close

Enter

Log in using OpenID

ASKISEIS PROS LYSI

embedDownload
ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 4ο
ΟΜΑΔΑ Α
1.
Τμήμα DΝΑ που έχει κοπεί στα άκρα του με την περιοριστική ενδονουκλεάση
ΕcoRΙ περιέχει 316 νουκλεοτίδια με αζωτούχο βάση την Τ και 1614 δεσμούς
υδρογόνου. Να υπολογίσετε τον αριθμό των υπόλοιπων βάσεων και των
φωσφοδιεστερικών δεσμών του τμήματος.
Λύση
Α=316=Τ, C= G=330, φ.δ=1290
2.
Τμήμα DΝΑ που έχει κοπεί στα άκρα του με την περιοριστική ενδονουκλεάση
ΕcoRΙ περιέχει 330 νουκλεοτίδια με αζωτούχο βάση την Α και 2602 δεσμούς
υδρογόνου. Να υπολογίσετε τον αριθμό των υπόλοιπων βάσεων και των
φωσφοδιεστερικών δεσμών του τμήματος.
Λύση
Τ=330=Α, C= G=650, φ.δ=1958
3.
Τμήμα DΝΑ που έχει κοπεί στα άκρα του με την περιοριστική ενδονουκλεάση
ΕcoRΙ περιέχει συνολικά 1650 νουκλεοτίδια από τα οποία τα 480 έχουν ως αζωτούχα
βάση την G και C. Να υπολογίσετε τον αριθμό των βάσεων και το σύνολο τον χημικών
δεσμών που αναπτύσσονται σε αυτό το τμήμα.
Λύση
Α=585=Τ, C= G=240, φ.δ=1648, δ.Η=1.882
4.
Τμήμα DΝΑ που έχει κοπεί στα άκρα του με την περιοριστική ενδονουκλεάση
ΕcoRΙ περιέχει συνολικά 1322 φωσφοδιεστερικούς δεσμούς και 250 νουκλεοτίδια που
έχουν αζωτούχα βάση την C. Να υπολογίσετε τον αριθμό των υπόλοιπων βάσεων και
τους δεσμούς υδρογόνου που αναπτύσσονται σε αυτό το τμήμα.
Λύση
Α=412=Τ, C= G=250, δ.Η=1566
5.
Η επίδραση της περιοριστικής ενδονουκλεάσης ΕcoRΙ σε μόριο DΝΑ προκάλεσε
το σπάσιμο 128 φωσφοδιεστερικών δεσμών.
α. Πόσοι δεσμοί υδρογόνου έσπασαν;
β. Πόσα θραύσματα προέκυψαν;
γ. Πόσα θραύσματα είναι έτοιμα για ανασυνδυασμό;
Λύση
α. δ.Η=512
β. κυκλικό: 64 θραύσματα, γραμμικό: 65 θραύσματα.
γ. κυκλικό: 64, γραμμικό: 63
6.
Η επίδραση της περιοριστικής ενδονουκλεάσης ΕcoRΙ σε μόριο DΝΑ προκάλεσε
τη δημιουργία 30 θραυσμάτων.
α. Πόσες θέσεις αναγνώρισης της EcoRI υπάρχουν στο μόριο;
β. Πόσοι δεσμοί έσπασαν από την EcoRI;
Λύση
α. κυκλικό: 30 θέσεις αναγνώρισης, γραμμικό: 29 θέσεις αναγνώρισης.
β. Για κυκλικό DNA: 60 φ.δ και 240 δ.Η.
Για γραμμικό DNΑ: 58 φ.δ και 232 δ.Η
7.
Δίνεται το παρακάτω τμήμα DNA:
5΄AGCCGGAGGATTGAGCCGGAATTATGC 3΄
3΄TCGGCC TCCTAACTCGGCC TTAATACG 5΄
Το τμήμα DΝΑ «επεξεργάζεται» με την περιοριστική ενδονουκλεάση Mspl η οποία
αναγνωρίζει και «κόβει» μεταξύ των δύο C την αλληλουχία:
5΄ CCGG 3΄
3΄ GGCC 5΄
α. Ποια είναι τα θραύσματα που προκύπτουν από τη δράση της Mspl;
β. Πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου έσπασαν;
γ. Εάν το 2ο θραύσμα που προκύπτει από αριστερά προς τα δεξιά ανασυνδυαστεί με
πλασμίδιο που έχει 1 θέση αναγνώρισης για την Mspl, μοριακό βάρος (Μ.Β)=110.000
και 240.000 δεσμούς υδρογόνου να βρεθεί το μοριακό βάρος και οι δεσμοί υδρογόνου
του ανασυνδυασμένου πλασμιδίου.
Δίνεται Μ.Β. νουκλεοτιδίου=200 και Μ.Β Η2Ο=18
1
Λύση
α.
1ο θραύσμα
5΄AGC 3΄
3΄TCGGC 5΄
ο
2 θραύσμα
5΄CGGAGGATTGAGC 3΄
3΄
CTCCTAACTCGGC 5΄
3ο θραύσμα
5΄CGGAATTATGC 3΄
3΄
CTTAATACG 5΄
β. 4 φ.δ και 12 δ.Η
γ. Μ.Β. ανασυνδυασμένου πλασμιδίου=110.000+5.200-2∙18=115.164
δ.Η ανασυνδυασμένου πλασμιδίου= 240.000-6+12+28=240.034
8.
Μόριο DΝΑ απομονώνεται από πυρήνα ευκαρυωτικού οργανισμού και στη
συνέχεια υποβάλλεται με τη μέθοδο ΡCR σε 4 κύκλους αντιγραφής. Το προϊόν
αναλύεται ως προς τη σύσταση των βάσεών του και προκύπτει ότι περιέχει 41.600
βάσεις Α και 124.800 βάσεις G. Να βρείτε:
α. Από πόσους κλώνους μορίων αποτελείται το δείγμα
β. Τον αριθμό των δεσμών υδρογόνου στο αρχικό μόριο.
Λύση
α. 16 μόρια
β. δ.Η=28.600
9.
Ένα διάλυμα περιέχει τα ακόλουθα 3 μόρια DNA (δίνεται μόνο ο ένας κλώνος):
1ο μόριο: 5΄ GCCGGAAGTG 3΄
2ο μόριο: 5΄ ATATTGACTTAT 3΄
3ο μόριο: 5΄ GCAATTAGATTATG 3΄
Αν αυξηθεί η θερμοκρασία του διαλύματος με ποια σειρά πιστεύετε ότι θα γίνει η
αποδιάταξη των κλώνων τους;
Λύση
2ο μόριο-1ο μόριο-3ο μόριο (σημαντικότεροι είναι οι δεσμοί υδρογόνου στην
σταθερότητα του μορίου).
10.
Γραμμικό δίκλωνο μόριο DΝΑ μήκους 18κb (κb = χιλιάδες ζεύγη βάσεων)
υπόκειται στη δράση της περιοριστικής ενδονουκλεάσης Α, οπότε προκαλούνται 2
θραύσματα των 8κb και 10κb. Όταν επιδράσει σε αυτό η περιοριστική ενδονουκλεάση
Β, προκαλούνται 2 θραύσματα των 4κb και 14κb. Πόσα θραύσματα θα προκληθούν αν
επιδράσουν ταυτόχρονα στο μόριο τα ένζυμα Α και Β;
Λύση
1η περίπτωση:
4kb
4kb
10kb
η
2 περίπτωση:
8kb
6kb
4kb
11.
Το ένζυμο EcoRI κόβει ένα γραμμικό μόριο DNA σε δύο κομμάτια. Το α'
αποτελείται από 212 νουκλεοτίδια, 40 από τα οποία περιέχουν την αδενίνη.
α. Ποιος είναι ο αριθμός των άλλων βάσεων και ποιος ο αριθμός των δεσμών του α'
τμήματος;
2
β. Ποιος είναι ο αριθμός κάθε είδους βάσεων του β' τμήματος, αν το αρχικό μόριο DNA
περιέχει 400 φωσφοδιεστερικούς δεσμούς και 85 αδενίνες;
Λύση
α. Τα 2 κομμάτια που προκύπτουν από την δράση της περιοριστικής
ενδονουκλεάσης EcoRI έχουν μονόκλωνο μόνο το ένα άκρο τους ενώ το άλλο είναι
δίκλωνο. Σε κάθε μονόκλωνο άκρο υπάρχουν 2Α και 2Τ.
Το δίκλωνο τμήμα θα έχει 212-4=208 από τις οποίες οι Α θα είναι: Α=40-2=38.
Άρα Τ=38 και 208-38-38=132 G και C δηλαδή G=C=66
φ.δ=210
δ.Η=274
β. Α=Τ=45 και G=C=50
ΟΜΑΔΑ Β
12. Δίνεται η παρακάτω αλληλουχία βάσεων τμήματος DNA:
GAGCCTTAAGAAATCCTAGGTTAGTACTTAAGCC
α. Ποια είναι τα θραύσματα που προκύπτουν από τη δράση της EcoRI;
β. Ποιο από τα θραύσματα που προκύπτουν, αν ανασυνδυαστεί με πλασμίδιο το
οποίο έχει επεξεργαστεί με EcoRI, δίνει πεπτιδικό προϊόν; Με τη βοήθεια του γενετικού
κώδικα να γράψετε το πεπτίδιο που σχηματίζεται.
γ. Εάν γίνει κατεργασία του παραπάνω τμήματος DNA και ενός πλασμιδίου με BamHl
και ανασυνδυασμός τους μπορεί ή όχι να συντεθεί το ίδιο πεπτίδιο και γιατί; Δίνεται
ότι η BamHl αναγνωρίζει και κόβει μεταξύ των 2 G την αλληλουχία:
5΄ GGATCC 3΄
3΄ CCTAGG 5΄
Λύση
α. Διακρίνουμε 2 περιπτώσεις:
1η περίπτωση: Θεωρούμε ότι το 5΄άκρο της 1ης αλυσίδας είναι αριστερά και το 3΄άκρο
δεξιά. Με αυτήν την κατεύθυνση δεν υπάρχει αλληλουχία που να αναγνωρίζει και να
κόβει η EcoRI .
2η περίπτωση: Θεωρούμε ότι το 3΄ άκρο της 1ης αλυσίδας είναι αριστερά και το 5΄
άκρο δεξιά. Με αυτήν την κατεύθυνση υπάρχουν 2 θέσεις αναγνώρισης της EcoRI και
τα θραύσματα που προκύπτουν είναι τα εξής:
1ο θραύσμα
5΄CCG 3΄
3΄GGCTTAA 5΄
2ο θραύσμα
5΄AATTC ATG ATT GGA TCC TAA AG 3΄
3΄
G TAC TAA CCT AGG ATT TCTTAA 5΄
ο
3 θραύσμα
5΄AATTCCGAG 3΄
3΄
GGCTC 5΄
ο
β. το 2 θραύσμα. Πεπτίδιο: NH2-met-ile-pro-ser-COOH
γ.
5΄AATTC ATG ATTGGA TCC TAA AG 3΄
3΄
G TACTAACCTAGG ATT TCTTAA 5΄
Όχι. Η αλληλουχία που αναγνωρίζει και κόβει η BamHl βρίσκεται μέσα στο γονίδιο
που δίνει το συγκεκριμένο πεπτίδιο και κατά συνέπεια είναι αδύνατη η σύνθεσή του.
13. Δύο πανομοιότυπα μόρια DΝΑ απομονώνονται από πυρήνα ευκαρυωτικού
οργανισμού και στη συνέχεια υποβάλλεται με τη μέθοδο ΡCR σε 7 κύκλους
αντιγραφής. Αν στο αρχικό μόριο υπήρχαν 2.300 δεσμοί υδρογόνου και η Α είναι τα
4/5 της G να βρεθεί ο συνολικός αριθμός της κάθε βάσης με την ολοκλήρωση των 7
κύκλων αντιγραφής.
Λύση
Α=Τ=102.400, G=C=128.000
14. Ένα τμήμα DNA με μήκος 40 kb (κb = χιλιάδες ζεύγη βάσεων) κόβεται σε
κομμάτια προκειμένου να αναλυθεί. Αν χρησιμοποιηθεί η EcoRI προκύπτουν 3
κομμάτια με μήκη 6 kb, 13 kb και 21kb. Αν χρησιμοποιήσουμε την Haelll προκύπτουν
2 κομμάτια με μήκη 18 kb και 22 kb. Πόσα τμήματα και με ποιο μήκος θα προκύψουν
από την ταυτόχρονη επίδραση και των δύο ενζύμων;
3
Λύση
Διακρίνουμε 5 περιπτώσεις:
1η περίπτωση:
6kb
12kb
1kb
21kb
1kb
21kb
η
2 περίπτωση:
13kb
5kb
3η περίπτωση:
6kb
12kb
9kb
13kb
4η περίπτωση:
13kb
5kb
16kb
6kb
5η περίπτωση:
18kb
3kb
13kb
6kb
15. Γονίδιο που προέρχεται από μιτοχονδριακό DΝΑ αποτελείται από 1500 ζεύγη
αζωτούχων βάσεων. Ακριβώς πριν και ακριβώς μετά το γονίδιο βρίσκεται η
αλληλουχία GGATCC την οποία αναγνωρίζει και κόβει μεταξύ των δύο G η
περιοριστική ενδονουκλεάση ΒamHl. Πλασμίδιο 2500 ζευγών αζωτούχων βάσεων
περιέχει τη χαρακτηριστική αλληλουχία μία φορά και επωάζεται αρχικά σε διάλυμα
ΒamHl και στη συνέχεια σε διάλυμα που περιέχει τα γονίδια. Τα πλασμίδια που
προκύπτουν ελέγχονται ως προς τον αριθμό των βάσεων τους και προκύπτει ότι
μερικά πλασμίδια αποτελούνται από 2500 ζεύγη βάσεων, μερικά από 4006 ζεύγη
βάσεων και μερικά από 5512 ζεύγη βάσεων. Πώς μπορεί να ερμηνευτεί ο αριθμός των
βάσεων στα πλασμίδια;
Λύση
1500 ζεύγη βάσεων=3.000 βάσεις
GATCC
G
G
CCTAG
4
Μετά την δράση της BamHl το γονίδιο με τα μονόκλωνα άκρα του θα αποτελούνται
από 3.000+6+6=3.012 βάσεις.
Πλασμίδια με 2.500ζ.β.=5000 βάσεις. Δεν ενσωμάτωσαν το γονίδιο.
Πλασμίδια με 4.006ζ.β.=8012 βάσεις. Ενσωμάτωσαν το γονίδιο 1 φορά
(5.000+3.012=8.012)
Πλασμίδια με 5.512ζ.β.=11.024 βάσεις. Ενσωμάτωσαν το γονίδιο 2 φορές
(5.000+3.012+3.012=11.024).
16. Ο ποντικός έχει στα σωματικά του κύτταρα 40 χρωμοσώματα. Μια περιοριστική
ενδονουκλεάση διασπά στο γονιδίωμά του 2.000 φωσφοδιεστερικούς δεσμούς.
α. Πόσα κομμάτια θα προκύψουν από τη δράση της περιοριστικής ενδονουκλεάσης;
β. Πόσα πλασμίδια θα χρησιμοποιηθούν για τον ανασυνδυασμό των κομματιών που
προέκυψαν;
Λύση
α. Σε κάθε θέση αναγνώρισης διασπώνται 2 φ.δ. Άρα 2.000:2=1000 θέσεις
αναγνώρισης. Ο ποντικός έχει 40 χρωμοσώματα (γραμμικά). Σε κάθε χρωμόσωμα
για ν θέσεις αναγνώρισης προκύπτουν ν+1 θραύσματα. Για τα 40 χρωμοσώματα θα
προκύπτουν συνολικά 40 επιπλέον θραύσματα σε σχέση με τις θέσεις αναγνώρισης
δηλαδή συνολικά θα ισχύει: 1.000+40=1040 θραύσματα.
β. Από τα θραύσματα που προκύπτουν σε κάθε μόριο τα 2 ακραία έχουν δίκλωνα
άκρα και επομένως δεν είναι κατάλληλα για ανασυνδυασμό. Συνολικά σε 40
χρωμοσώματα θα υπάρχουν 80 θραύσματα που δεν είναι κατάλληλα για
ανασυνδυασμό και 1040-80=960 θραύσματα που θα είναι κατάλληλα για
ανασυνδυασμό και για τα οποία θα χρειαστούν 960 πλασμίδια.
5
Author
Document
Category
Uncategorized
Views
0
File Size
191 KB
Tags
1/--pages
Report inappropriate content