close

Enter

Log in using OpenID

Ders Programı

embedDownload
Özgün Çalışma/Original Article
Mikrobiyol Bul 2014; 48(1): 48-58
Klinik Örneklerden
Ö
İzole
İ
Edilen Acinetobacter
baumannii ve Pseudomonas aeruginosa Suşlarının
Sınıf 1 ve 2 İntegron Taşıyıcılığı ve Yeni Bir Gen
Kaseti Birlikteliği: blaOXA-11-cmlA7
Carriage of Class 1 and 2 Integrons in Acinetobacter baumannii
and Pseudomonas aeruginosa
a Isolated from Clinical Specimens
and a Novel Gene Cassette Array: blaOXA-11-cmlA7
Fırat Zafer MENGELOĞLU1, Ayşegül ÇOPUR ÇİÇEK2, Esra KOÇOĞLU1, Cemal SANDALLI3,
Emine Esra BUDAK3, Osman Birol ÖZGÜMÜŞ2
1
1
2
2
3
3
Abant İzzet Baysal Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Bolu.
Abant Izzet Baysal University Faculty of Medicine, Department of Medical Microbiology, Bolu, Turkey.
Recep Tayyip Erdoğan Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Rize.
Recep Tayyip Erdogan University Faculty of Medicine, Department of Medical Microbiology, Rize, Turkey.
Recep Tayyip Erdoğan Üniversitesi Fen Edebiyat Fakültesi, Biyoloji Bölümü, Rize.
Recep Tayyip Erdogan University Faculty of Arts and Sciences, Department of Medical Biology, Rize, Turkey.
Geliş Tarihi (Received): 24.09.2013 • Kabul Ediliş Tarihi (Accepted): 19.11.2013
ÖZET
Antibiyotik direnç genlerinin bakteriler arasındaki yayılımı, enfeksiyon hastalıklarının tedavisinde
ciddi sorunlar oluşturmaktadır. Son zamanlarda bu genlerin integronlarda da taşındığı gösterilmiştir.
Ülkemizde, Acinetobacter baumanniii ve Pseudomonas aeruginosa
a klinik izolatlarında sınıf 1 ve sınıf 2
integron taşıyıcılığıyla ilgili çalışmalar sınırlı sayıdadır. Bu çalışmada, Abant İzzet Baysal Üniversitesi
Hastanesinde, klinik örneklerden izole edilen A.baumannii ve P.aeruginosa
a suşlarında, sınıf 1 ve 2 integron taşıyıcılığının araştırılması ve antibiyotik direnç gen kasetlerinin dizi analiziyle karakterize edilmesi
amaçlanmıştır. Çalışmaya, Mart 2010-Aralık 2012 tarihleri arasında çeşitli klinik örneklerden (%56 balgam, %19 yara, %11 idrar, %11 kan, %3 kateter) izole edilen 77 A.baumanniii ve 60 P.aeruginosa
a olmak
üzere toplam 137 suş dahil edilmiştir. İzolatların tanımlanması ve antibiyogramları Vitek 2 Compact
(bioMérieux, Fransa) ve BD Phoenix 100 (Becton Dickinson, ABD) sistemleriyle yapılmıştır. Suşlarda
integron varlığı, sınıf 1 (intI1) ve sınıf 2 (intI2) integraz bölgeleri için özgül primer çiftleri kullanılarak
PCR yöntemiyle araştırılmış; integron amplifikasyonunun gerçekleştirildiği tüm örnekler, hem klonlanarak
hem de PCR ürünü olarak DNA dizi analizine tabi tutulmuştur. Çalışmada, A.baumanniii suşlarında en yük-
İİletişim (Correspondence):: Doç. Dr. Osman Birol Ö
Özgümüş, Recep Tayyip Erdoğan
ğ Ü
Üniversitesi Tıp Fakültesi,
Tıbbi
bbi Mikrobiyoloji
ik bi l ji Anabilim
bili Dalı,
l Rize,
i
Türkiye.
ü ki
Tell ((Phone)
h
): +90
90 464
6 212 3009,
3009
E-posta (E-mail):: [email protected]
Mengeloğlu FZ, Çopur Çiçek A, Koçoğlu E, Sandallı C, Budak EE, Özgümüş OB.
sek duyarlılık kolistin (%96) ve tigesiklin (%78), P.aeruginosa
a suşlarında ise piperasilin-tazobaktam (%97)
ve piperasiline (%93) karşı saptanmış; buna karşın A.baumannii suşlarında en yüksek direnç oranı (%95)
piperasilin/tazobaktama karşı gözlenmiştir. A.baumannii suşlarının %33 (26/77)’ünde, P.aeruginosa
suşlarının ise %10 (6/60)’unda intI1 geni tespit edilmiş; intI1 pozitif suşlarda değişken bölgeler PCR ile
çoğaltıldığında sekiz (8/77, %10) A.baumanniii ve üç (3/60, %5) P.aeruginosa
a suşunun antibiyotik direnç
gen kaseti taşıdığı belirlenmiştir. Suşların hiçbirisinde intI2 geni saptanmamıştır. İntegron pozitif olan tüm
A.baumanniii suşlarında piperasilin/tazobaktam, seftazidim, sefepim, seftriakson ve ampisilin/sulbaktama
karşı, integron pozitif tüm P.aeruginosa
a suşlarında ise seftazidim, gentamisin ve siprofloksasine karşı ortak
direnç paterni tespit edilmiştir. İntegronların DNA dizi analizleri, A.baumanniii [aacC1-aadA1 ve aac(3)-1]
ve P.aeruginosa
a (blaOXA-30-aadA1 ve blaOXA-11-cmlA7)
7 suşlarının ikişer farklı gen kaset dizisi taşıdığını göstermiştir. Ulaşabildiği kadarıyla, P. aeruginosa
a integron gen kaseti içerisinde tanımlanan blaOXA-11-cmlA7
gen dizilimi ilk kez bu çalışma ile tanımlanmış ve yeni bir gen dizilimi olarak literatüre sunulmuştur.
Anahtar sözcükler: Pseudomonas aeruginosa; Acinetobacter baumannii; integron; gen kaseti.
ABSTRACT
The dissemination of antibiotic resistance genes between bacteria leads to serious problems in the
treatment of infectious diseases. It has been shown that resistance genes can also be carried by the integrons. There are limited studies regarding the carriage of class 1 and 2 integrons in Acinetobacter baumannii and Pseudomonas aeruginosa
a clinical strains in Turkey. The aims of this study were to investigate
the carriage rates of class 1 and class 2 integrons in A.baumanniii and P.aeruginosa
a strains isolated from
clinical samples in Abant Izzet Baysal University Hospital, and to characterize the antibiotic resistance
gene cassettes in these integrons by sequence analyses. A total of 137 strains (77 A.baumanniii and 60
P.aeruginosa) isolated from various clinical specimens (56% were sputum, 19% wound, 11% urine, 11%
blood, 3% catheter), between March 2010-December 2012, were included in the study. The identification and antibiotic susceptibility tests of the isolates were performed by Vitek 2 Compact (bioMérieux,
France) and BD Phoenix 100 (Becton Dickinson, USA) systems. The presence of integrons were screened
by PCR method using specific primer pairs targeting class 1 (intI1) and 2 (intI2) integrase regions. All
the samples that revealed integron amplification were subjected to DNA sequence analysis, both in the
forms of cloned products and PCR amplicons. In the study, the highest susceptibility rates were found
against colistin (96%) and tigecycline (78%) in A.baumannii,
i and against piperacillin/tazobactam (97%)
and piperacillin (93%) in P.aeruginosa
a isolates. The highest resistance rate was determined for piperacillin/tazobactam (95%) in A.baumanniii strains. The presence of intI1 gene was detected in 33% (26/77)
of A.baumanniii and 10% (6/60) of P.aeruginosa
a isolates. When variable regions in intI1 positive strains
were amplified by PCR, eight (8/77, 10%) A.baumanniii and three (3/60, 5%) P.aeruginosa
a strains were
found to harbor antibiotic resistance gene cassettes. IntI2 gene was not detected in any of the isolates.
Resistance to piperacillin/tazobactam, ceftazidime, cefepime, ceftriaxone and ampicillin/sulbactam was
detected as the common resistance pattern in all integron-positive A.baumanniii strains, whereas resistance to ceftazidime, gentamicin and ciprofloxacin was the common pattern in all integron-positive
P.aeruginosa
a strains. DNA sequence analysis of variable regions of integrons indicated that two separate
gene cassette arrays (aacC1-aadA1 and aac(3)-1) were carried by A.baumanniii strains, and two types of
gene cassette arrays (blaOXA-30-aadA1 and blaOXA-11- cmlA7)
7 were carried by P.aeruginosa
a strains. To our
best knowledge, this is the first report of the gene sequence of blaOXA-11-cmlA7 defined in an integron
gene cassette of P.aeruginosa.
Key words: Pseudomonas aeruginosa; Acinetobacter baumannii; integron; gene casette.
MİKROBİYOLOJİ BÜLTENİ
49
Klinik Örneklerden İzole Edilen Acinetobacter baumanniii ve Pseudomonas aeruginosa
Suşlarının Sınıf 1 ve 2 İntegron Taşıyıcılığı ve Yeni Bir Gen Kaseti Birlikteliği: blaOXA-11-cmlA7
GİRİŞ
İ İ
Pseudomonas aeruginosa
a ve Acinetobacter baumannii,
i yoğun bakım üniteleri başta
olmak üzere hastane enfeksiyonlarında en sık izole edilen bakteriler olup, tedavilerinde
en önemli problem, çoğul dirençli suşların sayısında artış ve bunun sonucunda tedavide kullanılacak antibiyotik seçeneklerinde azalmadır1-6. Antimikrobiyal ilaç direncinin, bakteriler arasında yayılmasında en etkili mekanizmalardan biri konjugasyondur.
Konjugasyonda direnç genlerini taşıyan R-plazmidleri diğer DNA molekülleri gibi, transpozon veya integronları da taşıyabilirler. Transpozon ve integronlar, bir DNA molekülünden diğerine, homolog olmayan bölgelere integre olmak suretiyle transloke olabilen (yer
değiştirebilen) DNA elementleridir. Son yıllarda dikkatler, bakterilerde genetik birimlerin
transferine, yani mobil gen kasetleri ve integronlar üzerinde yoğunlaşmıştır. Gen kasetleri, genelde konak hücre DNA’sına integre olmuş gen topluluklarıdır7,8. Antibiyotik direnç
integronları terimi ise ilk kez Rowe-Magnus ve arkadaşları9 tarafından kullanılmıştır.
Direnç genlerini taşıyan plazmidler bakteriler arasında transdüksiyon, transformasyon,
konjugasyon ve transpozisyon gibi mekanizmalarla aktarılırlar. Bu rekombinasyon, integron denilen farklı bir DNA ailesi tarafından oluşturulmaktadır. İntegronlar antibiyotik
direnç determinantlarını kodlayan, belirli gen kasetlerini entegre etme veya taşıma yeteneğine sahip genetik elemanlardır. Sınıf 1 integronun yapısında bir 5’- ve 3’- korunmuş
segment (5’-CS ve 3’-CS) ve bir de değişken bölge vardır. 5’-CS, intI geni (integraz) ve
eklenen gen(ler)in ekspresyonu için kullanılan bir promoter bölge içerirken, 3’-CS defektif kuaterner amonyum direnç geni qacE∆1 ve sülfonamide direnç sağlayan sulII geni
içerir10,11. İki korunmuş bölge arasında bulunan değişken bölge, antibiyotik direnç gen
kasetlerinin girmesi için rekombinasyon yeridir. Sınıf 2 integronlar ise dihidrofolat redüktaz gen kaseti içermektedir ve sırasıyla trimetoprim, streptotrisin ve streptomisin/spektinomisine direnç sağlayan dfrA1, sat2 ve aadA1 gibi üç klasik gen kaseti taşımaktadır.
İntegronların tek başlarına hareket yetenekleri yoktur ve aynı zamanda içlerinde bir
ya da daha fazla gen kaseti taşıyabilirler. Bir bakteride birden fazla integron bulunabilir;
gen kasetlerinin düzeyi ve ekspresyonu, bakteride bulunan integron sayısına ve 5’ bölgesinde bulunan promotor bölgesinin aktif olmasına bağlıdır12,13. İntegronlar, plazmid
veya transpozonların içerisinde bulunduklarından dolayı, bir bakteriden diğerine, hatta
integronlar içerisinde yer alan gen kasetleri bir integrondan diğerine geçebilme özelliğine sahiptirler. Bu durum, antibiyotik direnç determinantlarının yayılmasına neden
olmaktadır. Bu çalışmada, klinik örneklerden izole edilen P.aeruginosa
a ve A.baumannii
suşlarının sınıf 1 ve sınıf 2 integronlar yönünden taranması ve taşıdıkları gen kasetlerinin
karakterize edilmesi amaçlanmıştır.
GEREÇ ve YÖNTEM
Suşlar ve Antimikrobiyal Duyarlılık Testleri
Çalışmaya, Abant İzzet Baysal Üniversitesi Tıp Fakültesi Hastanesinde, Mart 2010-Aralık
2012 tarihleri arasında mikrobiyoloji laboratuvarına gönderilen çeşitli klinik örneklerden
izole edilen 77 A.baumanniii ve 60 P.aeruginosa
a suşu dahil edildi. İzolatların tanımlanması
ve antibiyogramları
y g
Vitek 2 Compact
p
(bioMérieux, Fransa) ve BD Phoenix 100 (Becton
50
MİKROBİYOLOJİ BÜLTENİ
Mengeloğlu FZ, Çopur Çiçek A, Koçoğlu E, Sandallı C, Budak EE, Özgümüş OB.
Dickinson, ABD) otomatize sistemleri kullanılarak yapıldı. Antimikrobiyal duyarlılık
deneyleri CLSI (Clinical and Laboratory Standards Institute) kriterlerine uygun olarak
değerlendirildi14. Acinetobacterr suşlarının tigesiklin ve kolistine duyarlılıkları BSAC (British
Society for Antimicrobial Chemotherapy) kriterlerine göre yorumlandı15.
P.aeruginosa
a suşları için amikasin (AK), gentamisin (GN), siprofloksasin (CİP), seftazidim (CAZ), piperasilin (PRL), piperasilin-tazobaktam (TZP), aztreonam (ATM), meropenem (MEM), sefepim (FEP) ve imipenem (İPM) duyarlılığı; A.baumanniii için AK, GN,
CİP, CAZ, TZP, FEP, İPM, tetrasiklin (TE), seftriakson (CRO), sulbaktam/ampisilin (SAM),
trimetoprim-sülfametoksazol (SXT), tobramisin (TOB), kolistin (CT) ve tigesiklin (TGC)
duyarlılığı değerlendirildi. Kalite kontrol suşu olarak P.aeruginosa
a ATCC 27853 kullanıldı.
Total DNA İzolasyonu ve İntegrona Özgül Polimeraz Zincir Reaksiyonu (PCR)
Kalıp DNA eldesi için bakteri suşları 3 ml Luria-Bertani (LB) sıvı besiyerine (%1 tripton,
%0.5 maya ekstraktı, %0.5 NaCl, pH 7.4) inoküle edildi ve 16 saat 37oC’de çalkalamalı
inkübatörde üretildi. Kültürün 1.5 ml’si ependorf tüpüne alınarak 10.000 rpm’de 5 dk
çöktürüldü. Çökelti sıvısının üst kısmı atıldı; çökeltideki hücreler 500 μl deiyonize suda
çözüldü ve 95oC’ de 10 dk ısıtılarak parçalandı. Preparat, 13.000 rpm’de 5 dk santrifüjlenerek çöktürüldü. Üst kısmın 1-3 μl’si PCR’de kalıp DNA olarak kullanıldı16.
Bütün izolatlar, öncelikle korunmuş sınıf 1 (intI1) ve sınıf 2 (intI2) integraz bölgeleri
için araştırıldı. Bu amaçla, intI1 için intI1F (ACATGTGATGGCGACGCACGA) ve intI1R
(ATTTCTGTCCTGGCTGGCGA); intI2 için intI2F (CACGGATATGCGACAAAAAGGT) ve
intI2R (GTAGCAAACGAGTGACGAAATG) primer çiftleri kullanıldı. intI1 bölgesi için pozitif sonuç alındığında, 5’-CS ileri primeri (GGCATCCAAGCAGCAAG) ve 3’-CS geri primeri (AAGCAGACTTACCTGA) kullanılarak değişken bölgeler çoğatıldı10. Standart PCR
karışımları 50 μl son hacim olacak şekilde; 1.5 ünite DNA polimeraz I (GoTaq, Promega),
5 μl DNA, 10 μl 5X DNA polimeraz tamponu (Promega), 3 μl 1.5 mM MgCl2, 5 μl 2 mM
her bir dNTP ve 2 μl her bir primer stoğu (25 pmol/μl) ve son hacim steril deiyonize su
ile 50 μl’ye tamamlanarak hazırlandı. Amplifikasyon koşulları; 5 dk 96°C, 1 dk 55°C, 3 dk
70°C (bir döngü); 15 sn 96°C, 30 sn 55°C, 3 dk 70°C (24 döngü) ve son sentez 5 dk
70°C (bir döngü) olacak şekilde programlandı10. Amplifikasyon ürünleri %1.4’lük agaroz jelde yürütüldü ve görüntülendi. İntegron amplifikasyonunun gerçekleştirildiği tüm
örnekler, hem klonlanarak hem de PCR ürünü olarak baz dizisi analizine tabi tutuldu.
Agaroz Jel Elektroforezi ve DNA Klonlama
Plazmidler ve PCR ürünleri agaroz jel elektroforezinde yürütülerek UV’de görüntülendi. Plazmidler için %1’lik, PCR ürünleri için ise %1.4’lük agaroz jel (0.5 μg/ml etidyum
bromür katkılı) kullanıldı. Yürütme, 100V doğru akım altında 45 dakika olarak gerçekleştirildi. Tam integron genleri çoğaltıldı ve üretilen PCR ürünlerinin, pGEM-T klonlama
vektörüne ligasyonu üretici firmanın önerileri doğrultusunda sağlandı. Ligasyon ürünleri,
E.coli DH5α kompetan hücrelerine ısı şoku ile transforme edildi. Transformasyon sonrası
hücreler ampisilin, IPTG ve X-gal içeren seçici LB agara ekilerek mavi/beyaz koloni oluşumuna bakıldı ve beyaz kolonilerden plazmid izole edilerek pozitif klonlar belirlendi17.
İzole edilen bu plazmidler
p
EcoRI restriksiyon
y enzimi ile kesilerek ayrıca
y
doğrulandı.
ğ
Pozitif
MİKROBİYOLOJİ BÜLTENİ
51
Klinik Örneklerden İzole Edilen Acinetobacter baumanniii ve Pseudomonas aeruginosa
Suşlarının Sınıf 1 ve 2 İntegron Taşıyıcılığı ve Yeni Bir Gen Kaseti Birlikteliği: blaOXA-11-cmlA7
olduğu doğrulanan plazmidleri içeren rekombinant hücreler tekrar çoğaltılarak plazmid
DNA saflaştırma kiti kullanılarak DNA dizi analizi için tekrar izole edildi. İzole edilen
plazmid DNA örnekleri baz dizisi analizi için Macrogen firmasına (Amsterdam, Hollanda)
gönderildi ve hem T7 promotor hem de SP6 bölgelerinden dizi analizi gerçekleştirildi.
PCR ürünlerinden de teyit amaçlı dizi analizi yapıldı ve PCR ürünlerinin baz dizisi analizi,
değişken bölgeleri çoğaltmak için kullanılan 5’CS ve 3’CS primerleri ile gerçekleştirildi18.
Dizileme sonuçları NCBI biyoinformatik sitesi kullanılarak analiz edildi.
BULGULAR
Çalışmaya alınan 77 A.baumanniii suşunun %49.4’ü balgam, %20.8’i yara, %18.2’si
kan, %9.1’i idrar ve %2.6’sı kateter örneklerinden; 60 P.aeruginosa
a suşunun ise %62.7’si
balgam, %16.9’u yara, %13.6’sı idrar ve %3.4’ü kan örneklerinden izole edilmiştir.
İzolatların antibiyotiklere karşı duyarlılık oranları Tablo I’de görülmektedir. Buna göre
A.baumannii suşlarında en yüksek duyarlılık kolistin (%96.1) ve tigesikline (%78),
P.aeruginosa
a suşlarında ise piperasilin-tazobaktam (%96.6) ve piperasiline (%93.2) karşı
saptanmıştır (Tablo I).
Tablo I. A.baumannii ve P.aeruginosa Suşlarının Antimikrobiyal Duyarlılık Oranları
Acinetobacter baumanniii (n= 77)
Antibiyotik
Pseudomonas aeruginosa
a (n= 60)
Duyarlı
Orta duyarlı
Dirençli
Duyarlı
Orta duyarlı
Dirençli
n (%)
n (%)
n (%)
n (%)
n (%)
n (%)
PRL
-
-
-
56 (93.2)
1 (1.7)
3 (5.1)
TZP
3 (3.9)
1 (1.3)
73 (94.8)
58 (96.6)
0
2 (3.4)
SAM
5 (6.5)
5 (6.5)
67 (87)
-
-
-
CAZ
4 (5.2)
2 (2.6)
71 (92.2)
50 (83.1)
1 (1.7)
9 (15.3)
FEP
6 (7.8)
0
71 (92.2)
52 (86.4)
4 (6.8)
4 (6.8)
CRO
4 (5.2)
1 (1.3)
72 (93.5)
-
-
-
ATM
-
-
-
42 (69.5)
12 (20.3)
6 (10.2)
IPM
13 (16.9)
8 (6.5)
59 (76.6)
50 (83.1)
1 (1.7)
9 (15.3)
MEM
-
-
-
54 (88.1)
1 (1.7)
5 (8.5)
TOB
45 (58.4)
0
32 (41.6)
-
-
-
AK
11 (14.3)
3 (3.9)
63 (81.8)
52 (86.4)
1 (1.7)
7 (11.9)
GN
35 (45.5)
6 (7.8)
36 (46.8)
47 (78)
5 (8.5)
8 (13.6)
SXT
16 (20.8)
2 (2.6)
59 (76.6)
-
-
-
TE
17 (22.1)
8 (10.4)
52 (67.5)
-
-
-
TGC
70 (77.9)
17 (22.1)
0
-
-
-
CİP
5 (6.5)
0
72 (93.5)
49 (81.4)
1 (1.7)
10 (16.9)
CT
74 (96.1)
0
3 (3.9)
-
-
-
AK: Amikasin; ATM: Aztreonam; CAZ: Seftazidim; CİP: Siprofloksasin; CRO: Seftriakson; CT: Kolistin;
FEP: Sefepim; GN: Gentamisin; IPM: İmipenem; MEM: Meropenem; PRL: Piperasilin; SAM: Sulbaktam/ampisilin;
SXT: Trimetoprim-sülfametoksazol; TE: Tetrasiklin; TGC: Tigesiklin; TOB: Tobramisin; TZP: Piperasilin-tazobaktam;
(-): Test edilmedi.
52
MİKROBİYOLOJİ BÜLTENİ
Mengeloğlu FZ, Çopur Çiçek A, Koçoğlu E, Sandallı C, Budak EE, Özgümüş OB.
A.baumanniii suşlarının %33 (26/77)’ünde intI1 geni tespit edilmiş; intI1 pozitif suşlarda değişken bölgeler PCR ile çoğaltıldığında 8 (%30.7) suşun antibiyotik direnç gen
kaseti taşıdığı belirlenmiştir. Tüm suşlarda ise %10.1 oranında gen kaseti taşıyan integron
saptanmıştır. DNA dizi analizleriyle gen kasetlerinin aacC1-aadA1 ve aac(3)-II diziliminde iki farklı tipte olduğu belirlenmiştir. aacC1 geni aminoglikozid N(3’) asetiltransferaz
enzimi kodlamaktadır ve gentamisine direnç sağlamaktadır. aadA1 geni aminoglikozid
adeniltransferaz enzimi kodlamaktadır ve streptomisin/spektinomisine direnç sağlamaktadır. aac(3)-II geni ise aminoglikozid 3-N-asetil transferaz enzimini kodlamaktadır ve
gentamisin, sisomisin ve fortimisine direnç sağlamaktadır. Yedi Acinetobacterr suşunun
aacC1-aadA1 dizilimine sahip sınıf 1 integron taşıdığı belirlenirken, bir Acinetobacter’in
r
aac(3)-II kaseti içeren sınıf 1 integron taşıdığı belirlenmiştir (Tablo II). Tespit edilen sınıf
1 integronların genetik yapıları Şekil 1’de şematik olarak gösterilmiştir. Bakteri suşlarının
hiçbirinde intI2 integraza rastlanmamıştır.
P.aeruginosa
a suşlarının %10 (6/60)’unda intI1 geni belirlenmiş; intI1 pozitif suşlarda
değişken bölgeler PCR ile çoğaltıldığında 3 (%50) suşun antibiyotik gen kaseti taşıdığı
belirlenmiştir. Tüm suşlarda ise %5 oranında gen kaseti taşıyan integron saptanmıştır.
Gen kasetlerinin blaOX
-aadA1 ve blaOXA-11- cmlA7
7 diziliminde iki farklı tipte olduğu
OXA-30
izlenmiştir. İki örneğin blaOXA-30-aadA1 dizilimine, bir örneğin cmlA17-blaOXA-11 dizilimine sahip olduğu saptanmıştır (Tablo II). blaOXA-11-cmlA7
7 gen kaset dizilimi yeni bir
kombinasyon olup, genetik yapısı Şekil 1’de şematik olarak gösterilmektedir. blaOXA-11
geni grup 1 okzasilinaz enzimleri, blaOXA-30 geni ise grup 3 okzasilinaz enzimleri kodlamaktadır ve beta-laktamlara direnç sağlamaktadır. cmlA7
7 geni kloramfenikol direnç proteini kodlamaktadır ve kloramfenikole enzimatik olmayan bir yolla direnç sağlamaktadır.
Suşların epidemiyolojik özellikleri Tablo II’de görülmektedir. Üç Pseudomonass suşu
(P23, P44 ve P60) aynı hastanın farklı zaman ve klinik materyallerinden izole edilmiş,
farklı fenotip ve genotipteki etkeni olarak tespit edilmiştir (Tablo II). Örneklerin hiçbirinde intI2 geni saptanmamıştır. İntegron pozitif olan tüm A.baumannii suşlarında piperasilin/tazobaktam, seftazidim, sefepim, seftriakson ve ampisilin/sulbaktam antibiyotiklerine
karşı, integron pozitif tüm P.aeruginosa
a suşlarında ise seftazidim, gentamisin ve siprofloksasin antibiyotiklerine karşı direnç ortak olarak gözlenmiştir.
TARTIŞMA
Bakteriler arasında beta-laktamlar, kinolonlar, karbapenemler ve aminoglikozidlere
direncin hızlı yayılımı, enfeksiyon hastalıklarında ciddi ve artan bir sorundur. Son çalışmalar direnç genlerinin integronlar ile yayılabileceğini göstermektedir1,2. İntegron gen
kasetlerinde çok sayıda farklı direnç genleri bulunabilir. Farklı sınıftan beta-laktamaz
genleri (A, B ve D sınıfı) ile aminoglikozid direnç genleri integron gen kasetleri içerisinde bulunabilir. Aminoglikozid modifiye edici enzimlerin (AMEs) üretimi, bakterilere
antibiyotiklerin amino ve hidroksil fonksiyonlarını modifiye etme yeteneği kazandırır. Bu
yetenek bakterilerin aminoglikozidlere direnç göstermesinin en önemli yoludur. AMEs,
aminoglikozid asetiltransferaz (AAC), aminoglikozid adeniltransferaz (AAD), aminoglikozid fosfotransferaz (APH)
(
) ve bu enzimlerin izoenzimlerini kapsar
p 19. Sunulan bu çalışmaç ş
MİKROBİYOLOJİ BÜLTENİ
53
54
KBB
Ocak 2012
Kasım 2010
Eylül 2010
Temmuz 2010
Ağustos 2010
Mayıs 2011
Kasım 2010
Mart 2012
Ekim 2010
Mart 2012
Ağustos 2010
Haziran 2011
Eylül 2010
Mart 2011
Nisan 2011
Nisan 2010
Şubat 2011
Haziran 2012
Ocak 2012
Eylül 2011
Ağustos 2011
Mart 2011
A16
A25
A39
A43
A44
A48
A50
A54
A56
A59
A62
A64
A66
A67
A70
A72
A74
A78
A80
A83
A85
A88
AR
K
AR
AR
KDC
KDC
Üroloji
BC
AR
GC
İH
Üroloji
AR
AR
AR
AR
KDC
Üroloji
Üroloji
Nöroloji
AR
Hastane
ünitesi
İzolasyon
tarihi
Suş
Kan
Balgam
Kan
Yara
Balgam
Yara
İdrar
Kan
Balgam
Yara
Yara
Yara
Balgam
Balgam
Kan
Balgam
Yara
Yara
İdrar
Balgam
Yara
Yara
Klinik
örnek
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
TOB, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
TOB, AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, GN, İPM, CİP
TOB, AK, TZP, CAZ, FEP, CRO, SAM, GN, TE, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, GN, TE, İPM, CİP
TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, GN, TE, İPM, CİP
Antibiyotik direnç paterni
Tablo II. A.baumannii ve P.aeruginosa Suşlarının Epidemiyolojik Özellikleri
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
intI1
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
intI2
+
-
-
+
-
-
+
-
-
-
-
-
-
-
-
-
-
+
+
+
-
+
5’ - 3’ DB
aacC1-aadA1
Boş integron
Boş integron
aacC1-aadA1
Boş integron
Boş integron
aacC1-aadA1
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
aacC1-aadA1
aacC1-aadA1
aacC1-aadA1
Boş integron
aacC1-aadA1
Gen kaseti dizilimi
Klinik Örneklerden İzole Edilen Acinetobacter baumanniii ve Pseudomonas aeruginosa
Suşlarının Sınıf 1 ve 2 İntegron Taşıyıcılığı ve Yeni Bir Gen Kaseti Birlikteliği: blaOXA-11-cmlA7
MİKROBİYOLOJİ BÜLTENİ
MİKROBİYOLOJİ BÜLTENİ
Ocak 2012
Nisan 2012
Ekim 2010
Ocak 2012
Haziran 2012
Ocak 2012
Mayıs 2012
Ocak 2012
Temmuz 2012
Ocak 2012
A90
A92
A98
A99
P11
P23*
P44*
P45
P49
P60*
Nöroloji
İH
AR
Acil
Acil
GH
AR
İH
Acil
AR
Hastane
ünitesi
Balgam
Balgam
Balgam
Balgam
İdrar
Balgam
Kan
İdrar
Kan
Kan
Klinik
örnek
MEM, CAZ, GN, İPM, CİP
PRL, AK, TZP, ATM, MEM, CAZ, FEP, GN, İPM, CİP
AK, GN, CİP
CAZ, FEP, GN, İPM, CİP, AK
MEM, CAZ, GN, İPM, CİP
-
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
TOB, AK, TZP, SXT, CAZ, FEP, CRO, SAM, TE, İPM, CİP
Antibiyotik direnç paterni
+
+
+
+
+
+
+
+
+
+
intI1
-
-
-
-
-
-
-
-
-
-
intI2
+
+
-
+
-
-
-
-
-
+
5’ - 3’ DB
blaOXA-11-cmlA7
blaOXA-30- aadA1
Boş integron
blaOXA-30-aadA1
Boş integron
Boş integron
Boş integron
Boş integron
Boş integron
aac(3)-I
Gen kaseti dizilimi
*: Aynı kişiye ait suşlar.
A: A.baumannii;
i AK: Amikasin; AR: Anestezi ve reanimasyon; ATM: Aztreonam; BC: Beyin ve sinir cerrahi; CAZ: Seftazidim; CİP: Siprofloksasin; CRO: Seftriakson;
CT: Kolistin; DB: Değişken bölge; EH: Enfeksiyon hastalıkları; FEP: Sefepim; GC: Genel cerrahi; GH: Göğüs hastalıkları; GN: Gentamisin; İH: İç hastalıkları; IPM: İmipenem;
K: Kardiyoloji; KBB: Kulak burun boğaz hastalıkları; KDC: Kalp damar cerrahi; MEM: Meropenem; P: P.aeruginosa; PRL: Piperasilin; SAM: Sulbaktam/ampisilin;
SXT: Trimetoprim-sülfametoksazol; TE: Tetrasiklin; TGC: Tigesiklin; TOB: Tobramisin; TZP: Piperasilin-tazobaktam.
İzolasyon
tarihi
Suş
Tablo II. A.baumannii ve P.aeruginosa Suşlarının Epidemiyolojik Özellikleri (Devamı)
Mengeloğlu FZ, Çopur Çiçek A, Koçoğlu E, Sandallı C, Budak EE, Özgümüş OB.
55
Klinik Örneklerden İzole Edilen Acinetobacter baumanniii ve Pseudomonas aeruginosa
Suşlarının Sınıf 1 ve 2 İntegron Taşıyıcılığı ve Yeni Bir Gen Kaseti Birlikteliği: blaOXA-11-cmlA7
Şekil 1. A.baumannii ve P.aeruginosa suşlarında tespit edilen sınıf 1 integronların genetik yapılarının şematik
gösterimleri [Siyah daireler integronun 59-baz elemanlarını (rekombinasyon bölgeleri), beyaz daireler ise
integraz (attI) bölgesini göstermektedir. qacE∆1 kuaterner amonyum maddelerine direnç geni, sul1 ise sülfanomidlere dirençç genidir).
g
)
da, A.baumannii’de
i
AAC ve AAD varyantlarının baskın olarak bulunduğu, P.aeruginosa’da
ise AAD varyantının bulunduğu gösterilmiştir. Her iki türde aminoglikosidaz enzimlerinin
üretilmesi, bu türlere ait suşlarda aminoglikozid direncinin nedenini ve aktarılabilme
potansiyelini göstermektedir. Beta-laktamaz genlerinden D sınıfına ait okzasilinaz
kodlayan OXA-11 ve OXA 30 alelleri ise sadece P.aeruginosa’da integron gen kasetleri
içerisinde belirlenmiştir. OXA-tipi beta-laktamazlar oksasilin ve kloksasilini parçalayarak
direnç oluştururlar. İki P.aeruginosa
a suşunda OXA-tipi beta-laktamaz kodlayan genlerin
integronlar üzerinde bulunması, bu genin P.aeruginosa
a suşundan başka suş veya türlere
aktarılmasına aracılık edebilir.
Bakterilerde bulunan cmll direnç genleri, kloramfenikol antibiyotiğine karşı direnç
oluşturmaktadır. Türkiye’den bildirilen daha önceki bir çalışma, P.aeruginosa
a suşunda
aac(3)-1c-cmlA5 gen diziliminin integron 1 gen kaseti içerisinde olduğunu göstermiştir20. Literatür incelendiğinde, P.aeruginosa
a integron gen kaseti içerisinde bulunan
blaOXA-11-cmlA7
7 gen diziliminin, daha önceden tespit edilemediğini ve ilk kez bu çalışma
ile tanımlandığını göstermektedir.
İran’da 50 A.baumannii suşu ile yapılan bir çalışmada, integron pozitifliği %88 olarak bulunmuş; integron pozitif 44 örneğin 21’inde sınıf 1, 41’inde ise sınıf 1 ve sınıf 2
integron birlikte çoğaltılmıştır21. A.baumanniii suşlarında integron varlığının araştırıldığı
başka bir çalışmada, sınıf I integron pozitifliği %92.5 oranında saptanmış, sınıf 2 integron pozitifliğine rastlanmamıştır22. Ülkemizden yapılan çok merkezli bir çalışmada, Çiçek
56
MİKROBİYOLOJİ BÜLTENİ
Mengeloğlu FZ, Çopur Çiçek A, Koçoğlu E, Sandallı C, Budak EE, Özgümüş OB.
ve arkadaşları23 281 A.baumanniii suşundan sadece 18’inde sınıf 1 integron saptanırken,
hiçbir suşta sınıf 2 integron tespit etmemişlerdir. Kiddee ve arkadaşları24, P.aeruginosa
suşlarında yaptıkları integron tarama çalışmalarında, %82 oranında sınıf 1 integron
saptamışlar, integron gen kasetlerinde aminoglikozidlere direnç sağlayan birkaç farklı
gen tespit etmişlerdir. İzmir’de yapılan bir çalışmada da, 163 gram-negatif bakterinin
%52.7’sinde sınıf 1 integron varlığı saptanmış; bu oranlar P.aeruginosa
a ve A.baumannii
için sırasıyla %49.3 ve %57.8 olarak belirlenmiş, ancak sınıf 2 integron gen kasetine rastlanmamıştır25. Sınıf 2 integronlar 2009 yılına kadar Pseudomonass suşlarında ortaya çıkmamıştır. Çin’deki bir hastanede üç klinik Pseudomonas suşunun ilk defa hem sınıf 1 hem
de sınıf 2 integron taşıdığı tespit edilmiştir26. Bizim çalışmamızda da 77 A.baumanniii ve
60 P.aeruginosa
a suşunda, önce intI1 ve intI2 genleri taranmış ve pozitif gözlenen suşların
değişken bölgeleri PCR ile çoğaltılmıştır. Çalışmamızda tespit edilen yeni gen kaset dizilimindeki cmlA7
7 geni her ne kadar klinik kullanımı sınırlı olan kloramfenikole karşı direnç
sağlasa da, mobil direnç gen yapılarından olan integronların klinik kullanımdaki birçok
antibiyotiğe karşı farklı direnç genlerini kazanarak plazmidlere geçişiyle yayılıma neden
olabilecek potansiyelde olduklarını göstermektedir. Bu açıdan değerlendirildiğinde yeni
gen kaseti dizilimlerinin ortaya çıkması bakteriyel popülasyonların devamlı antibiyotik
baskısına maruz kaldığını ve direnç gelişiminin artan bir şekilde karşımıza çıkacağını
göstermektedir.
Toplam örnek sayısı (n= 137) dikkate alındığında Acinetobacterr suşlarında gen kasetleri taşıyan integron pozitifliği %10.1, Pseudomonas suşlarında ise %5 olarak belirlenmiştir.
Sonuçlar literatür ile karşılaştırıldığında hem A.baumanniii hem de P.aeruginosa
a için integron gen kaseti taşıyıcılık oranı düşük bulunmuştur26,27. Sonuç olarak, ulaşabildiğimiz
kadarıyla, P.aeruginosa
a integron gen kaseti içerisinde tanımlanan blaOXA-11-cmlA7
7 gen
dizilimi ilk kez bu çalışma ile tanımlanmıştır. Elde edilen veriler incelendiğinde sınırlı
bir koleksiyonda bile yeni gen dizilimlerinin ve kombinasyonlarının belirlenebileceği
gözlenmektedir. A.baumanniii ve P.aeruginosa
a suşlarında mobil direnç genlerinden olan
integronların bulunması, gelecekteki antimikrobiyal tedavilerin etkinliğine yönelik ciddi
bir tehdit oluşturduğunu düşündürmektedir. Dolayısıyla, integron gen kasetlerindeki
genlerin antibiyotik direncinin yayılmasına olan etkisinin dikkate alınması ve ülke genelinde çok merkezli takip çalışmalarının yürütülmesi gerektiği kanısına varılmıştır.
KAYNAKLAR
1.
Strateva T, Yordanov D. Pseudomonas aeruginosa- a phenomenon of bacterial resistance. J Med Microbiol
2009; 58(9): 1133-48.
2.
Towner KJ. Acinetobacter:
r an old friend, but a new enemy. J Hosp Infect 2009; 73(4): 355-63.
3.
Maragakis LL, Perl TM. Acinetobacter baumannii: epidemiology, antimicrobial resistance, and treatment options. Clin Infect Dis 2008; 46(8): 1254-63.
4.
Yıldırım MI, Tuğrul HM. Assessment of efficacies of imipenem, cefoperazon-sulbactam and sefepime in rats
with experimental thigh abscess model Acinetobacter baumanniii strains. Mikrobiyol Bul 2011; 45(3): 422-9.
5.
Hosoglu S, Hascuhadar M, Yasar E, Uslu S, Aldudak B. Control of an Acinetobacter baumanniii outbreak in
a neonatal ICU without suspension of service: a devastating outbreak in Diyarbakir, Turkey. Infection 2012;
40(1): 11-8.
MİKROBİYOLOJİ BÜLTENİ
57
Klinik Örneklerden İzole Edilen Acinetobacter baumanniii ve Pseudomonas aeruginosa
Suşlarının Sınıf 1 ve 2 İntegron Taşıyıcılığı ve Yeni Bir Gen Kaseti Birlikteliği: blaOXA-11-cmlA7
6.
Asık G. Current approaches to explain the virulence of Acinetobacter baumannii. Mikrobiyol Bul 2011; 45(2):
371-80.
7.
Hall RM. Mobile gen casettes and integrons: capture and spread of genes by site-specific recombination.
Mol Microbiol 1995;15(4): 593-600.
8.
Fluit AC, Schmitz FJ. Class I integrons, gene casettes, mobility and epidemiology. Eur J Microbiol Infect Dis
1999; 18(11): 761-70.
9.
Rowe-Magnus DA, Guerout AM, Mazel D. Bacterial resistance evolution by recruitment of super-integron
gene cassettes. Mol Microbiol 2002; 43(6): 1657-79.
10. Lévesque C, Piche L, Larose C, Roy PH. PCR mapping integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995; 39(1): 185-91.
11. Bennett PM. Integrons and gene cassettes: a genetic construction kit for bacteria. J Antimicrob Chemother
1999; 43(1): 1-4.
12. Patridge S, Brown H, Hall R. Characterization and movement of the class 1 integron known as Tn2521 and
Tn1405. Antimicrob Agents Chemother 2002; 46(5): 1288-94.
13. Solberg OD, Ajiboye RM, Riley LW. Origin of class 1 and 2 integrons and gene cassettes in a populationbased sample of uropathogenic Escherichia coli. J Clin Microbiol 2006; 44(4): 1347-51.
14. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing.
22nd Informational Supplement, M100-S22, 2012. CLSI, Wayne, PA.
15. British Society for Antimicrobial Chemotherapy. BSAC methods for antimicrobial susceptibility testing. Version 12 May 2013. Available at: http://bsac.org.uk/wp-content/uploads/ 2012/02/Version-12-Apr-2013_final.pdf
16. Ausubel FM, Brent R, Kingston RE, et al (eds). Short Protocols in Molecular Biology. 1995, 2nd ed. John Willey
& Sons, New York.
17. Aminov RI, Garrigues-Jeanjean N, Mackie RI. Molecular ecology of tetracycline resistance: development and
validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins.
App Environ Microbiol 2001; 67(1): 22-32.
18. Bunny KL, Ruth, MH, Stokes HW. New mobile gene cassettes containing an aminoglycoside resistance gene,
aacA7,
7 and a chloramphenicol resistance gene, catB3, in an integron in pBWH301. Antimicrob Agents Chemother 1995; 39(3): 686-93.
19. Ramirez MS, Tolmasky ME. Aminoglycoside modifying enzymes. Drug Resist Update 2010; 13(6): 151-71.
20. Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa
a isolates carrying the IMP-1 metallo-β-lactamase gene in a University Hospital in Turkey.
Microb Drug Resist 2007; 13(3): 191-8.
21. Mirnejad R, Mostofi S, Masjedian F. Antibiotic resistance and carriage class 1 and 2 integrons in clinical
isolates of Acinetobacter baumanniii from Tehran, Iran. Asian Pac J Trop Biomed 2013; 3(2): 140-5.
22. Peymani A, Farajnia S, Nahaei MR, et al. Prevalence of class 1 integron among multidrug-resistant Acinetobacter baumanniii in Tabriz, Northwest of Iran. Polish J Microbiol 2012; 61(1): 57-60.
23. Çiçek AÇ, Düzgün AÖ, Saral A, et al. Detection of class 1 integron in Acinetobacter baumanniii isolates collected from nine hospitals in Turkey. Asian Pac J Trop Biomed 2013; 3(9): 743-7.
24. Kiddee A, Henghiranyawong K, Yimsabai J, Tiloklurs M, Niumsup PR. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa
a isolates in a Thai hospital. Int J Antimicrob
Agents 2013; 42(4): 301-6.
25. Eraç B, Hoşgör-Limoncu M, Ermertcan Ş, Taşlı H, Aydemir Ş. Prevalence of blaPER-1 and integrons in ceftazidime-resistant gram-negative bacteria at a university hospital in Turkey. Jpn J Infect Dis 2013; 66(2): 146-8.
26. Xu Z, Li L, Shirtliff ME, et al. Occurence and characteristics class 1 and 2 integrons in Pseudomonas aeruginosa isolates from patients in Southern China. J Clin Microbiol 2009; 47(1): 230-4.
27. Gu B, Tong M, Zhao W, et al. Prevalence and characterization of class I integrons among Pseudomonas aeruginosa
a and Acinetobacter baumanniii isolates from patients in Nanjing, China. J Clin Microbiol 2007; 45(1):
241-3.
58
MİKROBİYOLOJİ BÜLTENİ
Author
Document
Category
Uncategorized
Views
0
File Size
427 KB
Tags
1/--pages
Report inappropriate content