close

Enter

Log in using OpenID

Biologie moléculaire des hémopathies lymphoïdes

embedDownload
Biologie moléculaire
des hémopathies lymphoïdes
WE Hémato-bio de l’AIH
23-24 Mai 2014
Cédric PASTORET
AHU Hématologie-Biologie moléculaire
Laboratoire d’Hématologie, Pr FEST
CHU Rennes
Plan
Leucémie aigue lymphoblastique
– Bilan initial
• Recherche des transcrits de fusions
• Deletion IKZF1 (LAL B)
• Marqueurs oncogénétiques (LAL T)
– Maladie résiduelle
– Perspectives
Lymphomes B matures
–
–
–
–
Clonalité
Lymphome folliculaire
Lymphome du Manteau
Maladie de Waldenström
Bilan initial LAL
 Myélogramme
 Blastes lymphoblastiques
 Cytochimie Peroxydase –
 Phénotypage
 Diagnostic
 Classification EGIL
 Thérapeutique: CD20+ (GRAALL-R)
 Suivi (Maladie résiduelle)
Prise en charge des prélèvements
SANG
MOELLE
LIQUIDES
GANGLION, PEAU
(LCR, Ascite, Pleural)
Suspension
cellulaire de CMF
Ficoll ou lyse des GR
(Si suspicion de SMP)
Fragment
Centrifugation,
Lyse des GR résiduels,
Lavage en PBS
Conservation à -20°C
ou -80°C
Culot cellulaire conservé
à -20°C (ADN) ou -80°C
(ARN)
ADN
ARN
Extraction par le Trizol
Digestion avec la protéinase K
et extraction par le NaCl 6M
Extraction par la résine CHELEX
si nbre GB < 10.106
Reverse transcription
PCR ou QPCR
PCR
Recherche des transcrits de fusion au diagnostic (1)
Reverse Transcription
5’
ARN
3’
+ Random hexamer
5’
3’
Random hexamer
Synthèse d’un ADNc
complémentaire de l’ARNm
ARN
+ Reverse transcriptase
+ dNTP
5’
3’ Elongation
5’
3’
3’
5’
Reverse
transcriptase
ADNc
+ RNase H
5’
3’ ADNc
Recherche des transcrits de fusion au diagnostic (2)
PCR en point final
• RT-PCR
quantité
d’ADN
– Amplification de l’ADNc par PCR
– Visualisation des produits d’amplification sur gel d’agarose
PCR en point final= Résultat qualitatif
PCR en temps réel
nombre de cycles
• RT-PCR en temps réel
– Quantitation du transcrit
– Détection de fluorescence en cours de réaction
• Utilisation de sondes Taqman
• Agent intercalant Sybrgreen
dénaturation
hybridation
élongation
Recherche des transcrits de fusion au diagnostic (3)
• LAL B
–
–
–
–
t(12;21)
t(4;11)
t(1;19)
t(9;22)
Piu et al, Lancet 2008
TEL-AML1
25% enfants
MLL-AF4 3% des enfants, 85% nourrissons <1an, 5% adultes
E2A-PBX1
20% des LAL pré-B, 3% adultes
BCR-ABL 3% enfants 40% adultes
Recherche des transcrits de fusion au diagnostic (4)
e1a2
e14a2
e13a2
Patient 3
Patient 2
Patient 1
e1a2
Gel agarose 2%
Gabert et al, Leukemia 2003
Témoin -
SD1
Témoin+
K562
Recherche de BCR-ABL
Délétion d’IKZF1 (1)
–Localisation : 7p13
–code le facteur de transcription lymphoïde IKAROS
–Régulateur transcriptionnel précoce de la lignée lymphoïde
–7 exons codants, plusieurs transcrits (11 isoformes)
–Facteur pronostique péjoratif pour les délétions focales
–Suivi de la maladie résiduelle
Mulligan et al, Nature 2008
Délétion d’IKZF1 (1)
CGH-array (Comparative genomic hybridization)
Caye et al, hematologica 2013
Délétion d’IKZF1 (1)
Technique MLPA (Multiplex ligation probes assay)
Sondes gauche et droite
spécifiques de la séquence
génomique
1.
Dénaturation de l’ADN et
hybridation des sondes
spécifiques
2.
Ligation des sondes hybridées
3.
PCR avec amorces universelles
qui se fixent sur les séquences «
amorces PCR» des sondes
4.
Analyse de fragments (Migration
des produits de PCR par
électrophorèse capillaire)
Eijk et al, Methods in Mol Bio, 2011
11
Exon 6
Exon 4
Exon 5
Del 4-7 IKZF1
Exon 7
Délétion d’IKZF1 (1)
Délétion d’IKZF1 (1)
Caye et al, hematologica 2013
Délétion d’IKZF1 (1)
Deletion IKZF1
IKZF1 wt
Marqueurs oncogénétique des LAL T
Trinquard et al, JCO 2013
Maladie résiduelle
Cytométrie en flux
 Recherche de marqueurs au diagnostic
 Abération phénotypique (asynchronisme ou expression aberrante)
 Maladie résiduelle
 Recherche des blastes identifiés au diagnostic
Maladie résiduelle
MRD en biologie moléculaire Ig/TCR (amorces ASO)
– Détermination des réarrangements au diagnostic
– Séquençage des allèles clonaux
– Fabrication d’amorces spécifiques de la région
jonctionnelle du clone du patient (ASO)
– Quantification par RQ-PCR (Taqman)
TdT
TdT
pre-pre-B-cell
CyCD79
pre-B-cell
immature B-cell mature B-cell
CyCD79
pre-B-CyIg
(pre-B SmIg-CD79)
Smlg-CD79
Smlg-CD79
plasma cell
Cylg
IGL genes rearranged (in Ig+ cells)
TdT
pro-B-cell
+
I IGK genes rearranged (C deleted in most Ig cells)
(CyCD79)
IgH class switch may occur
IGH genes rearranged
(TdT)
lymphoid
precursor cell
'alternative' T-lymphocyte
TCR-CD3
TdT
prothymocyte
(TdT)
(CyCD3)
mature thymocyte
TdT
TdT
immature
thymocyte
common
thymocyte
CyCD3
(pre-T complex)
CyCD3
(pre-T complex)
(TCR-CD3)
NK-cell
TCRD genes rearranged
TCRG1
(CyCD3)
TCR-CD3
helper / inducer
T-lymphocyte
TCR-CD3
(TdT)
mature thymocyte
(CyCD3)
TCR-CD3
suppressor /
cytotoxic T-lymphocyte
TCR-CD3
TCRD genes deleted (in most TCR+ cells)
TCRG2 genes rearranged
TCRB genes rearranged: D-J to V-D-J (also in many TCR+ cells)
TCRA genes rearranged (in TCR+ cells)
Dept. of Immunology, Erasmus MC, Rotterdam
Réarrangement des IGH
5
4
3
2
1
6
66
1 2 3 4
s
JH
DH
VH
27
C
1 2 3 4 5 6
DH  JH joining
VH  DH-JH joining
V
IgH
D
V
IgH
D
J
J
V
V
C
C
C
C
transcription
IgL
C
C
C
C
C
C
CD79b
precursor IGH mRNA
RNA splicing
CD79a
IgL
J
J
translation
V DJ
C
mature IGH mRNA
junctional region
Structure des gènes du TCR
TCRA and TCRD gene complex (#14q11.2)
V1 V2 V3 V4 V5
Vn
V1
J
Rec
J
functional V : 46
C
functional J : 53
V2
D J C V3
1 2 3 1 42 3
TCRB gene complex (#7q34)
V1 V2 V3 V4 V5
Vn
D1 J1
C1
1 2 34 5 6
functional V: 47
D2
J2
C2
1 23 4 56 7
TCRG gene complex (#7p14)
V 2 V 3 V 4 V 5
V 7 V 8
V 9
V 10
V 11
J 1
1 2 3
functional V: 6
C1
J 2
1 3
C 2
Détermination des réarrangements au diagnostic
Approche multiplexe (Biomed 2)
LAL B
IGH : 3 PCR
FR1:
FR2:
FR3:
VH (1-6)
VH (1-6)
VH (1-6)
JH consensus
JH consensus
JH consensus
DHJH : 2 PCR si VH-JH négatif
Ig : 2 PCR
Tube A:
Tube B:
Vf
Vkf Intron
Jk1-4 + Jk5
Kde
TCR : 1 PCR
V (1-6)+ D2
DHJH : 2 PCR
TCR : 2 PCR
Tube A : VIf-V10
Tube B : V9-V11
TCR : 1 PCR
V (1-6)+ D2
J1.1/2.3 - J1.3/2.3
J1.1/2.3 - J1.3/2.3
J (1-4) + D3
TCR : 3 PCR
TCR : 2 PCR
Tube A : VIf-V10
Tube B : V9-V11
LAL T
J1.1/2.3 - J1.3/2.3
J1.1/2.3 - J1.3/2.3
J (1-4) + D3
TCR : 3 PCR si <2 marqueurs disponibles
Van dongen et al, Leukemia 2003
Détermination des réarrangements au diagnostic
Approche multiplexe (Biomed 2)
Détermination
des
réarrangements
au
diagnostic
Exemple PCR multiples TCR
Approche multiplexe (Biomed 2)
FAM
HEX
Détermination des réarrangements au diagnostic
Approche multiplexe (Biomed 2)
TCR PCR A
Témoin neg polyclonal
Vg10Jg1.3/2.3
VgIFJg1.3/2.3
Vg10Jg1.1/2.1
Patient LAL
VgIFJg1.1/2.1
VgIFJg1.3/2.3
Séquençage
Méthode Sanger
Séquençage
Vg1F
Vg1,3/2,3
Définition de la jonction (IgBLAST, IMGT V-QUEST)
Design de l’amorce
TCR
V
J
ASO sens
sonde
reverse
Vg2-Jg1.3/2.3 (0/11/-10)
CGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCA
AGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTCTGGGGTCTATTACTGTGCCACCTGGGA
CGGGCCCCCCTAAAGAAGAAACTCTTTGGCAGTGGAACAACACTTGTTGTCACAGGTAAGTATCGGAAGAATACAACAT
TTCCAAGGTAATAGAGGGAAAGCAGGAAATTATTAAACTGGAATAATGTAATAATGTTTAGAAAAAAGAGGAATTGGAT
GGGGATTTGATGTAGAAAAC
Détermination de la MRD : Taqman
• Echantillons
– Dilution de l’ADN de diagnostic dans pool de cellules mononuclées de 10
donneurs sains
– 10-1 à 10-5
– analyse au moins en duplicate
– obtention d’une courbe standard
– ADN témoin négatif
– Détermination du bruit de fond
– MRD en triplicate
• Sensibilité
–
Plus grande dilution présentant un Ct < Ct du bruit de fond -1
• Zone de quantification
–
zone de la courbe pour laquelle la MRD peut être quantifiée de façon sûre et reproductible
Détermination de la MRD : Taqman
10-1
10-2
10-3 -4
5.10
10-4
MRD
LN
40
30
20
MRD positive 3.10-3
y = -1,4246Ln(x) + 22,94
R2 = 0,9806
10
0
1,E -05
1,E -04
1,E -03
1,E -02
1,E -01
1,E +00
Maladie résiduelle
Maladie résiduelle
MRD1 seuil à 10-4
MRD1
10-4
MRD1≥≥10-4
MRD1 <10-4
MRD1 neg
Response MRD2
or no response
Response MRD1
LAL B
genetic+/MRD+
genetic-/MRD+
Genetic+/MRDGenetic-/MRD-
Standard risk:
MLL non réarrangé et IKZF1 non délété et
MRD1 < 10-4
High Risk
MLL réarrangé ou IKZF1 délété
et/ou MRD1 < 10-4
LAL T
genetic+/MRD+
genetic+/MRDgenetic-/MRD+
genetic-/MRD-
Standard risk:
NOTCH et/ou FBXW7 muté
MRD1 < 10-4
High Risk
NOTCH et FBXW7 non muté
et/ou MRD1 < 10-4
Mais encore…
Délétion ERG
Délétion de ERG
E Clappier et al, leukemia 2014,
Plan
Leucémie aigue lymphoblastique
– Bilan initial
• Recherche des transcrits de fusions
• Deletion IKZF1 (LAL B)
• Marqueurs oncogénétiques (LAL T)
– Maladie résiduelle
– Perspectives
Lymphomes B matures
–
–
–
–
Clonalité
Lymphome folliculaire
Lymphome du Manteau
Maladie de Waldenström
Recherche de réarrangements géniques dans les lymphomes
• Les lymphomes sont caractérisés par une prolifération clonale de cellules
lymphoïdes
• La classification des lymphomes (OMS)
Recherche de clonalité
• Indications
–
–
–
–
Suspicion clinique de lymphoprolifération
Doute sur clonalité en anapath ou en CMF++
Lymphome T > Lymphome B
Atteinte cutanée
• Recherche d’un réarrangement clonal du TCR et/ou de la
chaîne lourde des Ig (IGH)
– Toute population tumorale est monoclonale mais un clone n’est
pas toujours tumoral (clone réactionnel)
• Amplification ADN par PCR, analyse sur gel de
polyacrylamide ou en électrophorèse à capillaires
Recherche de clonalité
Recherche de clonalité
IGH polyclonal (JH FAM)
IGH monoclonal (JH FAM)
Recherche de clonalité
Complémentarité des cibles
B-cell
IGH
IGK
IGH
VH-JH
V-J
+ IGK
+ DH-JH
+ Kde
MCL (~50)
100%
100%
100%
T-PLL (~35)
B-CLL (~60)
100%
100%
100%
FCL (~110)
86%
84%
MZL (~50)
87%
DLBCL (~110)
TOTAL (~380)
malignancies
T-cell
TCRB
TCRG
TCRB
malignancies
V-J
V-J
+ TCRG
100%
94%
100%
T-LGL (~30)
97%
96%
100%
100%
PTCL-U (~45)
98%
94%
100%
76%
91%
AILT (~35)
89%
92%
95%
83%
75%
91%
ALCL (~45)
74%
74%
79%*
88%
85%
97%
TOTAL (~190)
91%
89%
94%*(99%)
+ D-J
* 20% to 25 % of anaplastic large cell lymphomas do not have TCR gene rearrangements (null-ALCL)
BIOMED-2 Concerted Action: BMH4-CT98-3936
BIOMED-2 Summary; JHJM van Krieken et al., submitted
Réarrangement BCL2-JH
• Lymphome folliculaire
• CD5- CD10+/- CD44 low
• prolifération des cellules du centre germinatif
• Translocation t(14;18) dans 80% des LNH folliculaires
– Chromosome 14 : gène de la chaîne lourde des Ig
– Chromosome 18 : gène bcl2 (antiapoptotique)
Surexpression de l’oncogène Bcl2
• Lymphome B diffus à grandes cellules
• Translocation t(14;18) dans 40% des DLBCL
• Type GC
Réarrangement BCL2-JH
BIOMED
3 régions de cassure
PCR couvre 60% des réarrangements :
- MBR (major breakpoint cluster region) : 40%
- 3’MBR : 9%
- mcr/5’mcr (minor breakpoint cluster region) : 11%
Mise en évidence d’une hyperexpression de la cycline D1 par RT-PCR
compétitive
• La translocation t(11;14) entraîne une hyperexpression de la cycline D1
qui n’est normalement pas exprimée dans les lymphocytes.
• Utilisable au diagnostic quand l’infiltration tumorale est suffisante
(30% de cellules tumorales). Peu sensible.
• Technique de RT-PCR compétitive
coamplification des cyclines D1, D2 et D3
REC1
1
2
3
D1
D2
D3
Mise en évidence d’une hyperexpression de la cycline D1 par RT-PCR
compétitive
 Blood 2005 106:4315 :
6 cas de lymphomes du manteau typiques
sans hyperexpression de cycline D1 ni t(11;14)
 Blood 2008;111:5683 :
8 cas de lymphomes du manteau typiques (histologie et immunophénotypage)
sans t(11;14) :
- 2 expriment la cycline D1 selon un mécanisme indépendant de la t(11;14)
- 2 expriment la cycline D2 et ont une t(2;12)
- 3 expriment la cycline D3 et ont une t(6;14) (translocation retrouvée dans les MM ou autre
lymphomes B matures)
- 1 cas sans expression de cycline D
- 2 cas (forme blastoide) ont également une translocation t(2;14), expriment la cycline E et ont une
surexpression de MYCN
L’absence d’hyperexpression de la cycline D1 n’exclut pas un diagnostic
de lymphome du manteau
Analyse du statut mutationnel dans les LLC
Premiers travaux sur LLC : répertoire IGVH non muté
1994 : dans la moitié des cas de LLC, nombre variable de mutations somatiques
dans les gènes IGVH
1999 : mutations somatiques dans les gènes IGVH associées à une évolution très
différente de la maladie
mutées
non mutées
Hamblin et al, Blood 1999, 94:1848
Analyse du statut mutationnel dans les LLC
VH
DH
MwM
PB-MNC
tonsil
ES-6
GBN-10
FR-5
VH-FR1 primers
JH primer
100
- 1 bande/pic unique : séquençage direct
bp
400 -
300
200
100
0
100
4500
3000
1500
0
300
200
100
0
PCR FR1-JH
IGH tube A VH-FR1–JH
300
200
100
0
400
310-360 nt
200
300
400
200
300
400
200
300
400
300
400
tonsil
ES-6
VH
GBN-10
100
200 -
300
300
200
100
0
100
300 -
200
PB-MNC
100
800 700 600 500 -
JH
200
JH
FR-5
Séquençage dans les 2 sens
BIOMED-2 report: Leukemia 2003; 17: 2257-2317
Analyse des séquences
- Plusieurs bandes/pics : purification après excision des bandes du gel
VH
JH
Séquençage dans les 2 sens
PCR FR1-JH
Analyse des séquences
Excision et purification des bandes
Analyse du statut mutationnel dans les LLC
Cut-off = 98% homologie
! VH3-21 : mauvais
pronostic quelque soit le
statut mutationnel
MYD88 L265P et Maladie de Waldenström
Real-time AS-PCR
WM
MZL
MM
CLL
MGUS IgM
MGUS IgG
HD
Mais encore…
Sakata-Yanagimoto et al, Cancer Science 2014
Recherche de mutations pour une médecine personnalisée…
DLBCL ABC
Yang Cancer Cell 2012; 21:723
Le nouveau meilleur ami des biologistes moléculaires en hématologie
Séquençage haut débit NGS
Merci de votre attention!
Author
Document
Category
Uncategorized
Views
1
File Size
4 148 KB
Tags
1/--pages
Report inappropriate content