close

Enter

Log in using OpenID

"Bitki Virüs Hastalıklarında Klonlama ve Gen Susturulması" Konulu

embedDownload
BİTKİ VİRÜS HASTALIKLARINDA GEN KLONLAMA VE
SUSTURULMASI
11 ARALIK 2013-26 MAYIS 2014
NEBRASKA ÜNİVERSİTESİ-LİNCOLN-NEBRASKA
BİTKİ PATOLOJİSİ BÖLÜMÜ
ABD
Dr. Hasan PINAR
Ziraat Yüksek Mühendisi
Alata Bahçe Kültürleri Araştırma İstasyonu
Erdemli/MERSİN
G. W. BEADLE BİYOTEKNOLOJİ
MERKEZİ
(Bitki Buluşları Merkezi)
ZİRAAT FAKÜLTESİ
DERSLER
• Genetik Prof. Dr. Don Lee
• Açık Tozlanan Bitkilerde Islah Metotları Prof. Dr. P. Stephen Baenziger
• Kendine Tozlanan Bitkilerde Islah Metotları Prof. Dr. P. Stephen
Baenziger
• Genler ve Germplazm Geliştirme Prof. Dr. P. Stephen Baenziger
• Bitki Büyüme ve Gelişme Konu Başlığı Altında Bitki Fizyolojisi Doç. Dr.
Tom Elthon
• Biyoteknolojik laboratuar uygulamaları (Bireysel) –Doç. Dr. Amitava
Mitra,
Biyoteknolojik laboratuar uygulamaları
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
-DNA izolasyon,
-RNA izolasyon,
-Protein İzolasyon,
-PCR metodları,
-Southern Blot(DNA düzeyinde herbiside dayanınıklılığın belirlenmesi)
-Western Blot(Protein düzeyinde herbiside dayanınıklılığın belirlenmesi)
-Northern Blot(RNA düzeyinde herbiside dayanınıklılığın belirlenmesi),
-Primer Dizayn,
-SSR Markırları ile genetik haritalama,
-PCR ile antibiyotiklere dayanınıklılığı sağlayan genlerden dizayn edilmiş
primerlerle domates, mısır, buğday, soyafasülyesi ve sorgum
genotiplerinde antibiyotiklere dayanınıklığın belirlenmesi,
Gen Klonlama,
Gen Transferi,
Gen susturma,
Eliza testlemesi,
Fungus ve virüs inokülasyonu
BİTKİ VİRÜSLERİ
• Uluslararası Virus Sınıflandırması Komitesi
Raporuna göre Dünyada 2012 yılına kadar
2,619 virüs türü rapor edilmiştir.
• 6 x 1010 Dolar (60.000.000.000) yıllık zarar
ÇÖZÜM
• Vektörlere karşı Kimyasal kullanımı
• Dayanıklı çeşit kullanımı
• a) Klasik yolla dayanıklılık genlerinin
aktarılması
• b) Direk gen transferi
• c) Gen susturulması
Mechanism/
Stratergies
employed
RNA interference
Transgenic
plant
Source/ gene product
common
bean
Replication initiator protein (rep; AC1), Bean golden mosaic virus
transactivator protein (TrAP; AC2),
(BGMV)
replication enhancer protein (REn; AC3)
and movement protein (BC1)
Aragão and Faira
(2009)
N. tabacum cv. ‘Xanthi, N.
benthamiana
replicase gene of PMMoV
(54-kDa-protein region)
Pepper mild mottle virus
(PMMoV)
Tenllado et al., 2004
N. benthamiana
150 bp N gene
segments of TSWV, GRSV, TCSV and
WSMoV
TSWV, Groundnut ringspot Bucher et al., 2006
virus (GRSV), Tomato
chlorotic spot virus (TCSV)
and Watermelon silver
mottle virus (WSMoV)
Nicotiana benthamiana
full-length (FL; 894 nucleotides), 397nucleotide N-terminal and 491nucleotide C-terminal portions of the
coat protein (CP) gene
Cassava brown streak
Uganda virus (CBSUV);
Cassava brown streak virus
(CBSV)
Patil et al 2010
partial Tobacco mosaic virus (TMV)
movement protein (MP) gene and the
partial
Cucumber mosaic virus (CMV)
replication protein (Rep) gene
Nicotiana benthamiana and a partial C2 gene from
Tomato
ToLCTWV and the middle half of the N
gene of
TSWV
Tobacco mosaic virus,
Cucumber mosaic virus
Hu et al., 2011
Tomato leaf curl Taiwan
virus
(ToLCTWV), Tomato
spotted wilt virus (TSWV)
Lin et al., 2011
Tomato
Tomato spotted wilt virus
(TSWV)
Goldbach et al.
(2003)
Nicotiana tabacum
Coat protein
meditaed
resistance
N gene
Virus
Reference
Replicase
Mediated
Resistance
Tobacco
Coat protein (CP)
Cucumber mosaic virus
sub
group IB
Srivastava and Raj
(2008)
N. benthamiana
Coat protein (CP)
Cowpea aphid-borne
mosaic
virus (CABMV)
Mundembe et al.
(2009)
Tobacco
Tobacco
Coat protein (CP)
Coat protein (CP)
cucumber mosaic virus
cucumber mosaic virus
Singh et al.(1998)
Jacquemond et al.
(2001)
Tobacco
Nicotiana tabacum
Coat protein (CP)
coat protein-mediated resistance (CPMR)
cucumber mosaic virus
TMV
Shin et al.(2002)
Bendahmane et al., 2007
Nicotiana tabaccurn
Xanthi-nn
coat protein (CP) and mutants of the CP
(CPT42W)
TMV
Bendahmane et al., 2002
Tobacco
coat protein-mediated resistance (CPMR)
TMV
Bendahmane and Beachy,
1999
N. benthamiana
capsid protein (CP)
Brome mosaic virus
(BMV)
Hema et al., 2010; Kao et al.,
2011
white clover (Trifolium
repens L.)
Coat protein gene (RNA4)
Alfalfa mosaic virus
(AMV)
Panter et al., 2012
Chrysanthemum
morifolium cv. Kundan
Coat protein (CP)
CMV
Kumar et al 2012
Tobacco
Modified tobacco mosaic virus
replicase transgene
Broad spectrum ressitance
to
Tobamoviruses
Donson et al.
(1993)
Potato
replicase gene ORF2b
potato leaf roll virus
(PLRV)
Vazquez Rovere et al., 2001
potato plants cv. Desirée
complete sense PLRV replicase gene
potato leaf roll virus
(PLRV)
Ehrenfeld et al., 2004
Lilium cv Acapulco
Defective CMV replicase gene (CMV2GDD)
cucumber mosaic virus
(CMV)
Azadi et al., 2011
Gladiolus
defective replicase gene
CMV
Kamo et al 2010
RNA dependent
RNA
polymerase
medited resistance
Tobacco
Gene encoding viral RNA
dependent RNA-polymerases
(RdRps)
Tobacco mosaic virus
Golemboski et al.
(1990)
RNA satellites
Pepper
Nicotiana benthamiana
and Arabidopsis thaliana
Sat-I17N
interfering satBaMV
cucumber mosaic virus
Bamboo mosaic virus
Kim et al. (1997)
Lin et al., 2013
N. tabacum cv Xanthi
satellite RNAs
CMV
Tomato
Sat-S
CMV-1
Palukaitis and Roossinck,
1996
Stommel et al. 1998
Tobacco
(CMV-D)
cucumber mosaic virus
Tobacco
ribosomeTobacco
inactivating proteins
(RIP)
Beta vulgaris L.
(CMV-Q)
TCS (Trichosanthes kirilowii)
cucumber mosaic virus
cucumber mosaic virus
beetins
Iglesias et al 2005
Ribonucleases
Tobacco
Tobacco
2-5Aase + RnaseL
pac1 (Yeast)
artichoke mottled crinkle
virus (AMCV)
cucumber mosaic virus
CMV, TMV, PVY
Enhancement
of HR/SAR
Tobacco
2-5Aase + RNaseL
cucumber mosaic virus
Honda et al.(2003)
Pepper
Tsi1 (Tobacco)
cucumber mosaic virus,
Pepper mild mottle virus
(PMMV)
Shin et al.(2002b)
Antisense
RNAs
Cuozzo et al.
(1988)
Ali et al.(1988)
Krishnan et al.
(2002)
Honda et al.(2003)
Watanabe et al. 1995
Nicotiana tabacum
TMV infection
TMV
Kathiria et al., 2010
Hammerhead
ribozyme
Tobacco
Conserved sequences of
RNA1 and 2 of CMV-Y
cucumber mosaic virus
Kwon et al.(1997)
microRNAs
A. thaliana
amiR-P69(159), amiR-HC-Pro(159)
and amiR- TuCP(159)
designed amiRNAs that target the
putative RISC accessible target sites
TYMV and TuMV
Niu et al., 2006
CMV
Duan et al., 2008
A. thaliana and N.
tabacum
N. benthamiana
Artificial miRNA targeting sequences CMV
encoding the silencing suppressor 2b
of CMV
amiRcp-8 targeting the 3′ end (nt735- PVY
nt754) region of PVY coat protein
Qu et al., 2007
tomato cv. Huafan
(A101)
Two amiRNAs, targeting the coding
sequence shared by the 2a and 2b
genes and the highly conserved 3'
untranslated region (UTR) of CMV
Zhang et al., 2011
Nicotiana benthamiana
amiRNAs targeting conserved motifs WSMoV
of the L (replicase) gene of
Watermelon silver mottle virus
(WSMoV)
amiR159-HCPro
TuMV
targeting 21 nucleotides in the Turnip
mosaic virus (TuMV)
Nicotiana tabacum
A. thaliana
Plantibodies
Tomato
Potato
ScFv antibodies
ScFv antibodies
Tobacco
Nicotiana benthamiana
ScFv antibodies
single-chain Fv fragments (scFvs)
antibodies
CMV
Cucumber mosaic virus
PVY
Jiang et al., 2011
Kung et al., 2012
Martínez et al., 2013
Villani et al.(2005)
Gargouri-Bouzid
et al.(2006)
Cucumber mosaic virus
Aebig et al.(2006)
Tomato bushy stunt virus Boonrod et al.
(TBSV)
(2004)
BL
Promoter
BR
Anti-sense
viral dizin
Linker
DNA
Sense terminator
viral dizin
hp-RNA
hairpin RNA (hp-RNA) konstrak
Dicer
Virus RNA
Virus sipesifik siRNA
RISC
Virus mRNA
parçalanması ve protein
üretilmez
Gen Susturulmasının Kullanım Alanları
• Terapi
– Aday genler, ilaç geliştirilmesi, ve terapi
• Genomda RNAi taraması
– Gen fonksiyonlarının belirlenmesi
– Aday genlerin ve ilaçların keşfi
• Sistem biyoloji
– Dayanım kazandırılması,
– Yeni maddelerin üretilmesi veya üretilmemesi
Virüslere Karşı Dayanım
www.nobelprize.org
1234 (1 virüs 4 gen) Turnip mosaic virus (TuMV)
•
•
•
•
•
•
•
•
•
•
TuMV1 (for 1234)
Atcccaaggacaagcaagcggaccatctatgaagcacaggttgacacagctacgcgatgtcatcaagtcaagctacccacgcttcaagcatgcagtgcagatactagataggtatgacgatggagtt
gaaaaagctgcattcccacacgtcaacaagctaaacgcaatattgatcaaaggggccacagtaacaggagaggaattctcgcaggctacgaagcacttgctcgagatagcacgatacctgaagaac
agaaccgagaacattgagaagggttcactgaagtcctttcgcaacaagatttcccagaaagcgcacatcaaacccaacactaatgtgtggacaaccagctcgatagaaatggaaatttcatatgggg
tgagagaggataccatgcaaaacgattcttcag
TuMV2
gagcggaataacggtgaactcgtaataaaatcacgacatggtgagttcgtgattaaaaacacaactcagctacacttgctaccgattccagacagagatcttctgctaatccggttaccaaaggacgt
cccaccctttccacagaaattgggtttcaggcaacctgagaaaggtgaacgaatttgcatggtggggtccaatttccaaaccaagagcataacgagtatagtctctgagactagtacaataatgccag
tggagaacagtcagttttggaaacactggattagcactaaagacggccaatgcggaagtccaatggtgagcacgaaagacgggaaaatactgggattacacagcctagcgaacttccagaactccc
atcaattactttgctgctttcccagatgattttgccgagaagtatcttcataccattgaagcacacgagtgggtcaagcactggaagtataacactagcgccatcagttggggctctttgaatatacaagc
atcgcaaccgtccggcttgttc
TuMV3
Agtgtggaacggtcgctgaaggcagagttgcgaccactagaaaaagtggaagcaaacaaaacacggacgtttactgccgcaccactagacacactgttgggtggaaaagtttgcttggatgatttca
acaaccagttctatgatcacaaccttagagctccttggagcgttggcatgacaaagttttattgtggttgggatcgcttgttggagtcgttgccagatggttgggtgtattgcgatgctgatggctcacagt
tcgacagctcgctatcgccatacttgatcaacgcagtactcaacatccgcttaggattcatggaagagtgggacataggggaggtaatgctgagaaatttgtacaccgaaatcgtgtatacccctatttc
tacaccagatggtacactcgtcaagaagttcaaaggaaacaatagcggacagccatcgactgttgtggacaacacgctcatggtcatattggcagtcaactattcactcaagaaaagcggaattcca
agtgagttgcgcgac sacI picked
TuMV4
Tgacagacgagcaaaagcaggcagagaaggagaagaaggagagagagaaggcagaaaaggaacgagagaggcaaaagcagttggcactcaagaaaggcaaggatgttgcacaagaagagg
gaaaacgcgacaaggaagtaaacgctggaacctgtggaactttcagtgtacccagactcaagagtctgacaagcaagatgcgcgtgccaagatacgagaaaagagtggctctaaacctcgatcatc
taatcctatacacgccggagcagacggatctatccaacacacgttcaacgcgaaagcagtttgacacatggtttgaaggtgtaatggctgattacgaactgacggaggacaaaatgcaaatcattctc
aatggtttaatggtctggtgcattgagaacggaacctccccgaacataaacggaatgtgggtgatgatggacggcgacgatcaggtggaattcccgatcaaaccgctcattgaccacgccaaaccca
catttaggc
1234 compile
Atcccaaggacaagcaagcggaccatctatgaagcacaggttgacacagctacgcgatgtcatcaagtcaagctacccacgcttcaagcatgcagtgcagatactagataggtatgacgatggagtt
gaaaaagctgcattcccacacgtcaacaagctaaacgcaatattgatcaaaggggccacagtaacaggagaggaattctcgcaggctacgaagcacttgctcgagatagcacgatacctgaagaac
agaaccgagaacattgagaagggttcactgaagtcctttcgcaacaagatttcccagaaagcgcacatcaaacccaacactaatgtgtggacaaccagctcgatagaaatggaaatttcatatgggg
tgagagaggataccatgcaaaacgattcttcaggagcggaataacggtgaactcgtaataaaatcacgacatggtgagttcgtgattaaaaacacaactcagctacacttgctaccgattccagaca
gagatcttctgctaatccggttaccaaaggacgtcccaccctttccacagaaattgggtttcaggcaacctgagaaaggtgaacgaatttgcatggtggggtccaatttccaaaccaagagcataacg
agtatagtctctgagactagtacaataatgccagtggagaacagtcagttttggaaacactggattagcactaaagacggccaatgcggaagtccaatggtgagcacgaaagacgggaaaatactg
ggattacacagcctagcgaacttccagaactcccatcaattactttgctgctttcccagatgattttgccgagaagtatcttcataccattgaagcacacgagtgggtcaagcactggaagtataacact
agcgccatcagttggggctctttgaatatacaagcatcgcaaccgtccggcttgttcAgtgtggaacggtcgctgaaggcagagttgcgaccactagaaaaagtggaagcaaacaaaacacggacgt
ttactgccgcaccactagacacactgttgggtggaaaagtttgcttggatgatttcaacaaccagttctatgatcacaaccttagagctccttggagcgttggcatgacaaagttttattgtggttgggat
cgcttgttggagtcgttgccagatggttgggtgtattgcgatgctgatggctcacagttcgacagctcgctatcgccatacttgatcaacgcagtactcaacatccgcttaggattcatggaagagtggga
cataggggaggtaatgctgagaaatttgtacaccgaaatcgtgtatacccctatttctacaccagatggtacactcgtcaagaagttcaaaggaaacaatagcggacagccatcgactgttgtggaca
acacgctcatggtcatattggcagtcaactattcactcaagaaaagcggaattccaagtgagttgcgcgacTgacagacgagcaaaagcaggcagagaaggagaagaaggagagagagaaggca
gaaaaggaacgagagaggcaaaagcagttggcactcaagaaaggcaaggatgttgcacaagaagagggaaaacgcgacaaggaagtaaacgctggaacctgtggaactttcagtgtacccaga
ctcaagagtctgacaagcaagatgcgcgtgccaagatacgagaaaagagtggctctaaacctcgatcatctaatcctatacacgccggagcagacggatctatccaacacacgttcaacgcgaaag
cagtttgacacatggtttgaaggtgtaatggctgattacgaactgacggaggacaaaatgcaaatcattctcaatggtttaatggtctggtgcattgagaacggaacctccccgaacataaacggaat
gtgggtgatgatggacggcgacgatcaggtggaattcccgatcaaaccgctcattgaccacgccaaacccacatttaggc
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Linker 1234 F Xba
ACT TAG tct aga TCC CTT CGG GAA GCG TGG CGC TTT CTC
Linker R 1234 Pst
ATG GAT ctg cag CTA GTG TAG CCG TAG TTA GGC CAC CAC
1234 we have
AAT CGA gga tcc ATC CCA AGG ACA AGC AAG CGG ACC
1234 R 1st Xba
AAC GTC tct aga CCT AAA TGT GGG TTT GGC GTG GTC
1234 2nd F Hind
TGA GTA aag ctt ATC CCA AGG ACA AGC AAG CGG ACC
1234 2nd R Pst
ACT CAT ctg cag CCT AAA TGT GGG TTT GGC GTG GTC
Linker 111 For
TGA GTA gtc gac TCC CTT CGG GAA GCG TGG CGC TTT CTC
111 we have
AAT CGA gga tcc ATC CCA AGG ACA AGC AAG CGG ACC
111 R 1st Sal
TTG AGT gtc gac GGT ACT ATG ACC ATA TCC CTC ATT
111 2nd F Hind
TCT GAT aag ctt ATC CCA AGG ACA AGC AAG CGG ACC
111 2nd R Pst
TTC CAT ctg cag GGT ACT ATG ACC ATA TCC CTC ATT
PCR
Ligation (Yapıştırma)
Digestion (Kesme)
E.Coli Transformasyon
Forvard primer 5’TGCACCATCGTCAACCACTA 3’
Reverse primer 5’ACAGCGACCACGCTGTTGAA 3’
Bar genini taşıyan plazmid
TERMİNATOR
RB
Nos
500
500
500
4321
500
500
Linker
500
500
1234
500
PROMOTOR
CaMV
LB
TERMİNATOR
RB
Nos
500
500
111
500
500
Linker
500
111
500
PROMOTOR
CaMV
LB
DOMATES
ELISA plate
NOTHERN BLOTTİNG
T2
WT
+
T2
19.3
19.3
7.7
7.7
6.2
6.2
3.5
3.5
kan ORF
WT
+
5.1 kb
PROTEİN
WESTERN BLOTTİNG
SEBZE TARIMI KONGRESİ-2014-TEKİRDAĞ
RECENT ADVENCES OF RNAi-MEDIATED GENE SILENCING IN PLANT BIOTECNOLOGY
•
•
•
•
•
•
•
•
Hasan PINAR1 Joydeep BANERJEE2
1 Alata Horticultural Research Station, Mersin-Turkey
•
2 University of Nebraska, Department of Plant Pathology, Lincoln-Nebraska-USA
[email protected]
•
Abstract
RNA interference (RNAi) is a well-established and important method for analyzing gene functions in
eukaryotes. It is a double-stranded RNA (dsRNA)- mediated gene-silencing phenomenon that is conserved
among various organisms, including animals and plants. Because of its high specificity and efficiacy, it has
been widely used as an efficient tool to analyze gene function.
RNAi pathway is initiated by dicer enzyme, which cleaves the larger dsRNA into small interfering RNA
(siRNA). siRNA is unwound into single stranded RNA and the guide strand is involved in the RNA-induced
silencing complex (RISC). The single stranded siRNA-mediated cleavage of the sequence specific
messenger RNA is carried out by Argonaute and subsequently lead to gene-silencing. In addition to this
type of post-transcriptional gene silencing, siRNAs also regulate transcriptional gene silencing by inducing
DNA-methylation.
RNAi has been reported to occur naturally in organisms such as nematodes, trypanosmes, plants and
fungi. RNA silencing is a conserved sequence-specific gene regulation system, which has an essential role
in the development and maintenance of genome integrity in a wide variety of organisms. In higher plants
and insects, RNA mediated silencing has been used for plant functional genomics, virus resistance in
plants, metabolic engineering of transgenic plants and to generate ınsect as well as nematode resistant
plants.
In this paper recent advences on RNAi-mediated gene silencing in plant biotecnological aplications have
been reviewed and discussed.
Key words: RNAi, gene silencing, plants
Effect of salt stress on seed germination, seedling growth and calli growth in
transgenic lines along with untransformed rice plant and salinity induced
expression of OsGLP1 in untransformed plant.
Alınan bu eğitimle;
-Moleküler yöntemlerde kullanmak üzere,
DNA, RNA, Protein izolasyonu,
Doku kültürü çalışmaları,
Doku kültürü ortamında stres uygulaması,
Primer dizayn,
GDO’lu ürün tespiti,
Elisa testi kullanarak hastalık testlemesi,
Genetik haritalama,
Klasik ve moleküler ıslah proğramı hazırlama,
Moleküler yardımıyla melezleme yoluyla gen aktarımı,
Gen klonlanması ve Susturulması
Gen transferi ve transfer edilmiş genlerin belirlenmesi,
Islah programlarında kullanmak üzere douple-haploid bitki elde
edilmesi yapabilir düzeye gelinmiştir.
Uygulamaya Aktarma
1-Biberde (Capsicum annum L.) Moleküler Markörler Kullanılarak Bazı Hastalık ve Zararlılara
Dayanıklı Hat Geliştirilmesi(Proje Lideri)
2-Domateste Moleküler Markörler Kullanılarak Bazı Hastalık ve Zararlılara Dayanıklı Hat
Geliştirilmesi(Proje Lideri)
3-Doğu Akdeniz Bölgesinde Badem Genetik Kaynaklarının Muhafazası, Değerlendirilmesi,
Morfolojik ve Moleküler Karakterizasyonu (Proje Lideri)
4- Türkiye’de Muz Seleksiyonu ve Karakterizasyonu-2 (Proje Lideri).
5- Doğu Akdeniz Bölgesinde Avakado Genetik Kaynaklarının Muhafazası, Değerlendirilmesi,
Morfolojik ve Moleküler Karakterizasyonu (Yardımcı Araştırmacı)
6- Bazı Yerli ve Yabancı Kayısı Çeşitlerinde Melezleme Islahı Üzerine Araştırmalar (Yardımcı
Araştırmacı).
7- Farklı Su Düzeyleri ile Potasyum Uygulamalarının Nar Meyvesinde (Punica granatum L.)
Çatlamaya Etkileri (Yardımcı Araştırmacı)
8- ‘Türkiye F1 Hibrit Sebze Çeşit ve Nitelikli Hat Geliştirme Projesi’nde (Tübitak 1007 )
Yardımcı Araştırmacı
9- Domateste Yüksek Sıcaklıklara Tolerant Nitelikli Hatların Belirlenmesi ve F1 Hibrit Çeşitlerin
Geliştirilmesi(Yürütücü-TUBİTAK 1007 alt iş paketi)
10- Domateste Düşük Sıcaklığa Tolerant Hatların Belirlenmesi ve F1 Hibrit Çeşit Geliştirilmesi
(Yürütücü-TUBİTAK 1007 alt iş paketi)
11- Biberde Kuraklığa Tolerant Nitelikli Hatların Belirlenmesi (Yürütücü-TUBİTAK 1007 alt
iş paketi)
12- Biberde Yüksek Sıcaklığa Tolerant Nitelikli Hatların Belirlenmesi ve F1 Hibrit Çeşit
Geliştirilmesi(Yürütücü-TUBİTAK 1007 alt iş paketi)
13- Biberde Nematoda Tolerant Nitelikli Hatların Geliştirilmesi(Yürütücü-TUBİTAK 1007 alt iş
paketi)
14- Domateste Tuza Dayanıklılık için Yüksek Çözünürlükte Haritalama (Araştırmacı-TUBİTAK
1001)
15- Alata Sarımsağının (Allium sativum L.) Meristem Kültürü ile Arındırılması ve Çoğaltılması
(Yardımcı Araştırmacı)
16- Ispanakta (Spinacia oleracea L.) Anter Kültürü ve Işınlanmış Polenle Tozlama Yöntemi ile
Haploidizasyon (Yardımcı Araştırmacı)
17- Türler Arası Melezleme İle Capsicum annuum’da Genetik Tabanının Genişletilmesi (Yardımcı
Araştırmacı)
18- BIO-INCROP Avrupa Birliği projesi (Yardımcı Araştırmacı)
19- Türk Biberlerinde Anter Kültürü Yoluyla Double Haploid Bitki Eldesi-Fito-Semilis Tohum Firması
İşbirliği Projesi-ÖZEL SEKTÖR (Yardımcı Araştırmacı)
20- Akdeniz bölgesi Muz alanlarında önemli bitki paraziti nematodlların yaygınlığı, popülasyon
dalgalanması ve zarar durumlarının belirlenmesi-TUBİTAK 1001 (Yardımcı Araştırmacı)
21- Kök Boğazı Yanıklığı Hastalığına (Phytophthora Capsici Leon.) Dayanıklı Karaisalı Biber Hattı
Geliştirilmesİ-TAGEM (Yardımcı Araştırmacı)
22- Mersin İlinde Doğal Yayılış Gösteren Keçiboynuzu (Ceratonia Siliqua L.) Genotiplerinin Srap
Tekniği İle Moleküler Karakterizasyonu-ORMAN VE SU İŞLERİ BAKANLIĞI-(Yardımcı
Araştırmacı)
23- Markır Yardımlı Seleksiyon ve Haploidi Yöntemi ile hastalıklara dayanıklı biber hatlarının
geliştirilmesi-TUBİTAK 1505 (Yardımcı Araştırmacı)
24- Türkiye Su kabağı (Lagenaria siceraria) Genetik Kaynaklarının Tuz Stresine Karşı Taranması
(Screening)-AB-COST-2515 (Yardımcı Araştırmacı)
25- Ülkemizde Bazı ‘Candidatus Phytoplasma prunorum’ İzolatlarının Moleküler Karekterizasyonu ve
16SrX grubundan ‘Ca. P. mali’, ‘Ca. P. pyri ve ‘Ca. P. prunorum izolatlarının virülenslik Düzeylerinin
Belirlenmesi-TAGEM-(Yardımcı Araştırmacı)
BİLGİ PAYLAŞIMI
1- 2010-2014 Yılları arasında 6 adet Biyoteknolojiyi
kullanabilen Alata Araştırma İstasyonunda Araştırmacı ve 8
teknisyen ve laborant eğitilmiştir.
2- Bakanlığımız Hizmet İçi Eğitim Kapsamında 120 mühendis
ve araştırmacıya Tarımsal Biyoteknoloji Eğitimi verilmiştir.
3- Haziran 2014’den bu yana Gen Klonlanması ve
Susturulması konusunda 8 adet araştırmacı ve 4 adet
Laborant teorik ve Uygulamalı olarak eğitilmektedir.
4- Eylül 2014’den itibaren Bakanlığımız Araştırma
kuruluşlarında ve bazı Üniversitelerde seminer verilecektir.
MAS (Moleküler Yardımıyla Seleksiyon)
KULLANILARAK DOMATESTE BAZI
HASTALIK VE ZARARLILARA DAYANIKLI HAT
GELİŞTİRİLMESİ
Dr. Hasan PINAR
Atilla ATA
Dr. Davut KELEŞ
Doç. Dr. Nedim MUTLU
Nihal DENLİ
Ceren EKŞİ
Halil GÜR
Klasik Islah metoduyla F1,’ler ve Islah hatlarında elde edilmiş Patojen Dayanıklıklıları






















Virus
Beet curly top virus (BCTV)
Tütün Mozaik Virüsü(TMV)
Domates Mozaik Virüsü(ToMV)
Domates Sarı Yaprak Kıvırcıklığı Virüsü(TYLCV)
Domates Lekeli solgunluk Virüsü (TSWV)
Bakteri
Corynebacterium michiganense
Pseudomonas solanacearum
Pseudomonas syringae pv. tomato
Nematod
Meloidogyne spp.
Mantar
Alternaria alternata f. sp. lycopersici
Alternaria solani
Cladosporium fulvum
Fusarium oxysporum f. sp. lycopersici
Fusarium oxysporum f. sp. radicis-lycopersici
Phytophthora infestans
Pyrenochaeta lycopersici
Stemphylium solani
Verticillium dahliae
Biberde (Capsicum annum L.) Moleküler Markörler
Kullanılarak Bazı Hastalık ve Zararlılara Dayanıklı Hat
Geliştirilmesi
Hasan PINAR
Dr. Davut KELEŞ
Atilla ATA
Duygu ALTUNÖZ
Nihal DENLİ
Ceren EKŞİ
Doç. Dr. Nedim MUTLU
Prof. Dr. Saadet BÜYÜKALACA
TSWV(Tsw)
0.87 cM
TSWV enfeksiyonundan kaynaklanan verim kayıp oranları % 30’ dan %100’ e kadar
değişebilmektedir (Cho ve ark., 1986; German ve ark., 1992).
Domates (Solanum lycopersicon L.)'te Tuza
Tolerans için Yüksek Çözünürlükte Haritalama
Prof. Dr. Sami DOĞANLAR
Dr. Davut KELEŞ
Hasan PINAR
TUBİTAK TOVAG 110O107
Biber’de (Capsicum annuum L.) Çinko Etkinliğini
Kontrol Eden Genlerin Kalıtımının Belirlenmesi ve Bu
Genlere Bağlı Moleküler Markırların Geliştirilmesi
Hasan PINAR
Doç. Dr. Nedim MUTLU
Dr. Davut KELEŞ
Atilla ATA
Prof. Dr. Saadet BÜYÜKALACA
A. Uluslararası hakemli dergilerde yayınlanan makaleler:
•
•
•
•
•
•
•
•
•
A1. Anne Frary, Denız Göl, Davut Keleş, Bılal Ökmen, Hasan Pınar, Hasan Ö Şığva, Ahmet Yemenıcıoğlu And
Samı Doğanlar 2010. Salt tolerance in Solanum pennellii: antioxidant response and related QTL BMC Plant
Biology 2010
A2. Frary, A., Pınar, H., Göl, D., Keles, D., Doğanlar, S. (2011) NaCI tolerance in Solanum pennellii
introgression lines: QTL related to physiological responses. BIOLOGIA PLANTARUM.
A3. Pınar, H., Unlu M., Ercisli, S. Uzun A., Bircan, M. Yilmaz, K.U., Agar, G..2013. Determination of genetic
diversity among wild grown apricots from Sakit valley in Turkey using SRAP markers Journal of Applied
Botany and Food Quality 86, 55 - 58 (2013)
A4. Pınar, H., Kaymak, S., Özongun, S., Uzun, A., Unlu, M., Bırcan, M. 2014. Fruit Quality and SRAP Markers
Based Genetic Diversity Analysis of Turkish Quince Germplasm SABRAO Journal of Breeding and Genetics.
(Değerlendirme Sürecinde)
A5. Pınar, H., ., Uzun, A., Unlu, M., Bırcan, M., Gülsen, O., Yilmaz, C., Gübbük, H., 2014. Identification of
Banana Accessions Sampled from Subtropical Region of Turkey Usıng Srap Markers In Turkey Bulgarian
Journal of Agricultural Science. (Değerlendirme Sürecinde)
A6. Pinar H., Ercisli, S., Unlu, M., Bircan, M., Uzun, A., Keles, D., Baysal, F., Atli H. S., Yilmaz, K. U.. 2014
Determınatıon Of Genetıc Dıversıty Among Some Almond Accessıons...Genetika (Kabul edildi).
A-7 Pinar H., Ercisli, S., Unlu, M., Bircan, M., Uzun, A., Yilmaz, K. U.. 2014 Determınatıon Of Self(In)Compatıbılıty In Some Turkısh Cultıvated And Wıld Aprıcots. Genetika (Kabul edildi)
A-8 Banerjee, J., Pinar, H. Effect of salinity stress and auxin treatment on the OsGLP1 down-regulated rice
plants Biochemical and Biophysical Research Communications (Değerlendirme Sürecinde)
A-9 Keles, D. Pinar, H., Ata, A. Taskın, H. Buyukalaca, S. 2014. Obtention of spontaneous dihaploid plants
via anther culture in different pepper types. Turkish Journal of Biology (Değerlendirme Sürecinde)
B. Uluslararası bilimsel toplantılarda sunulan ve bildiri kitabında (Proceedings) basılan
bildiriler :
•
•
•
•
•
•
•
•
•
B3. CANAN, I.., PİNAR, H., GULSEN, O., YİLMAZ, C., AGAR, T., 2009. Effect of 1-MCP, MAP, KMNO4 and
combinations on shelf life and eating quality of Anamur banana (Musa sp. dwarf cavendish)6th International
Postharvest Symposium. Antalya. TURKEY. Abstract Book. P-227
B4. GULSEN, O., UZUN, A., PINAR, H., CANAN, I., SEDAY, U., 2008. Surveying rumple disorder in a seven year-old
lemon orchard in Turkey. XI. International Citrus Congress, 26-30 October, Wuhan, China
B5. MUTLU, N., KELES, D., PINAR, H., ATA, A. (2011).Determination of heritability of zinc-efficiency in pepper
(Capiscum annum L.) and development of molecular markers linked to QTL/genes controlling zinc-efficiency.”3.
International Symposium on trace Elements&Health TRACEl 2011 May 2011 Murcia Spain . COST FA 0905
B6. PINAR,H., TÜRKAY, C., YILMAZ, C., BIRCAN, M., ÇAKIR, İ., KOZAK, B., PAYDAŞ, S. (2011). Sesonal Changes Of
Some Nutrition Elements In Banana (Dwarf Cavendish) Leaves In Turkey.II Balkan Symposium on Fruit Growing
(2011)
B7. PINAR,H., KAYMAK, S. ÜNLÜ, M., BIRCAN, M., UZUN, A. (2011) Determination of Self-Compatibility via
Molecular Marker in Some Apricot Cultivars in Turkey. II Balkan Symposium on Fruit Growing (2011)
B8. PINAR,H, ORTAS, I., KELES, D. (2012) Mycorrhizal dependency of different pepper genotypes. 2nd Symposium
on Horticulture in Europe July 1-5, 2012 Angers, FRANCE
B9. ATA, A., BÜYÜKALACA, S., KELEŞ, D., PINAR, H.2012. Determination of Relationship Between Culture Media,
Genotype and Season in Pepper (Capsicum Annuum L.) Anther Culture. Horticulture in Europa Angers/FRANCE
B10. ATA., A., BÜYÜKALACA, S., KELEŞ, D., PINAR, H., Denli., N.,.2011. Yüksek Sıcaklıklara Tolerant Biber
Genotiplerinde Anter Kültürüne Mevsim Etkisi. VI. Bahçe Bitkileri Kongresi-Şanlıurfa 4-7 Ekim Şanlıurfa
B11. PINAR, H., MUTLU, N., KELEŞ, D., ATA, A., BÜYÜKALACA, S., 2013. Determination of Soil Zinc Efficiency and
Symptoms of Some Pepper Species Soil Water Journal(2013) Vol 2, Number 2(1) p. 187-194
C. Yazılan ulusal/uluslararası kitaplar veya kitaplarda bölümler :
•
•
•
•
•
•
•
•
•
C1. H.Pınar., Muz Yetiştirciliği (2011).
D. Ulusal hakemli dergilerde yayınlanan makaleler :
D1. Pınar, H., Aras, V., Keleş, D., Ünlü, M., Mutlu, N., (2011) Karpuzda Fusarium Solgunluğuna
Dayanikliliğin Moleküler Markör Yardimiyla Belirlenmesi Alatarım Dergisi . 10 (2): 57-62
D2. Pınar,H., Türkay, C., Yılmaz, C., Bircan, M., Çakır, İ., Kozak, B., Paydaş, S. (2011). Anamur
Koşullarında Örtüaltında Yetiştirilen Muzların Beslenme Durumlarının İncelenmesi Alatarım Dergisi
10 (1): 26-33. 2011 Mersin
D3. Pınar, H., Türkay, C., Canan, I. (2007) Türkiye’de Muz Yetıştırıcılığı, Sorunları ve Çözüm Önerileri
Alatarım Dergısı 2007, 6 (2): 15-20 Erdemli.
D4. Türkay,C., Öztürk, H. H., Pınar, H., Hocagil, M. M (2006) Anamur Yöresindeki Muz Seralarının
Yapısal ve İşlevsel Özellikleri Dergisi Alatarım Aralık 2006 Mersin.
D5. Pınar, H. Ata, A. Keleş, D., Mutlu, N. (2013) Domateste Bazı Hastalık ve Zararlılara Dayanıklı Hat
ve Çeşit Geliştirmede Moleküler Markırların Kullanımı Alatarım Dergisi Haziran 2013 s: 36-43
D6. Pinar, H. Ata, A. Keleş, D., Mutlu, N., Denli, N., Unlu, M. 2013. Domates Hatlarında Fusarium
oxysporum f. sp. lycopersici’ye Dayanıklılığın Moleküler Markörler Yardımıyla Belirlenmesi Batı
Akdeniz Tarımsal Araştırma Enstitüsü Derim Dergisi, 2013, 30 (1):15-23
•
E. Ulusal bilimsel toplantılarda sunulan ve bildiri kitaplarında basılan bildiriler:
•
E1. Pınar, H., Kaymak, S. Özongun, Ş., Ünlü, M., Bırcan, M., Uzun, A.(2011) Bazı Ayva Genotipleri Arasindaki Genetik
Benzerliğin Srap Moleküler Markir Sistemiyle Belirlenmesi VI.Bahçe Bitkileri Kongresi-Şanlıurfa (Özet Kitabı)
E2. Pınar, H., Aras, V., Ünlü, M., Nacar, Ç.,, Mutlu, N., Keleş, D., Özden, Y. Ş., Ermiş, S. (2011) Bazı Karpuz Çeşit ve
Genotiplerinde Fusarium Solgunluğunun (Fusarium oxysporum f. sp. Niveum) 1 Numaralı Irkına Dayanıklılığın SCAR Markırı
(P01-700) ile Belirlenmesi VI.Bahçe Bitkileri Kongresi-Şanlıurfa
E3. Pınar, H. Ata, A. Keleş, D., Mutlu, N., Denli, N., Büyükalaca S., Özaslan, A.(2011) Bazı Elit Domates Hatlarında Mi
Dayanıklılık Geninin Moleküler Markırlarla Belirlenmesi VI.Bahçe Bitkileri Kongresi-Şanlıurfa
E4. Pınar,H., Bircan, M.,Türkay, C., Yılmaz, C.,( 2011) Bazı Muz Klonlarının Anamur Koşullarında Plastik Örtü Altında
Performanslarının Belirlenmesi VI.Bahçe Bitkileri Kongresi-Şanlıurfa
E5. Nacar, Ç., Pınar, H., Ünlü, M., Aras, V., Denli, N. Ve Keleş, D.(2012) Bazı yazlık kabak (Cucurbita pepo) Hatlarında Genetik
Farklılığın SRAP SRAP(Sequence-related amplified polymorphism) Marker Sistemleriyle Belirlenmesi VI.Bahçe Bitkileri
Kongresi-Şanlıurfa
E6. Pınar, H. Denli, N., Ata, A. Keleş, D., Büyükalaca S. (2011) Biberde Türlerarası Melezlemede Farklı Tarihlerde Yapılan
Embriyo Kurtarmasının Embriyo Sayısı Ve Bitkiye Dönüşüme Etkileri . IV Tohumculuk Kongresi.s.109-113 14-17 Haziran 2011
Samsun.
E7. Pınar, H. Ata, A. Keleş, D., Mutlu, N., Denli, N.(2011) Bazı Elit Domates Hatlarının Domates Lekeli Solgunluk Virüsü
(TSWV)’ne Dayanıklılığın Moleküler Markırlar Yardımıyla Belirlenmesi IV. Bitki Koruma Kongresi. S.409 28-30 Haziran
2011.Kahramanmaraş.
E8. Kaymak, S., Pınar, H., Uzun, A.., Boyraz, N. (2011) Bazı Elma Çeşitlerinin Pl-W Ve Pl1 Külleme Hastalığına (Podosphaera
Leucotricha) Dayanıklılık Genlerine Spesifik Scar Markörlerle Taranması IV. Bitki Koruma Kongresi. S.379 28-30 Haziran
2011.Kahramanmaraş.
E9. Pınar, H. Türkay, C., Denli, N., Ünlü, M., Bircan, M.(2011) Türkiye’de Muz Üretim Potansiyeli. GAP VI. Tarım Kongresi, 09–
12 Mayıs 2011, Şanlıurfa.
E10. Hocagil, M. Pınar, H. Ulun, A., Denli, N. 2010. Mersin İlinde İki Farkli Bölgeden Belirlenen Kum Zambaği (Pancratium
Maritimum L.) Genotiplerinin Genetik Farkliliklarinin SRAP ve RPAD Markirlari Yardimiyla Belirlenmesi IV. Süs Bitkileri
Kongresi Alata. MERSİN.
E11. Pınar, H., Yılmaz, C., Canan, İ. 2005. Anamur Koşullarında Örtü Altında Yetiştirilen Muzlarda Meyve Çatlaması ile Makro
ve Mikro Besin Maddeleri Arasındaki İlişki s.150-155 III.Bahçe Ürünlerinde Muhafaza ve Pazarlama Sempozyumu, AntakyaHatay.
E18. Keleş, D., Pınar, H. Ata, A. Mutlu, N., Denli, N.(2011)Domates Hatlarında Domates Sarı Yaprak Kıvırcıklığı Virüsüne
(TYLCV) Dayanıklılığın Moleküler Markırlar Yardımıyla Belirlenmesi9. Ulusal Sebze Tarımı Kongresi 12-14 Eylül 2012 Konya
(Özet Kitabı)
E19. Pınar, H. Ata, A. Keleş, D., Mutlu, N., Denli, N.(2012) Bazı Elit Domates Hatlarının Verticillium wilt’e Dayanıklılığın
Moleküler Markırlar Yardımıyla Belirlenmesi9. Ulusal Sebze Tarımı Kongresi 12-14 Eylül 2012 Konya (Özet Kitabı)
E20. Pınar, H. ve Mutlu, N. (2012) Domateste(Lycopersıcon Esculentum) Agrobacterıum Aracılığıyla Gen Transferi 9. Ulusal
Sebze Tarımı Kongresi 12-14 Eylül 2012 Konya (Özet Kitabı)
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
G1. Muz klonlarının Tescil Ettirilmesi
Türkiye’de Muz Seleksiyonu ve Karakterizasyonu projesi kapsamında ülkemizde üretimi yapılan muz
çeşitlerinden Anamur muzu(Dwarf cavendish), Grand nain ve Erdemli muzu olarak bilinen muz klonlarında
seleksiyon esnasında tescil gerçekleştirilmiş ve sertifikalı muz fidesi üretiminde kullanılmaktadır. Aynı proje
kapsamında yine ülkemizde yetiştiriciliği yapılan Azman yerel adıyla anılan muz klonunda seleksiyon
yapılmış ve tescil sürecine girmiştir.
G2. Badem Çeşitlerinin Tescil Ettirilmesi
Doğu Akdeniz Bölgesinde Badem Genetik Kaynaklarının Muhafazası, Değerlendirilmesi ve Karakterizasyonu
kapsamında 2 adet erkenci ve çağlaya uygun badem çeşit adayı belirlenmiş ve tescil için hazırlıklara
başlanmıştır.
G3- Karaisalı Biber Populasyonunun Seleksiyon Yoluyla Islahı projesi kapsamında yardımcı araştırmacı
olarak çalışmaktayım. Salçalık kalitesi yüksek ve verimli 4 adet çeşit adayı için tarla günü düzenlenmiş ve
tescile hazırlanmaktadır.
G4. Alata Bahçe Kültürleri Araştırma İstasyonu Biber Islahı programlarında geliştirilmiş 64 adet üstün
niteliklere sahip(Yüksek ve düşük sıcaklığa tölerant, verimli) sivri ve çarliston tipi biber hatları protokol
ile özel firmaya ıslahta kullanmak üzere devredilmiştir(Proje lideri ve yardımcı araştırıcı).
G5. Yine Alata Bahçe Kültürleri Araştırma İstasyonu Biber Islahı programlarında geliştirilmiş 40 adet üstün
niteliklere sahip(Yüksek ve düşük sıcaklığa tölerant, verimli, nematod ve TSWV virüsüne dayanıklı) sivri
ve çarliston tipi biber hatları özel firmalara devredilmek üzere arazi testleri gerçekelştirilmektedir(Proje
lideri ve yardımcı araştırıcı).
G6. MARAŞ BİBERİ 2 adet Çeşit Geliştirildi ve arazi denemeleri devam ediyor.
TEŞEKKÜRLER
Bakanlığımıza
Bana bu fırsatı sağladığı için
Ve sizlere beni sabırla dinlediğiniz için
Author
Document
Category
Uncategorized
Views
1
File Size
4 808 KB
Tags
1/--pages
Report inappropriate content