close

Enter

Log in using OpenID

embedDownload
Biotecnologie del farmaco:
disegno e analisi di biofarmaci
PER
BIOTECNOLOGIE MEDICHE
A.A. 2009-2010
Modulo
Modulo
analisi di biofarmaci (4 CFU)
disegno di biofarmaci (2 CFU)
Docente:
Claudia Sissi
Dip. Scienze Farmaceutiche,
via Marzolo, 5; (Edificio B)
Docente:
Manlio Palumbo
Dip. Scienze Farmaceutiche,
via Marzolo, 5; (Edificio B)
Ricevimento:
tutte le mattine su accordi con il docente
Ricevimento:
tutte le mattine su accordi con il docente
e-mail:
[email protected]
e-mail:
[email protected]
Testi consigliati:
- Appunti di lezione
- Diapositive utilizzate durante le lezioni (copia fornita dal
docente)
- Articoli di letteratura indicati dal docente
Utilizzo inglese scientifico
Modalita’ d’esame:
- relazione scritta preparata dallo studente su argomenti
concordati con il docente che traggono spunto da recenti articoli
scientifici riguardanti i biofarmaci
- colloquio sulle tematiche teorico pratiche sviluppate nel corso
ANALISI E DISEGNO DI BIOFARMACI
BIOFARMACO
farmaco basato sulla tecnologia del DNA ricombinante
Biological tests design
Test validation
idea
libreria
Molecular biology
Structural biology
synthesis
ADME
preformulazione
screening
Identificazione
lead compound
Validazione librerie
Structural analysis
Phisico-chemical
Analysis
Drug design
ottimizzazione
Metabolismo
farmacocinetica
Chimica fisica
Biologia molecolare
Biologia cellulare
METODOLOGIE
ANALITICHE
¾Quantitative analysis of binding equilibria
¾Multiple binding sites
¾Mapping binding sites
¾Structural studies
¾Equilibrium measurements
¾Kinetics experiments
¾Experimental approaches:
EXPERIMENTAL APPROACHES
Electrophoresis
Binding
affinities
Electrophoretic Mobility Shift Assay (EMSA)
Footprinting
Proteolysis
Surface Plasmon Resonance (SPR)
Calorimetric studies
Structural
informations
IsoThermal Calorimetry (ITC)
Differential Scanning Calorimetry (DSC)
Spectrophotometry
FRET
CD
Stopped flow
The foundamental equation
of binding - equilibrium
A+B
Ka
[C]
Ka =
[A][B]
C
0.30
[A] [B]
Kd =
[C]
12000
0.28
10000
8000
0.24
[A]
SEGNALE
0.26
0.22
0.20
6000
4000
0.18
0.16
2000
0.14
0.00
0.02
0.04
0.06
[B]
0.08
0.10
0.12
0.14
0
0
2
4
6
8
10
12
[B]
0.850
0.80
0.75
0.70
0.65
0.60
0.55
0.50
0.45
A 0.40
0.35
0.30
0.25
0.20
0.15
0.10
0.05
0.000
350.0
360
370
380
390
400
410
420
nm
430
440
450
460
470
480.0
0.30
0.28
SEGNALE
0.26
[At ] = [A] + [C]
0.24
0.22
S = Slib([A] /[At]) + Sleg([C] /[At])
0.20
0.18
0.16
0.14
0.00
0.02
0.04
0.06
0.08
0.10
0.12
0.14
[B]
[C]
[At]
= ν=
frazione di complessato
1.00
0.75
[A] [B]
Kd =
[C]
0.50
0.25
0.00
0.0
0.5
1.0
1.5
2.0
2.5
3.0
[B] mM
3.5
4.0
4.5
5.0
S - Slib
Sleg - Slib
A+B
Ka
C
[A] [B]
([At]-[C]) ([Bt]-[C])
Kd =
=
[C]
[C]
se [B]>>[C] [B]=[B]tot
[A] [B]
Kd =
[C]
Kd [C] = ( [At]-[C]) [B]
[A] = [At] – [C]
[B] [At]
[C] =
[B] + Kd
A+B
Ka
C
[A] [B]
Kd =
[C]
Se [B] ≈ [C] [B] = [B]tot – [C]
Kd [C] = ( [At]-[C]) ([Btot]-[C])
[A] = [At] – [C]
[C]2 – ([Atot]+[Btot]+Kd) [C] – [Atot][Btot] = 0
[C] = ½ { ([Atot]+[Btot]+Kd) - √([Atot]+[Btot]+Kd)2- 4[Atot][Btot] }
The Scatchard plot
Kd [C] = [A] [B]
[B] [At]
[C] =
[B] + Kd
[A] = [At] – [C]
[C] = [At] – [C]
[B]
Kd
10
8
[C]/[B]
ν = 1 - ν
[B]
Kd Kd
12
slope = -1/Kd
6
4
2
0.0
0.5
1.0
1.5
[C]
2.0
2.5
A+B
A+S
Ka
Ka
C
C
S = siti liberi
S=B*s
+
+
A+S
Ka
C
S = siti liberi = B * s
Kd [C] = [A] [S]
[St] = [S] + [C] = [Bt] * s
r/m
[C]
=r
[Bt]
slope = Ka
[A] = m
1
r
=
(s - r)
m
Kd
s
r
Multiple binding modes
+
A+S
Ka
C
S = siti liberi = B * s
r/m
slope = Ka
z
z-1
r
r
= Ka (1-nr)
m
(2ω+1)(1 – nr)+r-R
n-1
1 - (n – 1)r + R
2(ω-1) (1-nr)
2
2(1-nr)
n-1
m
= Ka (1-nr)
1 - nr
1 – (n-1)r
Ka
3
2
r/m
r
r=
[C]leg
1
[Bt]
m = [A]lib
0
0.00
0.05
0.10
0.15
0.20
0.25
r
1/n
0.30
Hill Plot
[A] [B]
Kd =
[C]
[C] = ½ { ([Atot]+[Btot]+Kd) - √([Atot]+[Btot]+Kd)2- 4[Atot][Btot] }
C
B-C
[A]
C
B-C
[A]
Stoichiometry - Job‘s methods
aA + bB
prodotto
moli di A
moli di B
C
1.0
complex
0.8
0.6
0.4
0.2
0.0
0.00
0.25
0.50
molar fraction
0.75
1.00
The foundamental equation
of binding - kinetics
A+B
Ka
C
A+B
The rate of association is:
The rate of dissociation is:
[C]
Ka =
[A][B]
[A] [B]
Kd =
[C]
C
Number of binding events per unit of time =[A]×[B]×kon.
Number of dissociation events per unit time = [C]×koff.
Equilibrium and Kinetic Constants
are related
A+B
ka
kd
AB
Saturation binding experiments: measure equilibrium binding
of various concentrations of the ligand. Analyze the relationship
between binding and ligand concentration to determine the
number of sites, Bmax, and the ligand affinity, Kd.
Competitive binding experiments measure equilibrium binding
of a single concentration of a ligand at various concentrations of
a competitor. Analyze these data to learn the affinity of the
receptor for the competitor.
Kinetics experiments measure binding at various times to
determine the rate constants for ligand association and
dissociation.
ELETTROFORESI
Q
+
-
d
Migrazione di particelle cariche sotto l’azione di un campo elettrico.
Tecnica soprattutto ANALITICA ma anche PREPARATIVA.
E’ un mezzo di separazione molto potente, fra i piu’ usati in biochimica
ELETTROFORESI
Forza elettrica : Fel = Q · E
Forza frizionale : Ffr = f ·v
(E = ΔV/d)
(f = 6π η r)
Quando le forze si bilanciano:
Q ·E = f ·v
→
Q
v= —·E
f
mobilita’ elettroforetica :
v
Q
μ = — = — =
E
f
Q
6πηr
v proporzionale al rapporto carica/massa
a parita’ di tale rapporto dipende dall’ingombro sterico
Migrazione di
proteine e
DNA in gel
di varia
porosita’
PROTEIN ELETTROPHORESYS
SDS-PAGE
(Sodium Dodecyl Sulfate Poly-Acrylamide Gel Electrophoresis)
FOCALIZZAZIONE ISOELETTRICA
Un’altra tecnica, oltre alla cromatografia a scambio ionico, che
permette la separazione di macromolecole sulla base della loro
carica. Estremamente potente.
anodo
pH3
ΔV
catodo
proteine pI acido
proteine pI basico
pH10
+
-
+
pI, punto isoelettrico ´ Z=Ø ´ v= Ø
2D ELETTROFORESI
2D ELETTROFORESI
- CATODO
-
+
ΔV
SDS-PAGE
+ ANODO
2D ELETTROFORESI
pH 3-11
B
pH 7-11
Elettroforesi di acidi nucleici
Agarosio → 0.1 - 40 kb
PFGE
(Pulse Field Gel
Electrophoresis) → 5 Mb
poliacrilamide → 10-1000 nt
Rivelazione :
•UV shadowing
•Coloranti :Bromuro di Etidio o Sybr Green
•autoradiografia
Recupero :
•elettroeluizione
•Eluizione
•Sciogliendo l’agarosio.
Separazione dei
cromosomi di
S. cerevisiae
Size of fragments and distance traveled not
linear when large fragments are analyzed
Conventional agarose
gel electrophoresis
PFGE
Periodically change the direction
of the electric field.
MODELLO A SETACCIO
Le molecole di DNA piu’ grandi sono separate da
quelle piu’ piccole dall’azione del setaccio dovuta
alla miscela del gel
MODELLO A SERPENTE
Le molecole di DNA piu’ grandi dei pori del gel
devono srotolarsi in modo da poter migrare. Il
DNA si muove con un’estremita’ che conduce lo
spostamento (TESTA) mentre il resto della
molecola (CODA) segue lungo lo stesso percorso
La PFGE permette di separare DNA fino a 5 Mb
Capillary Electrophoresis (CE)
silice
Quando applico il voltaggio si forma un flusso laminare.
I cationi che si trovano vicini alla parete hanno infatti un’elevata mobilita’ e migrando verso il catodo
formano un flusso elettroendosmotico la cui velocita’ di migrazione e’ molto piu’ elevata della
velocita’ di migrazione degli analiti. Cosi’, tutti gli analiti, indipendentemente dalla loro carica migrano
verso il catodo.
Capillary Electrophoresis (CE)
Vantaggi dell’Elettroforesi
Capillare
- Alta efficienza di separazione
(105 - 106 piatti teorici)
N = 5.54 × (t/Δt1/2)2
- Piccola quantità di campione
(1-10 ul)
- Separazione veloce (1-45 min)
- Selettività prevedibile
- Automatizzabilità
- Quantificabilità (lineare)
- Riproducibilità
- Accoppiamento alla
spettrometria di massa
Tipi di Molecole che possono essere separate con l’ Elettroforesi Capillare
Proteine, Peptidi, Aminoacidi, Acidi nucleici, Ioni
inorganici, Basi e Acidi organici, Cellule intere.
METODOLOGIE IDRODINAMICHE
Electrophoretic Mobility Shift Assay EMSA
Q
μ=
6πηr
μ proporzionale al rapporto carica/massa
a parita’ di tale rapporto dipende dall’ingombro sterico
METODOLOGIE IDRODINAMICHE - EMSA
gel shift assay
PROTEIN
12000
10000
6000
4000
2000
0
0
2
4
6
8
10
12
[B]
12000
10000
8000
[A]
[A]
8000
6000
4000
2000
0
0.1
1
10
[B]
100
Advantages :
- Low reactive species concentration
- Can separate different complexes
Disadvantages :
- Labelling
- Complex stability and solubility
- Not at the equilibrium
TECNICHE DI SEQUENZIAMENTO DEL DNA
CHE SEQUENZA?
MAXAM AND GILBERT SEQUENCING
(1977, Nobel prize 1980)
There are four chemical cleavage reactions
at the core of the Maxam and Gilbert
sequencing system. The figure shows an
example from these reactions, the reaction
cleaving specifically at guanine. The other
three reactions cleave at G+A, C+T, or C.
MAXAM AND GILBERT SEQUENCING
:
C: Hydrazine in 0.6M NaCl; incubate at
25°C for 7-9 minutes.
G: Dimethyl Sulfate (DMS) in 50mM sodium
cacodylate, pH 8, 1mM EDTA; incubate at
25°C for 4-5 minutes.
C+T: Hydrazine in H2O; incubate at 25°C for
7-9 minutes.
G+A: formic acid; incubate at 25°C for 4-5
minutes.
SANGER SEQUENCING (1977, Nobel prize 1980)
SANGER SEQUENCING
In Sanger dideoxy terminator sequencing, the sample DNA is used as a template for a DNA polymerase.
Four polymerase reactions are carried out involving enzyme, primer and sample DNA, along with
dNTP's. Each reaction also contains one of the four dideoxy NTP's. When a dideoxy NTP is added, chain
lengthening terminates because ddNTP nucleotides lack 3' hydroxyl groups by which to form the next
phosphodiester bond. Each reaction contains one of the four bases as a dideoxy NTP, thus each
reaction results in fragments terminating at that base. The four reactions produce four collections of
fragments with lengths reflecting the sequence positions of each of the four respective bases.
DYE TERMINATOR SENQUECING
FOOTPRINTING
FOOTPRINTING
60
40
20
•Localizzazione
•Efficienza di protezione
MX
100
80
0
GG
C/
GT GC
C
C/
CA GA
C
C/
C G
T
G
G
C/
CT GC
G
C/
CT GA
G
G
/
AA CA
G
C/
G
AA T T
G
/
AC CTT
G/
C
A
G GT
G/
A CC
GT T
/
AT A CT
C/
AT GA
G/ T
AT CA
T
T/
AA
T
T
A
C/
GT
T
A
A
G/
T A CT A
T/
A
T
T
C
C/ A
T C GG
A
G/
T C C GA
T
/
T G AG
G/ A
CC
T
GA A
/T
T G CA
T/
TT A CA
C/
GA
A
QUANTITATIVE FOOTPRINTING
DNA TRIPLE HELIX
+
DNA CLEAVING AGENTS
Enzymes : DNAse I
DNAse II
Micrococcal Nuclease
Chemical : [Fe-EDTA]2KMnO4
OsO4
DMS
Br2
DNase I–DNA complex.
Tight interactions in the minor groove formed by Y76 and R41 (shown in
purple) and contacts to the sugar–phosphate backbone of both strands
(represented by large yellow spheres centered at the phosphate positions)
cause a widening of the minor groove and bending of the DNA.
The scissile phosphate is shown as a red sphere
Hydroxil radical footprinting
Hydroxil radical footprinting
Method to probe DNA structure
Cleavage by .OH
Separate products on gel
HUMAN TELOMERIC SEQUENCE
BCL2
TTAGGG-TTAGGG-TTAGGG-TTAGGG
AGGGGCGGGCCGGGAGGAAGGGGGCGGGAGCGGGGCTG
Proteolysis
•Identificazione domini strutturali
•Identificazione cambi conformazionali
•Proteomica
Pulse proteolysis
F
Kunf
U
(a)
(b)
b
Time
Lower limit:
Upper limit:
long enough to completely digest unfolded protein
but short enough to not digest folded protein
short enough to not digest folded protein
F
Kunf
U
[U]
Kunf =
[F]
ΔGunf = -RT ln Kunf
1.2
without ligand
with ligand
1.0
f fold
0.8
0.6
0.4
0.2
0.0
0
2
4
[Urea ]
6
8
CIRCULAR DICHROISM
SPECTROSCOPY
L’ATTIVITA’ OTTICA
Una sostanza capace di ruotare il piano di polarizzazione
di un fascio di luce planarmente polarizzata viene definita
otticamente attiva
Per essere otticamente attiva una sostanza
non deve possedere dei piani di simmetria
isomers: different compounds which have the same molecular formula
Constitutional Isomers:
Isomers which differ
in "connectivity".
Stereoisomers:
Isomers which have
the same connectivity
L’ATTIVITA’ OTTICA- GLI ENANTIOMERI
Isomeric molecules that are non-superimposable mirror images are enantiomers.
Enantiomers are known as chiral molecules (derived from the Greek meaning hand).
Chiral enantiomers of a molecule have identical physical properties
- melting point, vapor pressure, etc. –
with one exception: they scatter polarized light differently.
For example, if linearly polarized light passes through a solution of chiral molecules
(all of the same enantiomer), the plane of polarization will rotate.
Most importantly, the two enantiomers of a molecule will rotate the plane of polarization
in opposite directions. This phenomenon is called optical rotation.
LA LUCE
LUCE
LINEARMANTE POLARIZZATA
LUCE
CIRCOLARMANTE POLARIZZATA
sx
dx
tg Θ = a/b
B
A
Θ = arctg (a/b)
Θ = k * (εL-εR) * c* d gradi
[Θ] = 3300 * (εL-εR) gradi*cm2*decimole
R = K * μ * m * cosγ
Cromofori nelle proteine: FAR UV
n -> π* involves non-bonding electrons of O of the carbonyl
It is centered around 220 nm.
It is weak as it is symmetry forbidden (εmax 100)
π-> π* involves the π-electrons of the carbonyl
It is centered around 190 nm.
It is very intense (εmax 7000)
The intensity and energy of these transitions depends on φ and
ψ (i.e., secondary structure)
Effetto della struttura proteica
Spettro di assorbimento UV di una catena di poli-L-lisina in
differenti conformazioni.
1. Alpha helix (pH 11, 25°C)
2. Disordered (pH 6, 25°C)
3. Beta sheet (pH 11, 52°C)
a+b+t+r=1
s=(a*x)+(b*y)+(t*z)+(r*n)
K2D : neural network
Cromofori nel DNA
NH
O
H3C
N
N
N
H
O
N
H
TIMINA
NH
N
N
H
2
O
CITOSINA
O
2
N
N
ADENINA
N
N
H
NH
N
GUANINA
NH
2
ssDNA
dsDNA
13
10
CD[m de g]
0
-11
230 240
260
280
W a ve le ngth[nm ]
300
320
For nucleic acids, unlike proteins, one cannot ignore spectral differences between different monomeric residues.
The bases themselves are directly involved in close interactions in all common secondary structures.
Even some actual sequence information must be taken into account to explain CD spectra.
For example the CD spectrum of the dinucleoside phosphate ApG is different from the sum of
the CD spectra of A and G monomers.
The CD spectra of ApG and GpU are the sum of the two monomers
plus and an additional term to account for the base-base interactions:
2[qApG(l)] = [qA(l)] + [qG(l)] + IAG(l)
2[qGpU(l)] = [qG(l)] + [qU(l)] + IGU(l)
The spectrum of a random coil can be estimated as simply the average of the properties of the four monomers.
The spectrum of a single-strand stacked helix would contain optical contributions from each of the
16 possible dinucleoside phosphates,
weighted by their frequencies of occurrence.
The spectrum of a double-strand is accounted for in an analogous way, by adding the
contributions of each of the 10 possible double-strand dimers (ApG base paired with CpU, and so on).
In practice, a total of up to 30 different spectral contributions must be combined
o compute the CD of a molecule such as tRNA that has both single-strand and double-strand regions.
This approach is very complex!
B-Z
A-Z
Induced Circular Dichroism
ETBr
Induced Circular Dichroism
BBR3387
BBR3388
1000
200
Mol. Ellip.
Mol. Ellip.
poly(dAdT)
poly(dGdC)
-4000
400
Wavelength[nm]
560
-2000
400
poly(dAdT)
poly(dGdC) Wavelength[nm]
560
Linear Dichroism (5)
Epar
Perfectly oriented DNA
Epar
Eperp
Eperp
ΔA = Az − Ax
LDr = ( Az − Ax ) 3 Aiso = cos 2 θ z − cos 2 θ x
Linear Dichroism (6) The α-helix
Fluorescence
Fluorescence Resonance Energy Transfert (FRET)
Fluorescence Quencing
FLUORESCENZA
n fotoni emessi
Resa quantica = Q =
n fotoni assorbiti
F = k q Io (εlc)
Fluorescence Resonance Energy Transfert (FRET)
Cyan Fluorescent Proteins
The first fluorescent protein emitting in the bluish-green cyan spectral region (CFP) was discovered
during mutagenesis studies that converted the tyrosine residue in the GFP chromophore to tryptophan
(Y66W). This single mutation yielded a chromophore that displays an absorption maximum at 436
nanometers with a very broad fluorescence emission spectral profile centered at 485 nanometers.
Subsequent refinements, including F64L and S65T, resulted in the production of an enhanced version
(ECFP) with greater brightness and photostability. Other than providing an additional hue for multicolor
imaging, initially the most promising aspect of ECFP was the potential for utility as a biosensor FRET
partner with yellow fluorescent proteins.
Yellow Fluorescent Proteins
Yellow fluorescent proteins, as a spectral class, are among the most versatile genetically-encoded
probes yet developed. Ranging in emission wavelength maxima from approximately 525 to 555
nanometers, those proteins residing in the shorter wavelength region actually appear green, rather
than yellow, when viewed in a widefield fluorescence microscope. The first member in what has
become a rather large family of probes was rationally engineered after the high resolution crystal
structure of green fluorescent protein revealed that threonine residue 203 (Thr203) was positioned
near the chromophore and potentially able to alter the spectral characteristics upon substitution.
Mutations of this aliphatic amino acid to several aromatic moieties were introduced in order to induce
pi-orbital stacking and attempt stabilization of the excited state dipole moment of the chromophore.
The most successful mutant proved to be tyrosine (T203Y; termed mutant 10C, the original YFP),
which resulted in almost a 20-nanometer shift to longer wavelengths for both the excitation and
emission spectra. Several YFP variants were initially constructed in attempts to maximize brightness
as well as to increase the speed of maturation and optimize expression at 37 degrees Celsius.
a | An intermolecular fluorescence resonance energy transfer (FRET)-based probe consists of two different
proteins (X and Y) that are labelled with cyan fluorescent protein (CFP) and yellow fluorescent protein
(YFP), respectively, which interact and bring the fluorophores into close proximity, thereby increasing the
FRET efficiency. b | An intramolecular FRET-based probe consists of either a cleavable linker or a
conformationally responsive region sandwiched between a FRET pair. c | Cameleon is an intramolecular
FRET-based probe that is used to measure intracellular Ca2+. d | Intramolecular phosphorylation-sensitive
FRET probes have been constructed with specificities for various different kinases. Arg, arginine; CaM,
calmodulin; Lys, lysine; pS, phosphoserine; pT, phosphothreonine; pY, phosphotyrosine. Figure 5, part c is
reprinted with permission from Ref. 105Nature © (1997) Macmillan Magazines Ltd. Figure 5, part d is
reproduced with permission from Refs 116, 118 © 2002, National Academy of Sciences.
Fluorescence Quencing
Some of the processes which reduce the quantum yield are:
- collisional quenching
- static quenching
-energy transfer
Dependent upon
distance
require contact between the
fluorophore and the quencher
useful to measure rates of diffusion
and exposure of fluorescent species
to the quencher.
molecular oxygen, amides,
BrO4-, xenon, I-,
peroxides, nitroxides, acrylamide
FLUOROPHORE/QUENCHER COMBINATIONS (*)
Recommend
Maximum (nm)
ed
Quencher
Fluorophore
Excitation
Emission
Dabcyl
Coumarin
434
475
Dabcyl
6-Fam
(Fluorescein)
494
521
Dabcyl
TET
519
537
Dabcyl
Eosin
524
544
Dabcyl
HEX
535
556
Black-Hole 2
Tetramethylr
hodamine
558
580
Black-Hole 2
Texas Red
592
615
T
A
T
G
G
G
G
G
G
G
G
G
G
G
A
GG T
G
T G GG
T
TA
G GG
G
G
G
T
TA
T
G
A
T
T
A
T
1.2
0.2
1.1
0.1
-d(F)/d(T)
1.0
0.9
F
0.8
0.0
-0.1
0.7
-0.2
0.6
-0.3
0.5
40
50
60
70
Temperature (°C)(°C)
80
90
-0.4
100
50
Tm
60
70
80
Temperature (°C)
90
100
1.4
Oligonucleotide
da solo
1.2
1.0
0.8
F
0.6
Oligonucleotide complessato
con un legante
0.4
0.2
0.0
20
30
40
50
60
70
80
90
TEMP
CSA32 K 5-50 mM
(COOPERATIVE BINDING)
CSA7 IN K 5 mM 50 mM
(ONE BINDING SITE)
35
35
30
30
25
25
20
DTm
20
DTm
100
15
15
10
10
5
5
0
0
0
10
20
CONC
30
0
2
CONC. (μM)
4
6
APPLICATIONS:
- macromolecule structure:
folding
distances
stability
accessibility
-macromolecule-ligand interactions
- real time PCR :
identification of specific sequence
quantification of PCR reaction products
quantification of PCR reaction substrate
-single molecule fluorescence
Single molecule
(a)
guarantee that only one molecule is in resonance in the volume probed by
the laser,
(b) provide that the signal-to noise ratio (SNR) for the single-molecule
signal is greater than the background for reasonable averaging time.
Guaranteeing that only one molecule is present in the detection volume is
generally achieved by dilution. For example, at room temperature one
needs to work with roughly 10-10 mole/liter concentration with a probed
volume of about 10mm3.
optics and detector are systems that will
simultaneously collect up to four types of correlated
information from each photon:
1) the time at which the photon was collected,
2) the polarization of the photon,
3) the wavelength region (above or below some
cutoff) of the photon and
4) the lifetime of the excited state that gave rise to
the photon.
REQUIREMENTS:
•severe background reduction
•high detection efficiency
•spatially selective imaging
near-field
microscopy
confocal
microscopy
wide-field
microscopy
total internal
reflection
(dark-field)
microscopy
Immobilized molecules
Flowing or diffusing single molecules
Immobilized molecules
Flowing or diffusing single molecules
Population distribution
Diffusion coefficient
Concentration
Calorimetric methods
endothermic
A+B
C
Q
exothermic
Q is proportional to C formation
ITC Isothermal Titration Calorimetry
DSC Differential Scanning Calorimetry
- Binding Constants
- Reaction Stoichiometry
- Thermodynamic Profile of the reaction
A+B
Ka
ΔG = ΔH -TΔS
Q
C
ΔG = -RT ln Ka
ΔCp = d(ΔH)/dT = T d(ΔS)/dT
Energia libera di Gibbs ΔG
ΔG < 0, a reaction/process will occur spontaneously
ΔG > 0, it won’t
Ka
Entalpia ΔH
Entropia ΔS
Capacita’ termica ΔCp
HEAT CAPACITY
Heat
_______
time
=
q
____
t
= heat flow
Temp. increase
ΔT
=
= heating rate
time
t
q
__
t
______
ΔT
____
t
=
q
____
ΔT
=
Cp
= Heat capacity
Microcalorimetry
™ Isothermal Titration Calorimetry (ITC)
Measures the heat developed/absorbed during a
(binding) reaction between molecules in the sample
cell and molecules injected
™ Differential Scanning Calorimetry (DSC)
Measures differences in heat capacity between
reference and sample cell due to dissociation or
melting of macromolecules in solution
•Ka and enthalpy (ΔH) can be determined
directly.
•Entropy (ΔS) can be calculated from these
values.
•Heat capacity, ΔCp, can also be obtained by
varying the temperature of the experiment.
ITC
A+B
Ka
Kcal/mol
mol I
Kcal/
ITC
C
[B] tot
ITC
B
A
Adiabatic jacket
ITC Measurements
• When an injection is made, heat will be
generated or absorbed by the molecules
reacting (exothermic or endothermic reactions)
• Heat input in sample cell adjusted to keep ΔT
constant
• Exothermic reaction will result in negative peaks
(less heat is needed while the reaction proceeds)
• Endothermic reactions will result in positive peaks
(more heat is needed while the reaction proceeds)
ITC Measurements II
• The heat input is integrated over time
until the it returns to the baseline value
• The heat generated/absorbed after any
given injection is a function of amount of
ligand in that injection, total amount of
ligand injected until that point of the
experiment, concentration of the
molecule in the cell, number of binding
sites, binding constant and ΔH of the
reaction
ITC Measurements III
• The observed heat change per injection
(dq/dLT) is fitted to the theoretical binding
curve, rather than the “standard” binding
curve that plots total change versus total
added ligand.
The ITC experiment
• The sample cell holds approx. 1.4 ml, but must
be overfilled, so each experiment uses 1.8-2.0
ml of sample
• The contents of both cells and of the syringe
must be degassed to avoid bubbles forming
• The cells must be filled carefully, as bubbles
caught on the side of the cell will ruin the
experiment
• Buffer blanks must be recorded to correct for
dilution effects
The ITC experiment II
• Certain things must be taken into
consideration when setting up an ITC
experiment:
– The ligand and the molecule in the cell MUST be
in the exact same buffer to avoid large injection
peaks due to dilution
– If protonation/deprotonation is expected to be part
of the reaction, a buffer with a low ΔHion must be
chosen, as ΔHobs= ΔHbind + ΔHion
– No other reactions should be taking place on the
timescale of the experiment
ITC BINDING CURVES
•
From Andersen et al. (2001), Biochem. 40; 15408-17
ITC
Q = V0 ΔH [M]t Ka [L] / (1 + Ka [L])
ITC
Isothermal Titration Calorimetry
Contro
¾ Requires ΔH > ± 3-5
¾ Works in solution
kcal/mol for precise
¾ Measures equilibrium data
determinations
¾ Determines the
¾ Most often requires
thermodynamics the of
macromolecule
concentrations in the
binding reaction
range 1 µM – 1 mM
¾ Automatic titration – setup
¾ Consumes “large”
and leave
amounts of purified
¾ No labelling/immobilization material
¾ Tight or very weak
binding
¾ Slow – 2-3 Insensitive
to very hours per run
Pro
Measuring very tight binding
•
ITC is not good for measuring very tight binding directly, although DH
can be determined accurately
•
From Leavitt and Freire, (2001), Curr. Op. Struct. Biol. 11; 560-6
ITC
Very tight binding II
• But one can do a competition assay:
– First we make a complex with a weak-binding
ligand
– We then compete with a stronger binding
ligand
– Kapp= Ka,s/(1+Ka,w[X])
ITC
•
Very tight binding III
From Velazquez-Campoy et al. (2001), ABB 390; 169-75
ITC Alternatives
• Surface Plasmon Resonance
• Requires attachment of molecules to chip
• Can give on and off rates
• Intrinsic Fluorescence
• Requires sensitive* Trp or Tyr residue(s) close to
binding site
• Interfering agents such as BSA must be absent
• Titrating in the ligand can give an increased signal by
itself
• Works in solution
• Potentially much more sensitive
ITC Alternatives II
• Extrinsic Fluorescence
• Requires labeling of macromolecule – most often by
introducing single cysteines in select locations
• Bulky fluorophores on surface of molecule may
interfere with binding
• Works in solution
• Much more sensitive (depending on fluorophore)
• Can give additional information about internal
distances using two defined fluorophores and FRET
DSC
Folded (N)
Unfolded (U)
N
ΔG = ΔH -TΔS
Kunf
U
ΔG = -RT ln Kunf
Protein stability : General Observations
ΔG = ΔH -TΔS
ΔG = 0
equilibrio tra stato nativo e denaturato
ΔG > 0
stato nativo piu’ stabile di quello denaturato
ΔH is positive for unfolding:
favorable interactions in the folded state are disrupted
ΔS is often positive, but:
disorder increases due to increased freedom of bond
rotation
disorder decreases due to the hydrophobic effect
Denaturazione avviene quando TΔS > ΔH
Apparecchiatura DSC
Differential Scanning Calorimetry (DSC)
• The reference cell contains buffer (exactly the same
as the sample is dissolved in)
• The two cells are heated at a constant rate
• The cells are pressurized, allowing a range of 2-130º
C to be measured (-10-130º C if one dare to unlock
the protection of the system)
• Differences in energy required to heat the two cells is
a measure of the heat capacity Cp of the dissolved
sample
• Dissociation or denaturation of a macromolecule will
result in a peak at the transition (melting)
temperature Tm
• If reversible, a negative peak should be seen on the
down scan as the molecule readopts the folded
structure
DSC setup
• DSC cells are filled with buffer and started
scanning 8-10 times before doing the real
experiment to establish a baseline
• When the instrument has almost cooled down to
the starting temperature, the sample cell is
loaded with the macromolecule
• If the molecule does not survive being cooked,
this is repeated for each run
DSC setup II
• Reactive buffer components should be
avoided to keep the baseline heat capacity
stable between runs
• The sample must be pure to avoid
additional unfolding event during the
experiment
• The cells hold less than 0.6 ml, but loading
the cells require 0.8-1.0 ml
Cp (kcal/mol•˚C)
Tm
DSC
Temp (˚C)
Tm is the temp.
at which
∆Gunfolding = 0..
ΔCp
Area under the curve
reflects ∆Hcal
DSC APPLICATIONS
• Measuring the stability of macromolecules
– Testing that functional mutations are representative
for the molecule looked at, rather than just being
misfolded
• Determining the number of domains in a protein
• Determining the oligomeric state of a protein
Tm, ΔH and ΔCp of the transition are calculated by fitting the
data to a two-state transition model using non-linear least
squares regression analysis
Ligand-Induced Stabilization
U
N+Q
X
Any thermodynamically favorable modification
of the native structure that takes place will
enhance the stability of the folded state (N)
vs. the denatured state (U).
DSC
Ligand-Induced Stabilization
Tm increases from 57˚C to 96˚C
∆Gunf at 25˚C increases from 20.5 kcal/mol to 40.5 kcal/mol
Tm is function of :
•Enthalpy of DNA melting
•Drug binding constant
DSC Alternatives
• Circular dichroism (CD)
– Follows the circular polarization of light at a
wavelength sensitive to secondary structure
elements while the sample is heated
– Not all proteins have enough secondary structure
for this approach to work
– Glass cells and the use of waterbaths to control
the temperature limits the range to 0-100º C
• Intrinsic fluorescence
– Follow changes in Trp or Tyr fluorescence as the
sidechains changes environment upon protein
denaturation
– Heated in same manner as CD sample
Surface Plasmon Resonance SPR
analyte
ligand
n2 < n1
n1
Θ
ΘC
Total Internal Reflection
Cella : 20-60 nl
Flusso : 1-100 μl/min
Ligando : 50 pg/mm2
What SPR Biosensors
Measures
Kinetics
Kinetics
Affinity
Affinity
Specificity
Specificity
Active
Active Concentration
Concentration
Thermodynamics
Thermodynamics
How fast
and strong
…
How
specific &
selective...
Is the binding of
a lead compound
Is this drug
binding to its
receptor?
How
much...
Biologically
active
compound is
in a
production
batch?
Rate Constants
Association rate
constant kon
Definition
Unit
Describes
Typical range
A+B
kon
AB
Dissociation rate
constant koff
AB
koff
A+B
[M-1s-1]
[s-1]
Rate of complex
formation, i.e. the
number of AB formed
per second in a 1 molar
solution of A and B
Stability of the complex
i.e. the fraction of
complexes that decays
per second.
1x10-3 – 1x107
1x10-1 – 5x10-6
Time (sec)
Association : dR/dt = KonCRmax – (KonC + Koff) R
Dissociation : ln(Ro/Rt) = Koff (t-t0)
Binding constant : Ka = Kon / Koff
Req/C = KaRmax - KaReq
Equilibrium Constants
Equilibrium dissociation
constant KD
Definition
Unit
Describes
Typical range
Equilibrium association
constant KA
(A).(B) koff
=k
on
(AB)
k
(AB)
= kon
(A).(B) off
[M]
[M-1]
Dissociation tendency
High KD = low affinity
Association tendency
High KA = high affinity
1x10-5 – 1x10-12
1x105 – 1x1012
Affinity and Equilibrium
Signal [RU]
20
15
10
5
0
Time [s]
0
60
120
Same Affinity but different Kinetics
• All four compounds have the same affinity KD = 10 nM
= 10-8M
• The same affinity can be the result from different
kinetics
kon
koff
[M-1s-1] [s-1]
All target
sites
occupied
100 nM
30 min
106
10-2
105
10-3
104
10-4
103
10-5
60 min
KD 10 nM
1 µM
30 min
60 min
Concentration
• Signal proportional to
mass
• Same specific
response for different
proteins
Applications :
-Kinetic measurements
-Kon (<106 M-1s-1)
-Koff (10-5 -1 s-1)
-Equilibrium measurements
-Binding affinity
-enthalpy
-Ligands evaluation
Not suitable for :
Small analytes (100 Da)
- High affinity interactions
(Kd<10nM)
Advantages :
-Weak interactions Kd>100μM
- Small sample volume
Problems :
- Cost of the apparatus
- Ligand immobilization
Immobilization
Immobilization
DIRECT (covalent)
INDIRECT
amine – Lys
thiol – Cys
aldehyde - carbohydrate
suitable binding site
tag
Experimental Design
– Direct coupling of Ligand to Surface.
– Indirect, via a capture molecule (eg a specific IgG).
– Membrane anchoring, where the interacting ligand is on the surface of a
captured liposome.
Immobilization : Problems
Heterogeneug coupling
Interference with analyte binding
Interference with ligand structure/activity
NEW DEVELOPMENTS:
Calorimetric data
Recovery
SPR-MS
Arrays
SPR microscopy or imaging
MICRORECOVERY
SPR-MS
MICROFLUIDIC in SPR
F1
F1 & 2
F2
F3 & 4
F3
F1 - 3
F4
F1 - 4
Spot 1
ot 2
Spot 3
Spot 4
(Reference)
Spot 5
SPR Microscopy (SPRM or SPRI)
Spatial resolution 4 μm
SPR imaging
SPR spectroscopy
Principle of SPR microscopy. SPR reflectivity curves versus the light's incident angle
(at fixed wavelength) for samples of two different effective refractive indices in contact
with the gold surface. There is a linear region on the left where the light intensity
increases almost proportionally with the change in effective refractive index. If the
microscope is set up at an angle in this so-called high-contrast region, the intensity
change measured at fixed angle is proportional to the change in effective refractive
index, which in turn is proportional to adsorbate coverage.
Advantages of SPRM for high-throughput bioaffinity assays
• Simultaneous monitoring of rates of >1000 different interactions
• Label-free detection
• Absolute quantification of binding amounts and ratios
• Kinetic measurements with 1 s time resolution
• Detection limit: 80 fg, or 1 attomole (<1 million molecules) for 60-kDa
proteins
• Can detect small ligands (<300 Da)
• Near perfect referencing for removing spurious signals due to changes in
index of refraction of buffer solutions, temperature, etc.
• Requires much less of the precious biomolecules than normal SPR:
○ On-chip receptors: requires only enough of each for spotting 1 nL
droplet onto microarray
○ Solution-phase biomolecules in the flow cell: requires 1000-fold less,
since >1000 interactions probed with every injection to cell
• SPR-active chips typically compatible with inexpensive but reliable robotic
spotters
• Timely: many new methods for spotting protein arrays and arrays of other
receptors on gold have recently been developed
Example potential applications of SPRM
for high-throughput bioaffinity analyses
• Analyses of protein and ligand concentrations with protein or
antibody arrays
• Analysis of concentrations of DNA-binding proteins from small cell
colonies with dsDNA arrays
• Screening for ligands that bind to proteins: drug discovery
• Screening for substrates (peptides) for catalysis by proteases or
kinases, and the relative reaction rates of different peptides
• Searches for cofactors in all sorts of protein binding events
• Fundamental research in proteomics, neurobiology, cell biology, …
• Arrays designed for early disease diagnostics, other clinical
applications, …
1020 spot protein microarray
Coupling SPRi and ProteinChip based mass spectrometry
SPR image and mass spectra obtained from a single 10 × 10 antibody array
containing all five antibodies, incubated with a solution containing the five
proteins
Rapid kinetic experiments
stopped flow
Cinetica enzimatica
0.630
0.60
0.55
0.50
0.45
0.40
0.35
0.30
0.25
0.20
0.15
0.10
0.05
0.000
0.0
10
20
30
40
50
60
min
70
80
90
100
110
1.1
1.0
0.9
0.8
0.7
Vi / Vo
A
0.6
0.5
0.4
0.3
0.2
0.1
0.0
-0.1
0
200
400
concentrazione C 4 (nM )
600
800
E+S
E+S
E+P
ES
E+P
Rapid kinetic experiments
stopped flow
0,06
0,05
0,04
dA243
0,03
0,02
0,01
0,00
-0,01
0
2
4
6
t/s
8
10
12
Transient Kinetics Recordings (Fluorescence and CD)
Refolding kinetics of Lysozyme
Followed by CD at 225 nm and simultaneous
recording of fluorescence at >305 nm
Traces correspond to 5 accumulated shots.
Folding was initiated by 10 fold dilution of 3 mg/mL
lysozyme denaturated in 6 M guanidine-cl (final
concentration 0.3 mg/mL)
Cuvette light path = 1.5 mm (FC-15 model)
Experiment dead time = 2 ms
Sampling rates from 50 µs/point (20kHz) to
100 s/point (0.1 Hz) can be used
Applications
Measured by:
Stopped-Flow Experiments
Protein Folding
Conformational Changes
Substrate Binding
Enzyme Kinetics
Substrate Transport in Vesicles
UV/VIS Absorbance
Light Scattering
Fluorescence
Circular Dichroism
Fluorescence Anisotropy
FTIR
X-ray scattering
Conductivity
Mass Spectrometry
Author
Document
Category
Uncategorized
Views
0
File Size
8 959 KB
Tags
1/--pages
Report inappropriate content