close

Enter

Log in using OpenID

3 - Cerere

embedDownload
Pisa, 24 gennaio 2014
“Aggiornamento sulle malattie virali trasmesse da vettori”
Dipartimento di Scienze Veterinarie – Università di Pisa
RICERCA DI ARBOVIRUS
NEGLI INSETTI VETTORI IN DUE AREE
ITALIANE AD ALTA DENSITA’ DI CULICIDI
Paolo Ravanini, MD
AOU Maggiore della Carità di Novara
Microbiologia – Laboratorio di Virologia Molecolare
Sede di Galliate
Arbovirosi in Europa
GLOBALIZZAZIONE
ATTIVITA’ DELL’UOMO
TRASPORTI
INCREMENTO ARBOVIROSI
UCCELLI MIGRATORI
TURISMO
CAMBIAMENTI CLIMATICI IMMIGRAZIONE
Problema dell’aumento delle arbovirosi, in particolare dovuto a:
- cambiamenti climatici
(aumento delle temperature estive più che inverni miti)
- introduzione di animali e insetti da zone endemiche
(zanzare tropicali – es Aedes albopictus o “zanzara tigre”)
- facilità degli spostamenti umani
Arbovirosi in Italia
Da tempo presenti sul nostro territorio:
- TBEV (encefalite da zecche) – in espansione
- TOSV (meningoencefalite da Toscana Virus) – forse in espansione
- Sandfly Naples e Sandfly Sicily (malattia febbrile)
- Tahyna (malattia febbrile, polmonite e encefalite) – ? poco conosciuto
- Batai (malattia febbrile) – poco conosciuto
- Sindbis (febbre e artralgia) – ? poco conosciuto
Comparse negli ultimi anni:
- West Nile (febbre e encefalite)
- Usutu (encefalite)
- Chikungunya (febbre, artralgia e encefalite)
A rischio di ingresso nel nostro paese:
- Dengue (febbre, artralgia e febbre emorragica)
- CCHFV (febbre emorragica da Crimea-Congo)
- Rift Valley (febbre emorragica)
- JEV (japanese encephalitis virus – encefalite)
RECENTI OUTBREAK EPIDEMICI IN ITALIA (1)
2007: virus Chikungunya
(Emilia Romagna)
In totale, 247 casi
probabili/confermati,
coinvolte quattro province
(Ravenna, Forlì/Cesena,
Rimini, Bologna)
9
39
103
19
15
6
RECENTI OUTBREAK EPIDEMICI IN ITALIA (2)
2008 - 2013: virus West Nile
Emilia Romagna – Veneto – Lombardia – Friuli – Sardegna – Basilicata – Puglia
Casi con malattia neuro-invasiva
Emilia R. - Veneto
2008
8
2009
18
2010
3
2011
14
Veneto - Friuli Sardegna
2012
28
Veneto - Sardegna Friuli - Basilicata
2013
40
Veneto - Lombardia
- Emilia R. - Puglia
Emilia R. - Veneto Lombardia
Veneto
RECENTI OUTBREAK EPIDEMICI IN ITALIA (3)
2009: virus Usutu
Modena e Bologna (Emilia-Romagna)
2 casi di encefalite
Arbovirus di interesse umano presenti in Europa e in Italia
da Zecche
Orbivirus (Reoviridae):
Gruppo Great Island (Kemerovo, Lipovnik, Tribec) - Argas, Ixodes, Ornithodoros
Coltivirus (Reoviridae):
Virus Eyach - Ixodes
Flavivirus (Flaviviridae):
Virus dell’encefalite da zecche o TBEV (CEEV) e Virus Louping Ill - Ixodes ricinus (e altre?)
Thogotovirus (Orthomyxoviridae):
Virus Thogoto e virus Dhori - Rhipicephalus (e Ixodes e Hyalomma)
Nairovirus (Bunyaviridae):
Virus Crimean-Congo o CCHFV - Hyalomma, Dermacentor, Rhipicephalus
Phlebovirus (Bunyaviridae):
Virus Uukuniemi - Ixodes
da Zanzare e Flebotomi
Alphavirus (Togaviridae):
Virus Chikungunya - Aedes albopictus
Virus Sindbis - Aedes albopictus (e altre: Culex, Culiseta, Aedes) - ma anche zecche (Hyalomma)
Flavivirus (Flaviviridae):
Virus Dengue (4 virus) - Aedes albopictus
Virus West Nile - Culex (quinquefasciatus, tarsalis, pipiens, ecc.) e Aedes
Virus Usutu - Culex
Orthobunyavirus (Bunyaviridae):
Gruppo California (Virus Tahyna e Virus Inkoo) - Aedes (vexans), Culex
Gruppo Bunyamwera (Virus Batai) - Aedes, Culex, Anopheles
Phlebovirus (Bunyaviridae):
Virus Toscana - Phlebotomus perniciosus e Phlebotomus perfiliewi
Virus Sandfly Fever Naples e Virus Sandfly Fever Sicily - Phlebotomus papatasii
Culicidi presenti in Nord Italia (principali specie)
Genere Culex
Culex pipiens
Culex modestus
Culex hortensis
Culex territans
Genere Ochlerotatus
Ochlerotatus caspius
Ochlerotatus geniculatus
Ochlerotatus berlandi
Genere Aedes
Aedes vexans
Aedes albopictus
Genere Anopheles
Anopheles maculipennis
Anopheles plumbeus
Genere Culiseta
Culiseta annulata
Nostro studio: Ricerca di Arbovirus nelle zanzare di due aree italiane
Area attorno a Novara:
- area con forte presenza di culicidi
- pochi studi
2009
2010-11
Raccolte di culicidi in due aree
geografiche distinte, ma caratterizzate
da particolari ambienti che favoriscono
un’alta densità di zanzare durante il
periodo estivo
Provincia di Novara: estate 2009
Province di Modena e Bologna: estati 2010 e 2011
Provincia di Novara
Ambiente fluviale
- fiume Ticino (parco naturale), fiume Sesia
- torrente Agogna, torrente Terdoppio
- canali Cavour e Quintino Sella, numerosissimi canali irrigui
Ambiente fluviale
- fiume Ticino (parco naturale), fiume Sesia
- torrente Agogna, torrente Terdoppio
- canali Cavour e Quintino Sella, numerosissimi canali irrigui
Ambiente risicolo
- “zona del riso”: province di Novara, Vercelli e Pavia
Allevamento
- numerose stalle animali (specialmente bovine)
Ambiente urbano
- forte concentrazione urbana (densità 256 ab/kmq in provincia),
che sale a 592 ab/kmq tra Novara e l’Ovest Ticino
(comuni di Novara, Trecate, Galliate, Oleggio, Bellinzago, Arona, Castelletto T., e altri 4 comuni)
1 - SCELTA SITI E PERIODI DI CATTURA
Tipologie di ambiente
Ambiente fluviale
(Bellinzago – Vecchio Mulino
del Parco del Ticino)
coordinate GPS: 45°34'23”N; 8°41'43”E
Ambiente di stalla animale
(Caltignaga – stalla di bovini)
coordinate GPS: 45°30'52”N; 8°35'05”E
Ambiente risicolo
(Vespolate – zona agricola)
coordinate GPS: 45°21'34”N; 8°37'16”E
Ambiente urbano
(Novara – quartiere S.Agabio)
coordinate GPS: 45°26'46”N; 8°38'23”E
Programma delle catture (anno 2009)
Periodi di cattura
Prima cattura (early summer) – dal 10 al 25 giugno
Seconda cattura (middle summer) – dal 20 luglio al 5 agosto
Terza cattura (late summer) – dal 10 al 25 settembre
Tipologie di ambiente
Ambiente fluviale
(Bellinzago – Vecchio Mulino del Parco del Ticino)
Ambiente di stalla / allevamento animale (Caltignaga – stalla di bovini)
Ambiente risicolo (Vespolate – zona agricola)
Ambiente urbano (Novara – quartiere S.Agabio)
Province di Modena e Bologna
Periodi di cattura:
2010: 21-29 settembre 2010
2011: 2-10 settembre 2011
2010
2011
Rastignano
Pontecchio Marconi
Pianoro
Sasso Marconi
Pontecchio Marconi
Ca' Vecchia
Sasso Marconi
Borgonuovo
Ponte Ronca
Crespellano
Bazzano
Savignano sul Panaro
2 -CATTURA DEI CULICIDI
Trappola a CO2
Posizionata per circa 15 ore
IDENTIFICAZIONE DELLE ZANZARE E ALLESTIMENTO DEI POOL
Identificazione di specie su basi morfologiche lo stesso giorno della raccolta
Allestimento di pool di 10 esemplari (secondo specie, luogo e tempo di raccolta)
3 – TRATTAMENTO DEI POOL
OMOGENEIZZAZIONE DEI POOL
ESTRAZIONE DEGLI ACIDI NUCLEICI
ESTRATTORE AUTOMATICO
NucliSENS EasyMag (Bio-Merieux)
100 µL di omogenato + 400 µL H2O → 50 µL eluato
RETROTRASCRIZIONE
con random primers
RevertAid First Strand cDNA Synthesis Kit
(Fermentas)
4 - PROTOCOLLI DI AMPLIFICAZIONE
ALPHAVIRUS
Nested PCR→ amplificazione frammento di 195 bp del gene nsP4
primers esterni: Alpha1+ (5'-GAYGCITAYYTIGAYATGGTIGAIGC-3')
Alpha1- (5'-KYTCYTCIGTRTGYTTIGTICCIGG-3')
primers interni: Alpha2+ (5'-GIAAYTGYAAYGTIACICARATG-3')
Alpha2- (5'-GCRAAIARIGCIGCIGCYTYIGGICC-3')
FLAVIVIRUS
Eminested PCR→ Amplificazione frammento di 220 bp del gene NS5
primers esterni: cFD2 (5'-GTGTCCCAGCCGGCGGTGTCATCAGC-3')
MAMD (5'-AACATGATGGGRAARAGRGARAA-3')
primers interni: cFD2 + FS778 (5'-AARGGHAGYMCDGCHATHTGGT-3')
ORTHOBUNYAVIRUS
One step PCR → Amplificazione frammento di 251 bp del segmento s
BCS82C (5'-ATGACTGAGTTGGAGTTTCATGATGTCGC-3')
BCS332V (5'-TGTTCCTGTTGCCAGGAAAAT-3')
One step PCR → Amplificazione frammento di 210/250 bp del segmento s
Cal/Bwa For (5'-GCAAATGGATTTGATCCTGATGCAG-3')
Cal/Bwa Rev (5'-TTGTTCCTGTTTGCTGGAAAATGAT-3')
5 - RIVELAZIONE DEGLI AMPLIFICATI
RIVELAZIONE SU GEL DI AGAROSIO
Corsa elettroforetica su gel di agarosio 4% (5V/cm per 90 min.) con EtBr
Acquisizione immagine mediante Gel Doc XR System (Biorad)
PURIFICAZIONE DELLE BANDE SOSPETTE
Purelink Quick Gel Extract (Invitrogen)
SEQUENZIAMENTO DIRETTO
e DOPO CLONAGGIO
CloneJET PCR cloning kit (Fermentas)
BigDye Terminator v1.1 Cycle Sequencing Kit (Applied BioSystem)
Sequenziatore ABI PRISM modello 3130 (Applied BioSystem)
ALLINEAMENTO IN GENBANK E COSTRUZIONE ALBERI FILOGENETICI
BLAST (http://blast.ncbi.nlm.nih.gov) algoritmo blastn con impostazioni di default
Programma MEGA 4: metodo di Neighbor-Joining (analisi maximum composite likelihood 1000 bootstrap)
6 - ISOLAMENTO IN COLTURA
Isolamenti effettuati presso l’Università di Helsinki in Finlandia (dott.ssa Huhtamo e prof. Vapalahti)
Utilizzate le linee cellulari: C6/36 in terreno L-15; BHK-21 e Vero E6.
Nei casi con presenza di effetto citopatico (virus Batai), le cellule e il surnatante sono stati raccolti e
analizzati con RT-PCR per confermare la presenza del virus.
7 – SEQUENZIAMENTO DELL’INTERO GENOMA VIRALE
Nel caso del virus Batai (BATV) è stato possibile sequenziare l’intero genoma (segmento S 943 nt,
segmento M 4440 nt, segmento L 6870 nt).
Sequenziamenti effettuati presso il CDC di Fort Collins in USA (dott.ssa Lambert e prof. Lanciotti).
Next Generation Sequencing (NGS): Ion Torrent Personal Genome Machine system (Life Technologies)
e 5’ e 3’ RACE kits (Life Technologies) per le parti terminali.
RISULTATI
1 - INDAGINE ENTOMOLOGICA (NOVARA 2009)
Totale zanzare catturate 2589 – Totale pool allestiti 273
Specie
Periodo 1
(early summer)
Periodo 2
(middle summer)
Periodo 3
(late summer)
288 (70,6%)
1.082 (52,8%)
100 (75,2%)
1470 (56,8%)
Anopheles maculipennis
20 (4,9%)
765 (37,4%)
1 (0,8%)
786 (30,4%)
Culex modestus
40 (9,8%)
120 (5,9%)
3 (2,3%)
163 (6,3%)
Ochlerotatus caspius
49 (12,0%)
54 (2,6%)
4 (3,0%)
107 (4,1%)
Aedes vexans
11 (2,7%)
23 (1,1%)
24 (18,0%)
58 (2,2%)
Ochlerotatus geniculatus
-
3 (0,1%)
-
3 (0,1%)
Culiseta sp.
-
-
1 (0,8%)
1 (<0,1%)
Aedes albopictus (z.tigre)
-
1 (<0,1%)
-
1 (<0,1%)
408
2.048
133
2589
Culex pipiens
totali
1 - INDAGINE ENTOMOLOGICA (MODENA-BOLOGNA 2010/11)
Totale zanzare catturate 614 – Totale pool allestiti 62
Specie
2010
(late summer)
2011
(late summer)
520 (100%)
85 (90,4%)
605 (98,5%)
Ochlerotatus caspius
-
5 (5,3%)
5 (0,8%)
Aedes albopictus (z.tigre)
-
3 (3,2%)
3 (0,5%)
Aedes vexans
-
1 (1,1%)
1 (0,2%)
520
94
614
Culex pipiens
totali
2 – INDAGINE VIROLOGICA
Risultati 24 pool positivi dopo sequenziamento su un totale di 335 pool (7,2%)
Novara
2009
Modena-Bologna
2010-11
-
-
-
Virus Usutu (USUV)
2
2
4
Virus JEV
-
1
1
Insect Flavivirus
7
3
10
Virus Batai (BATV)
3
-
3
Virus Tahyna (TAHV)
2
4
6
14
(5,1% dei pool)
10
(16,1% dei pool)
24
ALPHAVIRUS
FLAVIVIRUS
ORTHOBUNYAVIRUS
totali
USUTU (USUV):
4 pools positivi
3R08
3F03
Culex pipiens
Novara (Vespolate)
Risaia (late summer 2009)
Aedes vexans
Novara (Bellinzago)
Fiume (late summer 2009)
M7
M1A
Culex pipiens
Modena/Bologna
Pianoro (Bo) – 2010
Culex pipiens
Modena/Bologna
Pontecchio M. (Bo) – 2011
Virus USUTU (USUV)
(Flaviviridae – gen. Flavivirus)
- Mosquito-borne flavivirus (Japanese Encephalitis Complex)
Vettori: zanzare del genere Culex
Reservoir: varie specie di uccelli, anche migratori
Patologie umane: malattie febbrili
Dal 2000 comparsa in Europa (Austria) e diffusione in altri paesi europei,
tra cui l’Italia. Primo isolamento italiano nel 2006 vicino a Milano. Presenza
del virus in molte regioni del Nord Italia.
Japanese Encephalitis (JEV):
M20
Culex pipiens
Modena/Bologna
1 pool positivo
Sasso Marconi (Bo) – 2010
Japanese Encephalitis Virus (JEV)
Mosquito-borne flavivirus (JE Complex)
•  Ampiamente diffuso in Cina, India e in altre regioni dell’Asia. Appare in
espansione in regioni dove precedentemente non era presente.
•  Vettori: zanzare del genere Culex
(in particolare Culex tritaeniorhynchus e Culex vishnui)
•  Reservoir animali: suini (maiali domestici) e uccelli (ardeidi)
•  La maggior parte delle infezioni umane sono inapparenti (300:1)
•  Può provocare encefaliti con elevata mortalità (30000-50000 casi/anno)
•  Uno dei più importanti flavivirus patogeni su scala mondiale
>JEV_pool_M20 167 bp
TCATGTGGCTTGGAGCACGGT
ATCTAGAGTTTGAAGCTTTGG
GGTTCCTGAATGAAGACCATT
GGCTGAGCCGAGAGAATTCA
GGAGGTGGAGTGGAAGGCTC
AGGCGTCCAAAAGCTAGGATA
CATCCTCCGTGACATAGCAGG
AAAGCAAGGAGGGAAAATGT
AC
Simile a un isolato da
un pipistrello in Cina
Primo riscontro di JEV
in zanzare Culex in
Europa
1996
•  4 Settembre – 2 Ottobre.
•  Area compresa fra Firenze,
Pistoia e Prato.
41 uccelli selvatici esaminati:
•  38 rinvenuti morti
•  3 ancora vivi
( muoiono dopo poche ore)
•  Vengono osservati o riferiti sintomi nervosi in:
Turdus merula
Sturnus vulgaris
.
Passer italiae
Turdus musicus *
* uccelli da richiamo
da Mani P., 2010
Nel 1997 campioni di organi e tessuti delle diverse specie sono stati inviati al
Central Research Institute of Epidemiology di Mosca (Platonov).
RT-PCR
Legenda:M= miocardio, K= rene, Bm= midollo osseo, Br= cervello, P= pancreas, S= milza
Frammenti amplificati NS5 ottenuti da due campioni positivi, sottoposti a sequenziamento
diretto e confrontati con GeneBank di riferimento hanno dimostrato omologia
(148 nucleotidi su 150) a :
JEV ceppo Ling (ACCESSION L78128)
l'omologia con genoma non-JEV è risultata inferiore all'80%;
Frammento di 552 nucleotidi del gene E-JEV estratto dall'RNA virale di 5 uccelli è risultato
altamente omologo ( differenze di 1-3 nucleotidi e 1 aminoacido) con :
ceppo NAKAYAMA/AF112298/,
l'omologia con non-JEV genoma è risultata inferiore all'70%.
da Mani P., 2010
Negli anni successivi, riscontro di positività anticorpale nei sieri di:
Fagiani (Migliarino): 1999 e 2007
Anatre da richiamo (Massaciuccoli): 2009
Cinghiali (varie aree del Parco): 2008 e 2009 (positività del 72% nel 2008)
Sieri sottoposti a:
Test ELISA per JE viruses group (ID Screen®, ID VET, Montpellier France):
positivi
Test di neutralizzazione per WNV e USUV:
negativi (presso il Centro di riferimento AZS di Teramo)
Positività sierologica a Flavivirus del Gruppo Encefalite Giapponese nel fagiano
(Phasianus colchicus) di allevamento in Toscana
Mani Paolo, Fratini Filippo, Bertelloni Fabrizio, Filogari Dario, Legrottaglie Rosalinda
VI International Symposium on Wild Fauna (Paris, 2009)
Serological survey of Japanese Encephalitis Virus Group (JE group) among wild boars (Sus
scrofa) and mallard ducks (Anas platyrhynchos) in Tuscany
Mani Paolo, Filogari Dario, Bertelloni Fabrizio, Fratini Filippo, Rossi Giacomo
III Convegno Nazionale Ecopatologia della Fauna Selvatica Torino 2009
Flavivirus JE Group in Toscana
JEV
1996
JEV
serological
Positivity
1999-2010
WNV
1998
da Mani P., 2010
Endemizzazione o ricomparsa periodica del virus?
Vicinanza geografica delle
aree dove è stato trovato il
JEV nelle zanzare e negli
uccelli
Le sequenze riscontrate
sembrano appartenere tutte
al genotipo 3 e sono simili tra
loro (due sole sostituzioni
nucleotidiche nella regione
NS5 di 167 nt)
Insect Flavivirus (ISF):
10 pools positivi
1F08
2F02
2F14
2F18
3F05
3R11
3U01
Culex pipiens
Novara (Bellinzago)
Fiume (early summer 2009)
Aedes vexans
Novara (Bellinzago)
Fiume (mid summer 2009)
M2B
M5B
M5C
Ochlerotatus geniculatus Novara (Bellinzago) Fiume (mid summer 2009)
Aedes vexans
Novara (Bellinzago)
Fiume (mid summer 2009)
Aedes vexans
Novara (Bellinzago)
Fiume (late summer 2009)
Aedes vexans
Novara (Vespolate)
Risaia (late summer 2009)
Culex pipiens
Novara
Amb. urbano (late summer)
Aedes albopictus
Modena/Bologna
Sasso Marconi (Bo) – 2011
Aedes albopictus
Modena/Bologna
Borgonuovo (Bo) – 2011
Aedes vexans
Modena/Bologna
Borgonuovo (Bo) – 2011
Insect Flaviviruses (ISF)
Flavivirus molto divergenti
Trasmissione solo tra insetti
(no infezioni nei vertebrati)
Possibilità di integrazione nel
genoma dell’insetto sotto forma
di DNA
BATAI (BATV):
2S29
2S59
2S72
3 pools positivi
Anopheles maculipennis Novara (Caltignaga)
Stalla bovina (mid summer)
Anopheles maculipennis Novara (Caltignaga)
Stalla bovina (mid summer)
Anopheles maculipennis Novara (Caltignaga)
Stalla bovina (mid summer)
Batai
(Bunyaviridae – gen. Orthobunyavirus)
Batai (sierogruppo Bunyamwera)
primo isolamento nel 1955 in Malesia, nel 1960 isolato in Europa
presente in Europa centrale, in Asia e Africa
vettori: zanzare del genere Anopheles
reservoir principale: ruminanti e uccelli
Patologie umane: malattie febbrili
Riassortimento con virus Bunyamwera in Africa
---> Virus Ngari (febbri emorragiche)
Distribuzione geografica di BATV ritenuta storicamente l’Est-Europa
BATV
Recente isolamento di BATV anche in Germania (Jost et al, 2011)
Evidenze sierologiche e molecolari della presenza di BATV anche in Italia (Calzolari et al., 2010)
a poca distanza dal luogo del nostro isolamento (Zerbolò – Pv)
Campione 2S29 (“Caltignaga strain”) isolato in Finlandia (prof. Vapalahti e dott.ssa Huhtamo)
e completamente sequenziato a Fort Collins in USA (prof. Lanciotti e dott.ssa Lambert)
Abbiamo voluto continuare lo studio
sulla presenza del virus Batai con:
1 - indagine sieroepidemiologica per
la ricerca di Ab anti-Batai nel
reservoir animale (bovini).
2 - indagine sieroepidemiologica
analoga su campioni umani.
Risultati della ricerca degli anticorpi anti-Batai nei bovini della stessa stalla:
IFA (Novara e Helsinki) e confermati con test di neutralizzazione (Fort Collins)
Confermata la positività anticorpale anti-BATV in 9 bovini
in un totale di 130 bovini testati (7%)
Nessun siero umano con positività confermata
(3 campioni dubbi non confermati) su 81 sieri testati
Serological Evidence of Batai Virus Infections, Bovines,
Northern Italy, 2011
Amy J Lambert, Eili Huhtamo, Tiziana Di Fatta, Marco De Andrea, Alberto
Borella, Olli Vapalahti, Olga Kosoy, Paolo Ravanini
(in corso di pubblicazione)
Neutralization of Orthobunyaviruses with Bovine Sera
Bovine Serum
Sample
68
82
83
84
91
93
107
117
125
Batai
320
320
320
160
160
160
40
1280
640
Cache Valley
160
80
160
80
160
80
20
320
320
Bunyamwera
80
80
10
40
10
10
10
160
160
Tahyna
<10
<10
<10
<10
<10
<10
<10
<10
<10
Toscana
<10
<10
<10
<10
<10
<10
<10
<10
<10
Virus
TAHYNA (TAHV):
6 pools positivi
2U12
2S48
Culex pipiens
Anopheles maculipennis Novara (Caltignaga)
Stalla bovina (mid summer)
M29
M32
M38
M2A
Culex pipiens
Modena/Bologna
Ponte Ronca (Bo) – 2010
Culex pipiens
Modena/Bologna
Crespellano (Bo) – 2010
Culex pipiens
Modena/Bologna
Bazzano (Bo) – 2010
Culex pipiens
Modena/Bologna
Sasso Marconi (Bo) – 2011
Novara
Amb. urbano (mid summer)
Tahyna
(Bunyaviridae – gen. Orthobunyavirus)
Tahyna (sierogruppo California)
primo isolamento nel 1958 in Slovacchia
presente in gran parte d’Europa
vettori: zanzare dei generi Aedes e Culex
reservoir: piccoli mammiferi selvatici (lepri, conigli)
Patologie umane: malattie febbrili, più raramente polmoniti e encefaliti
BATV sembra circolare in Europa da molto tempo, con limitate variazioni
nucleotidiche
Non vi è finora evidenza di eventi di riassortimento con altri virus dello stesso
gruppo in Europa
Il riscontro dei nuovi ceppi di BATV in Germania e in Italia può essere dovuto
all’aumento della sorveglianza, ma potrebbe anche essere dovuto ad una
diffusione del virus in aree geografiche diverse.
BATV circola attivamente in Italia (dimostrazione della circolazione tra vettore e
reservoir animale), ma finora riscontrato solo nel Nord-Ovest (reale diffusione
sconosciuta)
TAHV è stato isolato in molte regioni d’Europa.
Nel nostro studio, il riscontro di TAHV nelle due differenti aree di raccolta, e in
anni diversi, può far ipotizzare una ampia diffusione del virus nel nostro paese.
Poco si conosce sulla diffusione, sul meccanismo di trasmissione e sulla
possibilità di riassortimento di questi virus.
Le infezioni umane sono probabilmente molto sottostimate.
JEV – BATV – TAHV
La presenza dei virus in Italia e le possibili infezioni umane e veterinarie (e
il loro reale impatto sulla salute pubblica) possono essere sottostimate.
Riteniamo vi sia l’esigenza di estendere la sorveglianza anche al virus
dell’Encefalite Giapponese e agli Orthobunyavirus, considerati
erroneamente virus “minori”.
La sorveglianza dovrebbe prendere in considerazione l’aspetto
entomologico, virologico, veterinario (reservoir degli animali domestici e
selvatici) e umano.
Necessaria una stretta collaborazione tra:
Entomologi
Veterinari
Medici
Responsabili sanità pubblica
RINGRAZIAMENTI
Laboratorio di Virologia Molecolare
AOU Maggiore della Carità di Novara
Sede di Galliate
Istituto Haartman
Università di Helsinki (Finlandia)
Maura Bandi
Stefano Costantino
Maria Grazia Stella Crobu
Valentina Ilaria
Letizia Krizmancic
Anna Maria Nicosia
Vittorio Quaglia
Luca Servino
Tiziana Di Fatta
Laboratorio di Biologia Molecolare
Anatomia Patologica – Novara
Renzo Boldorini
Sara Allegrini
Umberto Miglio
Claudia Veggiani
Alessia Paganotti
Università Amedeo Avogadro
del Piemonte Orientale
Rosalba Minisini
Andrea Magri
Marco De Andrea
Olli Vapalahti
Eili Huhtamo
Essi Hasu
Irina Suomalainen
Centers for Disease Control
and Prevention
Fort Collins (USA)
IPLA – Torino
Ivan Grasso
Laboratorio di Microbiologia
Università di Modena
William Gennari
Monica Pecorari
Anatomia Patologica
Università di Modena
Francesco Rivasi
Amy Lambert
Robert Lanciotti
Olga Kosoy
Dip. di Scienze Veterinarie
Università di Pisa
Paolo Mani
Servizio di Veterinaria
ASL Novara
Franco Tinelli
Alberto Borella
Author
Document
Category
Uncategorized
Views
0
File Size
7 503 KB
Tags
1/--pages
Report inappropriate content