close

Enter

Log in using OpenID

Ders1-Amino asitler_Beslenme ve Diyetetik Bölümü

embedDownload
Amino & Proteinler
Prof. Dr. Suat Erdoğan
EBN Tıp Fakültesi
Tıbbi Biyokimya Anabilim Dalı
20 Şubat 2014
Sunum içeriği
• Proteinlerin genel tanımı
• Proteinlerin fonksiyonları
• Amino asitler
– yapıları
– sınıflandırılması
– esansiyel (zorunlu-elzem) ve esansiyel
olmayan amino asitler
• Amino asit yıkımına bağlı hastalıklar
Başlıca besin
ögeleri
3
Karbonhidratlar
Proteinler
Yağ
BESĠN
ÖGELERĠ
PROT
YAĞ
VĠT
Vitaminler
Mineraller
Su
CHO
SU
MĠN
Her bir besin
ögesinin
vucutta farklı
görevleri
vardır
bu 6 besin ögesinin
günlük gereksinim kadarı
mutlaka
alınmalıdır
Yeterli ve
dengeli
beslenmenin
kuralı olarak,
Amino asitler
DNA-mRNA-protein
DNA
CCTGAGCCAACTATTGATGAA
transkripsiyon
mRNA
CCUGAGCCAACUAUUGAUGAA
translasyon
Protein
PEPTİT
Sınıf
Monomer (alt ünite)
Karbonhidratlar
Lipidler
Proteinler
Nucleik Asitler
Şeker
Yağ Asitleri
Amino Asitler
Nükleotidler
Alt ünite
Polimer
Polisakkaritler
Yağlar, Fosfolipidler
Proteinler
(DNA, RNA)
Büyük Moleküller
Şekerler
Polisakkaritler
Yağ Asitleri
Yağlar/Lipidler/Membranlar
Amino Asitler
Proteinler
Nükleotidler
Nucleik Asitler
Organik Moleküller – Dört sınıf
Karbohidratlar
Proteinler
Lipidler
Nucleik Asitler
Proteinler:
yaşam için olmazsa olmaz
• Proteinler vücutta en fazla bulunan
organik bileşikler sınıfıdır.
• Vücut ağırlığı kuru maddesinin %
17’sini proteinler oluşturur.
• Proteinler «yaşamın yapı taşı" olarak
tanımlanabilir.
Proteinlerin fonksiyonları
•
•
•
•
•
•
•
•
•
Katalizör (enzimler)
Taşıma (hemoglobin, albumin)
Kontraksiyon (aktin, myozin)
Korunma (antikorler, IgG)
Yapı (kollagen, elastin, keratin)
Metabolizmanın regülasyonu (hormonlar)
Depolama (kazein, ovalbumin)
Hücresel haberleşme (reseptörler)
Beyin ve sinir sistemi (iyon kanalları)
Protein kaynakları
• Diyet ile alınan proteinler
(et, süt, balık, tahıllar vb)
sindirim sisteminde
yıkımlanarak amino
asitlere ayrıştırılır.
• Amino asitler kan
dolaşımına geçerek
50.000’den fazla vücut
proteinlerine
dönüştürülür.
Amino asitler
• Amino asitler, aralarında özel kovalent
bağlar ile bağlanır ve proteinlerin yapı
taşlarını (monomer) oluşturur.
• Proteinlerin özellikleri yapılarını
oluşturan amino asitlere bağlıdır.
• Amino aistler, taşıdıkları birbirinden
farklı yan zincirlerleri (R) ile ayrılır.
Protein monomeri
Amino asitlerin yapısı
• Proteinlerin yapısında bulunan
başlıca 20 amino asit yapısında bir
amino grubu, bir karboksil grubu, bir
hidrojen atomu ve a-karbon atomuna
bağlı bir yan zincir (R) bulundurur.
• Proteinlerin yapısında yer alan doğal
amino asitlerin tamamı L-a-amino
asittir.
L- and D-amino acids
Amino asitlerin yapısı
Karboksil grubu
Amino grubu
Yan zincir
A-karbon
Proteinlerin yapıtaşı olarak
amino asitler
pK2
pK1
Fizyolojik pH’da karoksilik ve amino prupları
iyonlaşmıştır konumdadır
Amino asitler amfolit
moleküllerdir
• Organizmada asit veya baz gibi
davranırlar
• pH 7.0’de amino asitler zwitter ion
formundadır
Amino asitlerin sınıflandırılması
• R grupların genel kimyasal
özelliklerine göre amino asitler 4 temel
gruba ayrılır:
1.
2.
3.
4.
Nonpolar amino asitler (apolar)
Negatif yüklü amino asitler (asidik)
Pozitif yüklü amino asitler (bazik)
Nötral amino asitler
Nonpolar amino asitler
Glisin, alanin, valin, lösin, izolösin,
metiyonin, fenilalanin, triptofan, prolin
Negatif yüklü amino asitler
(asidik)
Glutamat
(glutamik asit
Aspartat
aspartik asit)
Pozitif yüklü amino asitler
(bazik)
Arjinin, lizin, histidin
Nötral amino
asitler
Tirozin
Serin
Treonin
Asparajin
Glutamin
Sistein
Esansiyel ve esansiyel
olmayan amino asitler
• Vücutta üretilemediği için besinler ile
dışarıdan alınması zorunlu amino
asitlere “esansiyel amino asit” (zorunlu,
elzem) denir. Organizmada bunları
sentezleyebilecek enzim sistemleri
bulunmaz.
• Esansiyel olmayan (non-esansiyel)
amino asitler ise vücutta üretilebilir.
Esansiyel amino asitler
*
*Arjinin vücutta üretilse de üre sentezinde çoğu
kullanıldığından esansiyel konumundadır.
Besin maddelerindeki amino asitler
Proteinden zengin bazı
besinlerin biyolojik değeri
Biyolojik değer
• Besinler ile alınan ve bağırsaklardan
absorbe edilen proteinlerin vücut
proteinlerine dönüştürülme oranıdır.
• Proteinlerin yıkımlanabilme (hidroliz)
durumu ile vücutta yeni proteinlerin
sentezlenme gücünü gösterir.
Amino asit yıkımı
bozuklukları
Fenilketonüri (PKU)
• Genetik olarak gelişen en önemli amino asit
katabolizması bozukluğudur.
• PKU, fenilalanin hidroksilaz enzim yetmezliğine
bağlı olarak gelişir.
• Bu enzim yokluğunda fenilalanin amino asiti
vücutta birikir.
• Doğumdan hemen sonra teşhis edilmesi gerekir.
aksi halde bebekte mental gerilik ve geri
dönüşümsüz (irreverzible) diğer bazı bozukluklar
gelişir.
• PKU hastaları düşük fenilalanin içeren diyet ile
beslenmelidir.
PKU teşhisi-laboratuvar
Akçaağaç Şurubu İdrar Hastalığı
(Maple Syrup Urine Disease, MSUD)
• Bu hastalık dallı-zincirli ketoasidüri olarak da
bilirinir.
• Valin, Lösin ve İzolösinin ketoasitlerinin
dekarboksilasyonunda fonksiyon gören kompleks
ve mitokondrial enzim sistemi olan "dallı zincirli alfa
ketoasit dehidrogenaz" eksikliği vardır.
• Genetik olarak gelişir.
• Dallı zincirli aminoasitler ve bu aminoasitlerin
ketoasitleri, kanda ve idrarda yükselir.
• Bu ketoasitlerin kokusu Maple ağacından elde
edilen reçine kokusuna benzer.
• Hastalar doğumda normaldir.
Akçaağaç Şurubu İdrar Hastalığı
• Hayatın ilk haftasında kusma, beslenme
bozukluğu, tipik idrar kokusu saptanır.
• Hipoglisemi, ağır metabolik asidoz, konvülziyon
ve koma birkaç gün içinde gelişir.
• İlerleyici nörolojik ve mental bozukluk oluşur.
• Tedaviye 10 günlükten önce başlanırsa normal
büyüme ve gelişme sağlanır.
• Hayvansal protein diyetten çıkarılır. Yağ ve
karbohidrat verilir.
• Proteinden fakir sebze, meyve, nişasta ve
küçük bir bardak süt diyete eklenir. Diyet
tedavisi hayat boyu sürer.
Bunları bilin
• Temel bir amino asitin yapısı nedir
• Esansiyel ve non-esansiyel amino
asitler nelerdir
• Proteinlerin fonksiyonları
• Amino asit metabolizması bozuklukları
Author
Document
Category
Uncategorized
Views
2
File Size
2 794 KB
Tags
1/--pages
Report inappropriate content