close

Enter

Log in using OpenID

Absence of the Human Retinoblastoma Gene - Blood Journal

embedDownload
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
RAPID COMMUNICATION
Absence of the Human Retinoblastoma Gene Product in the Megakaryoblastic
Crisis of Chronic Myelogenous Leukemia
By Masayuki Towatari, Koichi Adachi, Hidefumi Kato, and Hidehiko Saito
The human retinoblastoma gene (RBI product, which is
involved in the control of cell cycle and tumor suppression, is
constitutively expressed as a nuclear phosphoprotein in
normal human cells. We examined leukemic cells from 22
patients with blast crisis of chronic myelogenous leukemia
(CML) for alterations of the RB expression. Western blotting
and flow cytometry with anti-RB-protein antibodies showed
that all of five cases with megakaryoblastic crisis lacked the
expression of the RB-encoded protein, whereas none of 17
cases with the other phenotypes such as myeloblastic or
lymphoblastic crisis showed any abnormality. These findings
suggest that megakaryoblastic transformationof CML might
be lineage-specificallyassociated with loss of the RB protein.
o 1991 by The American Society of Hematology.
T
monoclonal antibodies and molecular
But the
associations between the cell lineage of the blastic cells and
the molecular events in the blastic transformation of CML
have remained unclear. We studied 22 samples of blastic
cells in CML blast crisis to evaluate whether alterations of
the RB gene product correlate with the clonal evolution of
each lineage of hematopoietic cells.
HE PRODUCT of the human retinoblastoma susceptibility (RB) gene, one of tumor-suppressor genes, has
recently been implicated in the control of cell cycle progression and normal cell g r ~ w t h . ”The
~ loss or inactivation of
RB gene function contributes to the loss of growth regulation and leads to tumor formation. The RB gene was first
identified through its association with an inherited predisposition to retinoblastomas.’ Structural abnormalities or altered expressions of the RB gene have subsequently been
reported in other types of human tumors, including small
cell lung carcinoma,6.7 breast cancer,’ bladder carcinoma:
and osteosarcoma.1oDeletions of the RB gene or decreased
expression of RB mRNA have also been observed in some
cases of lymphoma/le~kemia.”~’~
These observations suggest that RB inactivation plays a significant role in the
pathogenesis or progression of human cancers.
Chronic myelogenous leukemia (CML) is a myeloproliferative disorder that has been shown to occur at the level of
a pluripotential stem cell because of the presence of
Philadelphia chromosome in all elements of hematopoietic
cell lineages. The chronic phase of CML inevitably
progresses to an acute phase (blastic transformation) after
some period of time. CML is one of the most extensively
studied leukemias at the molecular level, and activation of
the c-ab1 proto-oncogene at the bcr-ab1 translocation is
thought to be important in the pathogenesis of the chronic
phase of CML. However, little is known about the subsequent genetic alterations or other molecular mechanisms
responsible for progression to the blastic phase. The cellular origin and the stage of differentiation of the blastic cells
at this clonal event have been investigated by using specific
From the Division of Hematology/Oncology,The First Department
of Intemal Medicine, Nagoya University School of Medicine; and
Aichi Blood Disease Research Foundation, Showa-ku, Nagoya, Japan.
Submitted July 29, 1991; accepted August 13, 1991.
Supported by Grant-in-Aidfor Scientific Researchfrom the Ministry
of Health and Welfarein Japan.
Address reprint requests to Koichi Adachi, MD, Division of Hematology/Oncology,First Department of Intemal Medicine, 65, Tsurumalcho, Showa-ku, Nagoya 466, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section I734 solely to
indicate this fact.
0 1991 by The American Society of Hematology.
0006-4971191 /7809-0044$3.00/0
2178
MATERIALS AND METHODS
Cell samples. Bone marrow aspirates or peripheral blood samples were collected, with the informed consents of 22 patients, at
the time of diagnosis in the blastic phase of CML. The diagnosis
was based on the standard clinical and hematologic criteria with
Philadelphia chromosome. The leukemic blasts were separated by
Ficoll-Conray (Pharmacia, Uppsala, Sweden) density gradient
centrifugation, frozen in the medium with 10% dimethyl sulfoxide
and 10% fetal calf serum by a programmed freezer, and cryopreserved in liquid nitrogen. All samples had greater than 70% blastic
cells by morphologic examination and good viability of more than
80% by trypan blue dye exclusion test after being thawed and
washed for use in this study.
DNA and RNA analyses. Genomic DNAs extracted from leukemic samples were completely digested with each restriction enzyme, Hind 111, BamHI, or Egl 11. Agarose gel electrophoresis,
Southern blotting, and hybridization analysis were performed
according to the standard methods.” DNA probes of the RB gene
(provided by Dr W. H. Lee, University of California at San Diego)
were p0.9R which comprises exon 1 through part of exon 9 and
p3.8R containing the rest of the 3’ exons.
RNA isolation and Northern blotting were performed as described previo~sly.’~
Radiolabeling of the 4.5-kb RB cDNA probes
and HLA-B7 probe from pDP00l plasmid for an internal control
was performed using an oligo-random-labeling technique.
Four sets of primers covering the binding regions to SV40 T
antigen were used in this reverse transcription-polymerase chain
reaction (PCR) analysis. They include primer la, 5’-CACACACTCCAGTTAGGACTGTTATGAACA-3’; primer lb, 5’-AATGTTGTCATTCAGAAGTTTGCTAAAATT-3�, primer 2a, 5’TAATGGAATCCATGCTTAAATCAGAAGAAG-3’;primer 2b,
5’-GACAAGCAGATTCAAGGTGATCAGTTGGTC-3�;
primer
3a, 5’-ACCCAGAAGCCA�ITGAAATCTACCTCTCrT-3�;
primer
’;primer
3b, 5’-AAGGTCTATATTCTTCACTTTGCATATGCATATGCC-3
4a, 5 �-AGTATGAACTCATGAGAGACAGGCATITGG-3’;and
primer 4b, 5’-GTGAGGTA~GGTGACAAGGTAGGGGGCCT3’. After 30 cycles of the reactions at 94”C, 5 3 T , and 72°C for 1,2,
and 2 minutes, respectively, in a Thermocycler (Perkin-Elmer
Cetus, Emeryville, CA), the amplified products were analyzed by
electrophoresis in agarose gels and ethidium bromide staining.
Westem blot analysis. Leukemic cells (1 X lo’) were lysed with
400 PI of lysis buffer (50 mmol/L Tris-HC1 pH 8.0, 0.25 mol/L
NaCl, 0.1% Nonidet P-40, 5 mmol/L EDTA, 1 mmol/L phenylBlood, Vol78, N o 9 (November 1). 1991: pp 2178-2181
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
ABSENCE OF RB PRODUCT IN CML MEGAKARYOBLASTIC CRISIS
2179
methanesulfonyl fluoride, and 50 p,g/mL aprotinin). The cell
lysates were clarified by centrifugation at 15.000 rpm for 10 minutes
at 4В°C. The total concentration of protein was determined using a
commercial kit (Bio-Rad, Richmond, CA). and 50 p,g of protein
from each sample was analyzed in 7.5% sodium dodecyl sulfatepolyacrylamide gel. and then the gels were transferred to nitrocellulose membranes. The gels were stained with Coomassie blue to
identify protein integrity in each sample. After overnight blocking
in phosphate-buffered saline (PBS) containing 0.1% Tween 20, 5%
dried milk, and 0.1% sodium azide, the blots were incubated with a
mouse monoclonal anti-RB-protein antibody, PMG3-245
(PharMingen, San Diego, CA) or a rabbit polyclonal antibody
Rb(Ab-3) (Oncogene Science, Manhasset, N Y ) at the final concentration of 10 &mL. They were washed and incubated with
biotinylated secondary immune reagents (rabbit antimouse IgG or
donkey antirabbit IgG, respectively) and then reacted with streptavidin-alkaline phosphatase complex (Amersham, Buckinghamshire, UK). After washing thoroughly, nitro-blue tetrazolium and
5-bromo-4-chloro-3-indolyl
phosphate were added to visualize the
specific bands.
Flow cyromerric ana!vsi.s. The cells ( 1 x 10")were fixed with 4%
paraformaldehyde in PBS for 20 minutes. After centrifugation,
they were resuspended in 0.1% Triton X-100 (Sigma, St Louis,
MO) in PBS containing 0.1% bovine serum albumin for 5 minutes.
The fixed cells were incubated with a monoclonal PMG3-245
antibody (10 p,g/mL) or nonspecific mouse IgG monoclonal
antibody (MoAb) as a negative control. Binding of these antibodies
was detected with fluorescein isothiocyanate conjugated goat antimouse IgG F(ab'), (Cappel Laboratories, West Chester, PA).
After washes, the percentage of fluorescence-positive cells was
A
.
1
2
3
counted by flow cytometry using EPICS profile analyzer (Coulter
Corp, Hialeah, FL).
RESULTS
We examined 20 leukemia samples in CML blast crisis
that we had previously reported on the cell lineage'" and
another two cases with the megakaryoblastic crisis. The
phenotypic classification of surface antigens with a panel of
lineage-spccific MoAbs showed that five cases expressed
the megakaryocytic marker, platelet glycoprotein IIb-IIIa.
The others were eight cases expressing myeloid differentiation antigens, six cases in lymphoblastic crisis with pre-B
cell markers, and the remaining three cases showing no
surface marker characteristic of any cellular lineage."
Among these 22 samples, all of five samples from megakaryoblastic crisis were found to lack the 1 10-Kd RB protein by
Western blotting with a monoclonal anti-RB-protein antibody, PMG 3-245, but none of 17 samples from the other
phenotypes showed any abnormality (Fig IA). Western
blotting using a polyclonal anti-RB protein antibody, Rb(Ab3), also presented the same result, indicating that RB
proteins were lineage-specifically absent in all megakaryoblastic transformations of CML (data not shown). To
exclude the possibility of RB protein degradation in the
process of protein extraction, we mixed megakaryoblastic
cells and RB-positive myeloid cells in the half and half
ratio, then extracted the mixed protein, and confirmed that
4
5
7
8
- -.9
. ...
-*-
B
200
Fig 1. Western blot analysis showing loss of the RE protein in the
megakaryoblastic crisis of CML. (A) Myeloblastic samples (lanes 1
through 3) and lymphoblastic samples (lanes 9 through 11) show the
bands of the 110-Kd RB protein, but all samples from five patients with
megakaryoblastic crisis (lanes 4 through 8) lack the expression of the
RE gene product. (B) Lanes 1 through 3 of Coomassie blue-stained gel,
which present the integrity of total protein, correspond to lanes 4
through 6 of the Western blot, respectively. Lane 4 is from RB-positive
myeloblastic cells and lane 6 is from megakaryoblastic cells. Lane 5
shows the reduced RE protein extracted from the mixed sample of
myeloblastic cells and megakaryoblastic cells in the half and half ratio.
6
97
68
43
=
-
10
-
11
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
2180
TOWATARI ET AL
Table 1. Characterization of Five Patients in the Megakaryoblastic Crisis of CML
RE Protein
Surface Antigen’
(GPllblllla)
Patient
Positive
Positive
Positive
Positive
Positive
1
Western Blotting
Flow Cytornetryt
RE Transcript
RB Gene Alteration
Undetectable
Undetectable
Undetectable
Undetectable
Undetectable
3.9
3.9
3.8
0.9
2.5
Normal
Normal
Normal
Normal
Normal
None detected
None detected
None detected
NE*
NE
�Positive percent reactivity: > 40%.
tThe percentage of positive cells.
*NE, not examined.
there was decreased but detectable RB protein (Fig 1B). By
India ink staining of blotted membranes, we also demonstrated that the pattern of other proteins than R B protein
in megakaryoblastic samples was the same as that in the
other phenotypic cells of CML blast crisis (data not shown).
Compatible with the findings of Western blot analysis, flow
cytometry with indirect immunofluorescence staining
showed that only 0.9% to 3.9% of blastic cells in the cases of
megakaryoblastic crisis reacted with the anti-RB-protein
antibody in contrast to 48% to 6S% of blastic cells in
myeloid or lymphoid crisis (Table 1).
To examine the mechanism of the loss of R B gcnc
product, we analyzed genomic DNA configuration and
mRNA expression of the R B gene in each sample. Southern blot analysis of restriction fragments showed the normal
R B gene structure without any gross deletion or rearrangement (data not shown). By Northern blotting using the
full-length R B cDNA probe, no distinct abnormal size of
R B transcript (4.7 kb) was identified in any sample of 22
cases. No decreased expression of the R B gene was also
observed in comparison with HLA-B7 genc expression as
an internal control for mRNA quantity (Fig 2). It has
recently been reported that an aberrant R B protcin mutating in the binding region to adcnovirus-cncoded E I A
proteins is unstablc’ and that the rcgions of R B protein for
1
2
3
4
5
6
binding to E l A or SV40 large T antigen are common sites
for mutations.”’” Therefore, we used thc method of the
cDNA synthesis-PCR to detect smaller alterations of RB
mRNA, but each sample of megakaryoblastic crisis showed
the normal amplified R B fragments for all four segments
covering the binding regions to E I A and SV40 large T
antigen (data not shown).
DISCUSSION
One of the simplest and most sensitive methods for
detccting alterations of the R B gene expression is analysis
o f the R B protein by using an immunoblotting assay with
anti-RB-protein antibodies. We found that no R B protein
in leukemic cells from patients with CML mcgakaryoblastic
crisis was dctccted by both Western blotting and flow
cytomctry despite intact R B genes and transcripts analyzed
by Southern and Northern blotting. Some possible explanations can account for it: (1) A point mutation or a very small
deletion at the 5�early portion of R B gene resulted in a new
stop codon, a nonsense codon, or a frame shift by which
detectable R B protein could not be produced. (2) Rapid
protcin degradation or antigenic modulation of the RB
gene product occurred just after translation by some
genetic altcration or protein interaction in relation to
megakaryoblastic transformation.
7 8 9 10 11
)
o
m
Fig 2. Northern blot analysis of leukemic samples
from CML blast crisis. Ten micrograms of total RNA
isolated from myeloblastic cells (lanes 1 through 3).
megakaryoblastic cells (lanes 4 through E), and lymphoblastic cells (lanes 9 through 11) of CML blast
crisis were electrophoresed, transferred t o nylon
membranes, and hybridized with the ”P-labeled probe
of the 4.5-kb RB cDNA (top panel). The same membranes were rehybridized as a control with the probe
of HLA-B7 gene from pDPOOl plasmid (bottom panel).
The number of each lane corresponds t o the same
lane number of the Western blot in Fig 1A.
~
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
2181
ABSENCE OF RB PRODUCT IN CML MEGAKARYOBLASTIC CRISIS
Recently, a group of investigators reported that no RB
protein was detected by immunoprecipitation analysis in six
small cell carcinoma cell lines, although normal RB transcripts were observed.’ In their subsequent report of the RB
gene in the same cell lines,22 single base pair deletion
resulting in a novel stop codon appeared within exon 20 or
exon 23 in two cell lines. They speculated that structurally
altered RB protein is less stable than normal RB protein.
Further studies are also required at the sequence level to
search for a possible aberration of the RB gene in the
megakaryoblastic crisis.
In any event, it is an interesting phenomenon that the RB
protein is not detected only in megakaryoblastic transformation, in the fashion of all or none, for each cell lineage of
CML blast crisis. These findings suggest that the clonal
evolution of megakaryocytic lineage in CML blast crisis
might be lineage-specificallyassociated with the absence of
the RB gene product.
ACKNOWLEDGMENT
We thank Dr Tohru Marunouchi for critical reading of the
manuscript, Drs Makoto Sawada and Isamu Sugiura for technical
advice on Western blotting, Makoto Kondo for chromosome
analysis, and Sayoko Sugiura for excellent technical assistance.
REFERENCES
1. DeCaprio JA, Ludlow JW, Lynch D, Furukawa Y, Griffin J,
Piwnica-Worms H, Huang CM, Livingston DM: The product of the
retinoblastoma susceptibility gene has properties of a cell cycle
regulatory element. Cell 58:1085,1989
2. Buchkovich K, D u e LA, Harlow E: The retinoblastoma
protein is phosphorylated during specific phase of the cell cycle.
Cell 58:1097, 1989
3. Chen PL, Scully P, Shew JY, Wang JYJ, Lee WH: Phosphorylation of the retinoblastoma gene product is modulated during the
cell cycle and cellular differentiation. Cell 58:1193,1989
4. Mihara K, Cao XR, Yen A, Chandler S, Driscoll B, Murphree
AL, T’Ang A, Fung YKT Cell cycle-dependent regulation of
phosphorylation of the human retinoblastoma gene product. Science 246:1300,1989
5. Friend SH, Bernard R, Rogelj S, Weinberg RA, Rappaport
JM, Albert DM, Dryja TP: A human DNA segment with properties
of the gene that predisposes to retinoblastoma and osteosarcoma.
Nature 323:643, 1986
6. Harbour JW, Lai SL, Whang-Peng J, Gazdar AF, Minna JD,
Kaye FJ: Abnormalities in structure and expression of the human
retinoblastoma gene in SCLC. Science 241:353,1988
7. Yokota J, Akiyama T, Fung YKT, Benedict WF, Namba Y,
Hanaoka M, Wada M, Terasaki T, Shimosato Y, Sugimua T,
Terada M: Altered expression of the retinoblastoma (RB) gene in
small-cell carcinoma of the lung. Oncogene 3:471,1988
8. Lee EYHP, To H, Shew JY, Bookstein R, Scully P, Lee WH:
Inactivation of the retinoblastoma susceptibility gene in human
breast cancers. Science 241:218,1988
9. Horowitz JM, Yandell DW, Park SH, Canning S, Whyte P,
Buchkovich K, Harlow E, Weinberg RA, Dryja TP: Point mutational inactivation of the retinoblastoma antioncogene. Science
243:937,1989
10. Friend SH, Horowitz JM, Gerber MR, Wang XF, Bogenmann E, Li FP, Weinberg RA: Deletions of a DNA sequence in
retinoblastomas and mesenchymal tumors: Organization of the
sequence and its encoded protein. Proc Natl Acad Sci USA
84:9059,1987
11. Cheng J, Scully P, Shew JY,Lee WH, Vila V, Haas M:
Homozygous deletion of the retinoblastoma gene in an acute
lymphoblastic leukemia (T) cell line. Blood 75730, 1990
12. Chen YC, Chen PJ, Yeh SH, Tien HF, Wang CH, Tang JL,
Hong R L Deletion of the human retinoblastoma gene in primary
leukemias. Blood 76:2060, 1990
13. Ginsberg AM, Raffeld M, Cossman J: Inactivation of the
retinoblastoma gene in human lymphoid neoplasms. Blood 77:833,
1991
14. Furukawa Y, Ishida Y, Belvin M, DeCaprio JA, Griffin JD:
Abnormalities in expression of the product of the retinoblastoma
susceptibility gene in primary human leukemias. Blood 76:272a,
1990 (abstr)
15. Janossy G, Greaves MF, Revesz T, Lister TA, Roberts M,
Durrant J, Kirk B, Catovsly D, Bread MEJ: Blast crisis of chronic
myeloid leukaemia (CML): I1 Cell surface marker analysis of
�lymphoid’and myeloid cases. Br J Haematol34:179,1976
16. Griffin JD, Todd RF 111, Ritz J, Nadler LM, Canellos GP,
Rosenthal D, Gallivan M, Beveridge RP, Weinstein H, Karp D,
Schlossman SF: Differentiation patterns in the blastic phase of
chronic myeloid leukemia. Blood 61:85,1983
17. Bakhshi A, Minowada J, Arnold A, Cossman J, Jensen JP,
Whang-Peng J, Waldmann TA, Korsmeyer SJ: Lymphoid blast
crisis of chronic myelogenous leukemia represent stages in the
development of B-cell precursors. N Engl J Med 309:826,1983
18. Adachi K, Okumura M, Tanimoto M, Morishima Y, Ohno
R, Saito H: Analysis of immunophenotype, genotype, and lineage
fidelity in blastic transformation of chronic myelogenous leukemia:
A study of 20 cases. J Lab Clin Med 111:125,1988
19. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning, in:
A Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold
Spring Harbor Laboratory, 1988
20. Hu Q, Dyson N, Harlow E: The regions of the retinoblastoma protein needed for binding to adenovirus E1A or SV40 large
T antigen are common sites for mutations. EMBO J 9:1147, 1990
21. Huang S, Wang NP, Tseng BY, Lee WH, Lee EHHP: Two
distinct and frequently mutated regions of retinoblastoma protein
are required for binding to SV40 T antigen. EMBO J 9:1815, 1990
22. Mori N, Yokota J, Akiyama T, Sameshima Y, Okamoto A,
Mizoguchi H, Toyoshima K, Sugimura T, Terada M: Variable
mutations of the RB gene in small-cell lung carcinoma. Oncogene
51713, 1990
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
1991 78: 2178-2181
Absence of the human retinoblastoma gene product in the
megakaryoblastic crisis of chronic myelogenous leukemia
M Towatari, K Adachi, H Kato and H Saito
Updated information and services can be found at:
http://www.bloodjournal.org/content/78/9/2178.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
Document
Category
Uncategorized
Views
333
File Size
1 930 KB
Tags
1/--pages
Report inappropriate content