close

Вход

Log in using OpenID

Amino asitler ve önemi - Prof. Dr. Suat Erdoğan

embedDownload
Amino asitler ve önemi
(2014-2015 Güz)
Prof. Dr. Suat Erdoğan
Zirve Üniversitesi, EBN Tıp Fakültesi
Tıbbi Biyokimya Anabilim Dalı
Sunum içeriği
•  Vücuttaki 4 makromolekül
•  Proteinlerin fonksiyonları
•  Amino asit nedir?
•  Amino asitlerin yapıları
•  İyonize formları
•  D ve L amino asitler
Organik moleküller- 4 sınıf
Lipidler
Karbonhidratlar
Proteinler
Nükleik asitler
Alt ünite (monomer)
Büyük Moleküller (polimer)
Şekerler (monosakkarit)
Polisakkaritler
Yağ Asitleri
Yağlar/Lipidler
Amino Asitler
Proteinler
Nükleotidler
Nükleik asitler (RNA, DNA)
DNA-mRNA-protein
DNA
CCTGAGCCAACTATTGATGAA
transkripsiyon
mRNA
CCUGAGCCAACUAUUGAUGAA
translasyon
Protein
PEPTİT
Proteinler: yaşam için olmazsa
olmaz
•  Proteinler vücutta en fazla bulunan organik
bileşikler sınıfıdır (vücut ağırlığı kuru maddesinin
% 17’si).
•  Proteinler "yaşamın yapı taşı (proteios = ilk
element)" olarak tanımlanabilir.
•  İnsan vücudunda bir milyon çeşitten fazla
protein olduğu düşünülmektedir.
•  Proteinlerin yapı taşları (monomer) amino
asitlerdir.
Proteinlerin fonksiyonları
•  Proteinler organizmada başlıca iki
şekilde rol oynarlar;
–  Yapısal (structural): kollagen, elastin,
büyüme, gibi.
–  Düzenleyici (regulatory): enzim, hormon,
vücut sıvı ve elektrolit dengesinin
korunması, gibi.
Biyokatalizör olarak
(enzimler)
Taşıma
(hemoglobin,
myoglobin)
Kontraksiyon (aktin, myozin flamentleri)
Membran proteinleri
(reseptör, kanal)
Kemik yapısının oluşumu (kollagen)
Bağışlık sistemi
(antikorlar, IgG)
Hücre içi sinyal iletimi
(metabolik olaylar)
Hormon yapısı
(regülasyon)
Depo görevi
(örn. sütte kalsiyumun
kazeinde depo edilişi)
Ovalbumin,
yumurta akı
proteinlerinin
%60-65’ini oluşturur
ve metal iyonları ile
glikoprotein depo
ettiği kabul edilir
Başlıca protein kaynakları
•  Diyet ile alınan proteinler
(et, süt, balık, tahıllar vb)
sindirim sisteminde
yıkımlanarak amino asitlere
ayrıştırılır.
•  Amino asitler kan
dolaşımına geçerek çok
sayıda vücut proteinlerine
dönüştürülür.
Amino asit nedir?
Amino asitler
•  Aralarında özel kovalent bağlar ile
bağlanır ve proteinlerin yapı taşlarını
(monomer) oluşturur.
•  Proteinlerin özellikleri, yapılarını
oluşturan amino asitlere bağlıdır.
•  Amino asitler birbirinden taşıdıkları
farklı yan zincirleri (R) ile ayrılır.
Proteinlerin monomeri
•  Memeli proteinleri 20 çeşit amino asitten
oluşur. İnsan DNA’sında yalnızca bu 20
amino asit kodlanmıştır.
•  Ancak doğada (örn. mikroorganizmalar) 300
çeşit amino asit tanımlanmıştır.
Amino asitlerin yapısı
•  Her bir amino asitte
tetrahedral α-karbon (Cα)
atomuna kovalent bağlı 4
farklı grup bulunur.
Bu 4 grup:
•  Amino grubu, NH2
•  Karboksil grubu, COOH
•  Hidrojen atomu, H
•  Farklı yan zincir R-grup
(her bir amino asite farklı
özellik kazandırır).
Amino asitlerin
iyonize formu
•  Fizyolojik pH’da (pH 7.4),
COOH grubu dissosiye olarak
(H ayrışarak) negatif yüklü
karboksilat iyonunu (COO–);
amino grubu ise
protonlanarak pozitif yüklü
NH3+ iyonu oluşturur.
•  Oluşan amino asit bir pozitif
ve bir negatif yük
taşıdığından, nötral bir
molekül durumundadır.
•  Sıfır net yük taşıyan iyonize
amino asit zwitterion olarak
adlandırılır.
•  Proteinler kan ve pek çok
dokuda zwitterion formunda
bulunur.
İyonize amino asit
Amino Asitlerin Fiziksel Özellikleri
Erime Noktası
•  Amino asitler
–  Ortalama molekül ağırlığı: 110 Da.
–  Oda sıcaklığında: katı-kristal form
–  Erime ısısı: 200 °C Þ
Çözünme
•  Amino asitler içerdikleri iyonize gruplar nedeniyle:
– Su, etanol, zayıf asit ve bazlarda çözünürken;
– Organik çözücülerde (benzen, eter) çözünmezler.
Amino asitlerin optik özellikleri
•  Amino asitlerin çoğunda (glisin hariç) αkarbon atomu asimetrik yapıdadır
(asimetri:α-C atomuna bağlı 4 kimyasal
grubun farklı olması).
•  Bu amino asitler optikçe aktif olarak
isimlendirilir.
•  Optikçe aktif amino asitler polarize ışığı
sağa veya sola çevirebilir.
α
α
Glisin Alanin Optik Aktivite: Polarize ışık düzleminin
sağa veya sola yönlendirilmesi
(+) Dekstrorotator-Sağ–saat yönü
(-) Levorotator-Sol-saat yönünün tersi
L- ve D- amino asitler
•  İnsan proteinlerinde yer alan tüm amino asitler
L-konfigürasyonundadır (=yapı)
(D-lizin, D-fenilalanin, gibi).
•  D-amino asitler ise bazı antibiyotik, bitki ve
bakteri duvarında bulunur.
Author
Документ
Category
Без категории
Views
0
File Size
8 438 Кб
Tags
1/--pages
Пожаловаться на содержимое документа