close

Enter

Log in using OpenID

Bartter et Gitelman jouent aux diurétiques

embedDownload
Bartter et Gitelman jouent aux
diurétiques
Rosa Vargas-Poussou
Département de Génétique
Hôpital Européen Georges Pompidou
Paris
Syndromes de Bartter et Gitelman
Tubulopathies héréditaires rares
Transmission autosomique récessive
Prévalence
Syndrome de Gitelman: 1/40.000
Syndrome de Bartter: 1/1.000.000
Défaut de réabsorption de sodium dans le
néphron distal
Syndromes de Bartter et Gitelman
Caractéristiques cliniques communes
Activation secondaire du système rénine angiotensine - aldostérone
Alcalose métabolique
Hypokaliémie d’origine rénale
Pression artérielle normale ou basse
Tubule Rénal - Réabsorption
Tube Proximal
Na+ 60%
Ca+2 60%
Branche large ascendante
de l’anse d’Henle
Mg+2 70%
Na+ 20-25%
Ca+2 25-30%
Tube contourné distal
Na+ 7%
Ca+2 et Mg+2 10%
Tube collecteur
Na+ 2%
H2O
Sécrétion
H+ et K +
Tube proximal
Tube collecteur
Acétazolamide
H+
HCO3-
Na+
H+
ACIV
ACII
H+
H2O
CO2
Glucose
Phosphate
Acides aminés
Na+
3HCO3-
HCO3-
Pendrine
Na+
Glutamine
Na+
NH4+
NH4+
NH3
H+
NH3
Na+
K+
HCO3-
Glutamate
Cl-
cetoglutarate
Glucose
NH4+
HCO3-
H2O
CO2
Furosémide
K+
H+
Ca++
Mg++
NH4+
(+)
K+
ClCl-
H+
HCO3-
Intercalaire
B
Na +
HCO3-
NDCBE
K+
Na+
K+
Cl -
H+
Cl K+
Na+
Na+
HCO3Cl-
Acétazolamide
Barttine
HCO3
H+
H+
Branche large – Anse d’Henle
2Cl Na+
K+
Na +
Cl-
Intercalaire
A
ACII
K+
Na +
K+
CO2
HCO3-
H2O
(-)
(+)
ENaC
Amiloride
Claudines
Na +
Na +
K+
(-)
Principale
Vte
Aldostérone
K+
Cl-
Cl Na+
Thiazides
Na+
K+
Ca2+
Mg2+
Na+
H+
Na+
Na+
Na+
Ca2+
H2O
RM
Ca2+
Mg2+
Tube contourné distal
Spironolactone
Eplérenone
H2O
Syndromes de Bartter et Gitelman
Na+ 7%
Cl Na+
Thiazides
Na+
Na+
Mg2+
K+
Na+
Ca2+
Mg2+
H+
ClNa+
Ca2+
Ca2+
Na+
Na+
20%
2Cl Na+
K+
Furosemide
K+
K+
Ca++
Mg++
NH4+
(+)
H+
Na+
Na+
Vte
Na+
K+
Cl Barttin
Cl K+
Adolescent
Adulte
Hypomagnésémie
Hypocalciurie
Nourrisson - enfant
Normo ou
hypercalciurie
Polyurie
Retard de
croissance
Gitelman
Bartter
classique
Hydramnios
Polyurie sévère Bartter Antenatal
Retard de
(-) croissance
Hypercalciurie
Néphrocalcinose
 PG
Parfois surdité
HCO3-
Syndromes de Bartter et Gitelman
Na+ 7%
Cl Na+
Thiazides
ClK+
Na+
Na+
Ca2+
Ca2+
Mg2+
Na+
H+
Na+
20%
Bartter type I
(anténatal)
2Cl Na+
K+
Furosémide
Bartter type II
(anténatal)
Na+
Ca2+
Na+
Mg2+
K+
K+
Ca++
Mg++
NH4+
(+)
H+
Na+
Gitelman
Na+
K+
Cl Barttin
Cl K+
Bartter type IV
(anténatal+surdité)
HCO3-
Na+
Bartter
(-)
Vte
Bartter type III
(classique)
Na+ 7%
2Cl Na+
K+
Furosémide
K+
HCO3-
Cl K+
Na+
Na+
Ca++
Mg++
NH4+
HCO3-
Barttine
K+
H+
Pendrine
Na+
K+
Cl -
Cl-
HCO3-
K+
ClCl-
H+
HCO3-
Na+
2%
(-)
NDCBE
HCO3
H+
H+
Vte
HCO3Cl-
Intercalaire
A
ACII
Hypercalciurie
Polyurie
H+
K+
Na +
K+
CO2
H2O
(-)
Na+
K+
Ca2+
Mg2+
Na+
H+
Na+
Na+
Na+
(+)
ENaC
Cl-
Cl Na+
Thiazides
Intercalaire
B
Na +
Na+
20%
Claudines
(+)
Na +
Cl-
Amiloride
Na +
Na +
K+
Ca2+
Ca2+
Mg2+
Alcalose
Hypokaliémie
Principale
Aldostérone
K+
H2O
RM
Spironolactone
Eplérenone
H2O
Na+ 7%
2Cl Na+
K+
Furosémide
K+
HCO3-
Cl K+
Na+
Na+
Ca++
Mg++
NH4+
HCO3-
Barttine
K+
H+
Pendrine
Na+
K+
Cl -
Cl-
HCO3-
K+
ClCl-
H+
HCO3-
Na+
2%
(-)
NDCBE
HCO3
H+
H+
Vte
HCO3Cl-
Intercalaire
A
ACII
Normo ou hypercalciurie
Polyurie
H+
K+
Na +
K+
CO2
H2O
(-)
Na+
K+
Ca2+
Mg2+
Na+
H+
Na+
Na+
Na+
(+)
ENaC
Cl-
Cl Na+
Thiazides
Intercalaire
B
Na +
Na+
20%
Claudines
(+)
Na +
Cl-
Amiloride
Na +
Na +
K+
Ca2+
Ca2+
Mg2+
Alcalose
Hypokaliémie
Principale
Aldostérone
K+
H2O
RM
Spironolactone
Eplérenone
H2O
Na+ 7%
2Cl Na+
K+
Furosémide
K+
HCO3-
Cl K+
Na+
Na+
Ca++
Mg++
NH4+
HCO3-
Barttine
K+
H+
Pendrine
Na+
K+
Cl -
Cl-
HCO3-
K+
ClCl-
H+
HCO3-
Intercalaire
B
Na +
Na+
20%
Claudines
Na+
2%
(-)
(+)
Na +
Cl-
NDCBE
HCO3
H+
H+
Vte
HCO3Cl-
Intercalaire
A
ACII
H+
K+
Na +
K+
CO2
H2O
(-)
Cl Na+
Thiazides
Na+
K+
Ca2+
Mg2+
Na+
H+
Na+
Na+
Na+
(+)
ENaC
Cl-
Amiloride
Na +
Na +
K+
Ca2+
Ca2+
Mg2+
Alcalose
Hypokaliémie
Principale
Aldostérone
K+
H2O
RM
Hypomagnésémi
e Hypocalciurie
Spironolactone
Eplérenone
H2O
Syndrome de Gitelman - Population
 Janvier 2001 à août 2009
 448 patients avec diagnostic clinique de SG (219 H et 229
F)
 Réseau Français de Tubulopathies et Eunefron
 Critères
–
–
–
–
–
–
Hypokaliémie d’origine rénale
Alcalose métabolique
Fuite sodée
Activation secondaire du système RAA
Hypomagnésémie
Hypocalciurie
SLC12A3 – Séquençage
MUTATIONS
172 différentes (100 nouvelles)
6%
2%
14%
15%
70%
(n=315)
63%
Missense (n=110)
Frameshift (n=26)
Splicing (n=24)
Nonsense (n=11)
Inframe (n=4)
52 patients sans mutations
 Analyse du gène CLCNKB chez 49 patients: détection
d’anomalies moléculaires chez 14
 38 patients sans anomalies moléculaires (8.4%)
MLPA (Multiplex Ligation-dependant Probe
QMPSF
Amplification)
Quantitative Multiplex PCR Short
Fluorescent Fragments
6-FAM Forward primer
5’
Exon
3’
« queue » M13
Reverse primer
Salsa® MLPA® kit P136 SLC12A3
Gitelman Syndrome MRC Holland
38 sondes: 25/26 exons du gène SLC12A3
(excepte exon 6) and 13 contrôl
Rapport
< 0.7 délétion
0.7 - 1.3 Normal
1.3 – 2 duplication
Résultats MLPA
11 grands réarrangements hétérozygotes chez 24/51
patients du groupe avec une seule mutation hétérozygote
– Délétion d’un exon chez
13 patients:
•
•
•
•
E9del, 1 patient
E14del, 2 patients
E18del, 1 patient
E26del, 9 patients
– Délétions ou duplications de 2
ou plus exons chez 11 patients
•
•
•
•
•
•
•
E1_E7del, 2 patients
E2_E3del, 2 patients
E4_E6del,
E4_E5del, 3 patients
E19_E23del, 1 patient
E24_E25del, 1 patient
E1_E3dup, 1 patient
E1_E4dup, 1 patient
1
2
3

4 5 6
7 8
9 10 11 12
13
(3342 bp)

14

19
20 21
22
23
24
25
AluSx
26

(1183 bp)
L2b_LINE
AluJb
L2a_LINE
15 16 17 18

(2720 bp)

MER115
AluY
AluSx
AluSx
AluSx
AluSx
Grands réarrangements – Gène SLC12A3
(10711bp)

(1355 bp)
(2416bp)
(1508 bp)
AluSx
AluSx

AluY
MER115

Intron 1
5’
CTACTTGCTTATCACCGTGGCTCTGTGAGGACTGGGGACACAATCTG
 patient
CTACTTGCTTATCACCGTGGCTCTGAAGGCAGTAAAGTGGGGTGATG
GCTGTTGGGACTGTGGAGGGCTCTGAAGGCAGTAAAGTGGGGTGATG
3’

Intron 13
Intron 3

Intron 14
5’
TAAAGAGGCTTGAGGAAGACTTTTTCTTTCTTTTTTTTTTTT
patient
TAAAGAGGCTTGAGGAAGACCCTGAGTGAGCTTCCAGGGCCT
3’
GAATCCCCTGTCCGAAGGACCCTGAGTGAGCTTCCAGGGCCT
5’
GGGTAGGGCTTGTCCCAGGTGAAGCTTTGTGGATGGAACTTCCAAGTGTGACATAGCTGTTTAGTATCCCAGTTACCCTTCTCAGAGGAG
patient
GGGTAGGGCTTGTCCCAGGTGAAGCTTTTTAGTAGAGATGGGGTTTAGTAGAGATTTTTAGTAGAGATGGGGTTTCACCATGTTGACCAG
3’
CTCCCGAATAGCTGGGATTACAGGCACCTGCCATCACACGAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGACCAG
Deletions 1-3 et 5: points de cassure dans Alu(s) avec homologie > 80%  Non-allelic homologous recombination (NAHR)
Deletions 4 et 6: points de cassure dans LCRs non homologues  Non-homologous end-joining (NHEJ)
Deletion 7: E26del: point de cassure en 5’ proche d’un AluJb et point de cassure en 3’ dans un AluSx  Mécanisme complexe
Séquençage + Recherche de grands
réarrangements
6% 2% 6%
13%
14%
Taux de détection de mutations de 91%
59%
Missense (n=110)
Frameshift (n=26)
Splicing (n=24)
Nonsens (n=11)
Inframe (n=4)
Grands réarrangements(n=11)
Vargas-Poussou R, JASN 2011
SLC12A3 - Mutations ponctuelles
Fréquence et distribution - 172 mutations - 711 allèles
Kunchaparty, S, et al. Am J Physiol, 1999.
De Jong, JC, et al. J Am Soc Nephrol, 2002.
Cotransporteur Na+-Cl



 



 
 

 



 








 

  


*
* **
 
  

 

 
 



 






 



 

 

   
 


 



   


*Thr46, Thr55, and Thr60
4

 



  
 
 
  





      

  








3
TGN
Golgi
ERGIC
2
RE
Ubiquitineprotéasome
1
Séquençage + Recherche de grands
réarrangements
Janvier 2001 à août 2012
662 cas index
12%
6%2% 7%
3%
13%
14%
55%
14%
58%
16%
Hétérozygotes composites (n = 360)
Homozygotes (n = 105)
Une mutation hétérozygote (n = 94)
Pas de mutation (n = 81)
CLCNKB (n=22)
Taux de détection de mutations de 88%
Missense (n=130)
Frameshift (n=31)
Splicing (n=28)
Nonsens (n=13)
Inframe (n=4)
Grands réarrangements(n=16)
Base de données - Syndrome Gitelman
Janvier 2012
• 375 patients : 189 M et
186 F
• 3 Centres
9.5%
– Paris : 314
– Brussels: 32 patients
– Nijmegen: 29 patients
• Mutations
– SLC12A3: 363
– CLCNKB: 12
16%
7%
n= 348
Med IQR: 25 (14-38)
Symptoms at diagnosis
25
20
15
%
10
5
0
Fortuitous
cramps
Asthenia
Failure to Thrive
Polyuria
Tetany
Arrhytmia
Malaise
Chondrocalcinosis
Vomiting
Paresia and paresthesia
Hypotonia
Abdominal pain
Enuresis
constipation
Donnés biologiques au diagnostic
n= 250 Med IQR: 138.8 (137-140)
n= 280 Med IQR 2.37 (2.25-2.47)
n= 41
Med IQR 286 (240-329)
Donnés biologiques au diagnostic
39%
22 %
n= 322 Med IQR: 0.62 (0.52-0.68)
n= 151 Med IQR 0.08 (0.03-0.18)
Syndrome de Bartter de type III
Na+
2Cl K+
K+
Na+
K+
Cl -
Na+
K+
Ca2+
Mg2+
Na+
Na+
H+
Cl -
Na+
(+)
Mg++
NH4+
Ca2+
Ca2+
Mg2+
Tube contourné distal
RSCa
Na+
Ca++
Na+
Na+
K+
K+
H+
Cl-
Cl Na+
Thiazides
HCO3-
Pendrine
HCO3HCO3-
Claudins 16 - 19
(-)
Cl-
Cl-
Na +
K+
ClCl-
HCO3Na +
NDCBE
TC – C. Intercalaires B
SB Anténatal
 SB Classique  S de Gitelman
Alcalose Hypochlorémique
++++
H+
CLCNKA-CLCNKB – 1p36
Bartter type 3
Missense
12%
N=91
8%
Nonsense
Homozygous
Compound htz
1 htz mutation
n=43
n=34
n=14
Splicing
10%
55%
15%
Frameshift
Large
rearrangements
N
Homozygous whole gene
deletion
Antenatal
Bartter
23
11 (45%)
Classic Bartter
47
8 (17%)
Gitelman
24
2 (8.3%)
Expression fonctionnelle de mutations du gène
CLCNKB
Keck M et al. Human Mutation, 2013
Andrini O et al. Pflugers Arch. 2013
n=94
17.5 ans IQR(8-36)
n=35
1an IQR(0.4-3)
p<0.0001
SLC12A3
Pédiatrie
SLC12A3
Adultes
CLCNKB
Fortuite
58%
40%
3%
Retard de
croissance
18%
5%
60%
Faiblesse
musculaire
9%
5%
9.6%
Asthénie
9%
32.5%
Tétanie
9%
7.5%
DF
7%
5%
Crampes
2%
10%
Malaise
10%
Troubles du
rythme
5%
Chondrocalcinose
7.5%
7%
Polyuropolydipsie
20%
Déshydratation
10%
Vomissements
13%
Constipation
7%
p<0.0001
p=0.037
n=85, Med. IQR
30 (28-32)
n=25, Med. IQR
32.9 (28.5-36)
n=61, Med. IQR
97 (94.5-99)
n=25, Med. IQR
89 (80-96.5)
p<0.0001
p<0.0001
n=89, Med. IQR
0.59 (0.51-0.68)
n=26, Med. IQR
0.87 (0.77-0.96)
n=81, Med. IQR
0.05 (0.03-0.11)
n=21, Med. IQR
0.62 (0.23-1.14)
Bartter anténatal
Syndrome de Bartter anténatal - Type I
Na+ 2Cl
K+
Furosemide
K+
Na+
K+
Cl Barttine
Cl K+
K+
H+
(+)
Réabsorption:
Na+ 20%
Ca2+ 20 %
Mg2+ 60-70%
Ca++
Mg++
NH4+
Na+
RSCa
Na+
Claudines 16 et 19
HCO3-
Vte
(-)
Gène SLC12A1 – 15q15-21 (NKCC2)
18%
**
54%
10%
*
5%
13%
Na-K 2-Cl : 1.099 aa. Gène: 26 exons
N = 30 : 16 homozygotes, 10 hétérozygotes comp., 4 une mutation hétérozygote
Missense
Splicing
Nonsense
Frameshift
Inframe
Syndrome de Bartter anténatal - Type II
Na+ 2Cl
K+
Furosemide
K+
Na+
K+
Cl Barttine
Cl K+
K+
H+
(+)
Réabsorption:
Na+ 20%
Ca2+ 20 %
Mg2+ 60-70%
Ca++
Mg++
NH4+
Na+
RSCa
Na+
Claudines 16 et 19
HCO3-
(-)
Hyperkaliémie transitoire
Gène KCNJ1 – 11q24-25 (ROMK)
Evolution Ionogramme – Bartter de type II
160
140
120
Na
Cl
100
80
60
0
2
4
6
8
10
12
14
16
18
20
22
24
30
27,5
25
22,5
20
17,5
K
RA
15
12,5
10
7,5
5
2,5
0
0
2
4
6
8
10
12
14
Jours
16
18
20
22
24
21%
Faux sens
Non sens
Frameshift
7%
72%
Canal K Kir 1.1. : 391 aa. Gène: 5 exons
N = 34 : 15 homozygotes, 17 hétérozygotes composites, 2 une seule mutation htz.
Syndrome de Bartter anténatal avec surdité
Na+ 2Cl
K+
Furosemide
K+
Na+
K+
Cl Barttine
Cl K+
K+
H+
(+)
Réabsorption:
Na+ 20%
Ca2+ 20 %
Mg2+ 60-70%
Ca++
Mg++
NH4+
Na+
RSCa
HCO3-
Na+
Claudines 16 et 19
(-)
Type IV - Gène BSND – 1p31
Syndrome de Bartter anténatale avec surdité - Type IV
BSND – 1p31
N =12
9 homozygotes
3 hétérozygotes
composites.
CLCNKA-CLCNKB – 1p36
Hérédité Digénique
Bartter IVb
Barttin. : 320 aa.
Bartter IVa
Rickheit G et al EMBO 2008
Syndrome de Bartter anténatal
Brochard, K. et al. Nephrol. Dial. Transplant. 2009 24:1455-64
Syndrome de Bartter anténatal
KCNJ1
SLC12A1
CLCNKB
BSND
Nombre
23
17
6
6
Médiane
25
26
28
22
KCNJ1
SLC12A1
CLCNKB
BSND
Nombre
31
28
16
7
Médiane
32
32
37
31,8
* p = 0,021 ** p = 0,002 *** p = 0,001
Syndrome de Bartter anténatal
KCNJ1
SLC12A1
CLCNKB
BSND
Nombre
32
18
10
7
Médiane
1321,5
131
131
121
KCNJ1
SLC12A1
CLCNKB
BSND
Nombre
28
21
14
9
Médiane
5
3
2.6
2.4
* p = 0,002 ** p = 0,0001 *** p = 0,0006
Syndrome de Bartter anténatal
KCNJ1
SLC12A1
CLCNKB
BSND
Nombre
18
15
9
7
Médiane
26.5
28
39
27
* p = 0,01 ** p = 0,002***p=0,003
KCNJ1
SLC12A1
CLCNKB
BSND
Nombre
17
10
7
6
Médiane
92
89
76
83
* p = 0,01
Syndrome de Bartter anténatal
Conclusion
Main biological and clinical characteristics and genetic classification
Parameter
Antenatal Bartt e r
Classic Bartte r
Type I
Type II
Type IV
Age of presentation
In utero
In utero
In utero
In utero
Polyhydramnios/
Prematurity
Failure to thrive
Deafness
Polyur i a
Tetany crisis
Magnesemia
+++
+++
+++
+++
+++
Normal
+++
+++
Normal
-
Transient
Hyperkalemia
Hypochloremic
alkalosi s
Calciur i a
Nephrocalcinosis
Urinary
prostaglandins
Indomethacin
response
Gitelman
Type III
Adolescent/adult
/children
++
Infant- toddler,
preschool or school
children
-
+++
Yes
+++
Normal
+++
+++
Normal
++
++
Occasional
Normal or low
+++
-
-
-
+
Commo n
Low (sometimes
normal)
-
++
++
+++
High +++
High +++
+++
High +++
+++
High +++
Normal or
High +
++
High +++
+++
+++
+++
-
++
++++
Normal or High +
Low or normal
High +++
+/Normal or High +
Normal
+++
++
+
EAST :
Epilepsy, Ataxia,
Sensorineural Deafness,
Tubulopathy
Bockenhauer D et al. New Engl J Med 360, 2009
SeSAME: Seizures, sensorineural
deafness, ataxia, mental
retardation, and electrolyte imbalance
Scholl UI et al. PNAS 106, 2009
Tubule distal
Cl Na+
Thiazides
TRPV5
TRPM6
Na+
K+
Ca2+
K+
Mg2+
Ca2+
K+
H+
Réabsorption:
Na+ 7%
Ca2+ 10- 15%
Mg2+ 10%
Cl-
Na+
Na+
Ca2+
Na+
Mg2+
Syndrome EAST ou SeSAME
Gène KCNJ10, 1q23.2
Bartter type I - Furosémide
2Cl Na+
K+
Furosémide
K+
(+)
HCO3-
Cl K+
Na+
Na+
Ca++
Mg++
NH4+
HCO3-
Barttine
K+
H+
Pendrine
Na+
K+
Cl -
Cl-
HCO3-
Na +
Cl-
K+
ClCl-
H+
HCO3-
Intercalaire
B
Na +
NDCBE
Claudines
(-)
HCO3
H+
H+
Vte
HCO3Cl-
Intercalaire
A
ACII
Bartter type IV –Furosémide/Thiazide
H+
K+
Na +
K+
CO2
Bartter type II – Furosémide/Amiloride
H2O
(-)
(+)
ENaC
Bartter type III – Thiazide/Furosémide
Amiloride
Na +
Na +
K+
Principale
Aldostérone
K+
K+
Na+
Ca2+
Na+
Mg2+
H+
Seyberth HW, Ped Nephrol 2011
Cl-
Cl Na+
Thiazides
Na+
Na+
Na+
Ca2+
H2O
RM
Ca2+
Mg2+
Gitelman/East - Thiazide
Spironolactone
Eplérenone
H2O
Récepteur sensible au calcium (RSCa)
BLAH
BLAH
> AMPc
>
> +
Na+
2ClK+
-
RSCa 3q21-24
+
Ca2+ (Mg2+)
-
K+
Ca2+
Mg2+
ADH, PTH
+
_
Cl-
Hypocalcémie Autosomique Dom.
•PTH basse, inappropriée
•Hypomagnésemie
•Hyperphosphatémie
•Lithiase/néphrocalcinose
•Polyurie
Association HAD et Bartter
•
•
•
•
•
Réponse normalisée
Polyurie
Hypomagnésémie
Hypercalciurie
Alcalose hypokaliémique
Hyperéninémie et
hyperaldostéronisme modérées
• Hypoparathyroïdie
• EFR
1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
0
2
4
6
8
10
12
14
16
Ca2+ (mM)
ERK activity
(% of WT activity)
150
RFD de Cl: 71 % (N=86.7+4.1 %)
Osmol. Ur. Min. 90 mOsm/kg (N=54+13)
Osmol. Ur. Max. 460 mOsm/kg (N=>800)
Receptor
WT
L125P
I40F
1.1
WT
L125P
I40F
100
EC50
3.2 mM
1.4 mM
8.1 mM
Hill Slope
4.1
2.0
3.1
Bartter V
50
0
-3.5
-3.0
-2.5
-2.0
-1.5
Log [Ca +2 ] M
Vargas-Poussou R et al. JASN 2006
Diagnostic différentiel – Dossier 1
• Dossier et prélèvement adressés pour diagnostique
génétique d’un pseudohypoaldostéronisme de type 1
• Fille née le 22/03/2008, prématurée - 35 SA. Grossesse
compliqué par hydramnios. PN:1.92kg TN: 44.5 cm
• A J6 Tableau de déshydratation avec hyponatrémie,
hyperkaliémie et polyurie
• Prélèvements pour bilan hormonal et début d’un traitement
par fludrocortisone
2 Tubulopathies avec perte de sel
Pseudohypoaldostéronis
me de type 1
Bartter type2
Hydramnios
Rare
Constant
Fuite sodée
Oui
Oui
Polyurie
Oui
Oui
Persistante
Transitoire
Très élevées
Très élevées
Hyperkaliémie
Rénine et aldostérone
•
•
•
Clinique en faveur d’un syndrome de Bartter de type 2
Analyse du gène KCNJ1
Détection d’une mutation connue à l’état homozygote une semaine après la
réception du prélèvement
• Adaptation du traitement
Diagnostic Différentiel - SB anténatal
Dossier 2
Grossesse
• Parents d’origine tunisienne,
cousins germains
• 34 SA : Hydramnios + distension
diffuse d’anses digestives
• Naissance à 36 SA
• LA teinté. Méconium émis à la
naissance
• A 5 mois hospitalisation et bilan
pour stagnation pondérale
– Poids 5250 g; Taille 61 cm
• Bilan: Sang
Nouveau-né
• Apgar 10/10
• PN: 2970 g, TN: 49 cm
• Ballonnement abdominal
•
•
Urines
Na 130 mmol/l
<20 mmol/l
K 2.54 mmol/l
53 mmol/l
Cl 80 mmol/l
RA 38 mmol/l
Ca 2.6 mmol/l
Ca/Cret 0.35
Mg 0.89 mmol/l
Créatinine 20 µmol/l
Rénine active 1114 pg/ml
Aldostérone 888 pg/ml
Ecographie Rénale: normale
Pas de polyurie
Sous NaCl 12 mEq/j et KCl 24 mEq/j
Bilan: Sang
Urines
Na 135 mmol/l
24 mmol/l
K 3.5 mmol/l
28 mmol/l
Analyse des haplotypes - Bartter
anténatal – Dossier 2
Diagnostic Différentiel - SB anténatal – Dossier 2
• A 1 an - diarrhée sévère à
rotavirus. Bilan sous NaCl 20
mEq/kg/j et KCl 18 mEq/kg/j
•
P 7615 g (-1.75 DS); T 71.5 cm (-0.5 DS)
•
Bilan: Sang
Na 144 mmol/l
K 3.3 mmol/l
Cl 96 mmol/l
RA 33 mmol/l
•
A distance de l’épisode:
ionogramme de selles
Urine
217 mmol/l
68 mmol/l
184
Diarrhée Chlorée congénitale :
Maladie autosomique récessive
SLC26A3 - 7q31.1
Cl dans les selles > 90 mmol/l
Na 82 mmol/l (30-50)
K 28 mmol/l (50-80)
Cl 131 mmol/l (30-50)
Wedenoja S et al. Aliment Pharmacol Ther. 2010
And Human Mut 2011
Diagnostic Différentiel - SB classique/SG – Dossier 3
•
•
•
•
Parents non consanguins
Né à terme, pas d’antécédents
Mange peu et boit beaucoup
Episodes de déshydratation à 8
et 10 mois
• Bilan lors de ces épisodes
• Sang
Urines
Na 132 et 128 mmol/l
inadapté
K 2.4 et 2.7 mmol/l
89 mmol/l
Cl 79 mmol/l
Ca 2.56
0.15mmol/mmol
RA 42 et 40 mmol/l
Rénine active 316 pg/ml
Aldostérone 1120 pg/ml
Ecographie Rénale: normale
• A 1 an sous NaCl 1,5 g/j et K 45
mg/j
P 9.5 kg (-1 DS); T 74 cm
• Bilan: Sang
Urines
Na 139 mmol/l
29 mmol/l
K 4.8 mmol/l
40 mmol/l
Cl 110 mmol/l
RA 23 mmol/l
Ca 2.57 mmol/l
Ca/Cret 0.15
Mg 0.94 mmol/l
Créatinine 55 µmol/l
Rénine et Aldo normales
Diagnostic Différentiel - SB classique/SG – Dossier 3
•
•
Analyse du gène CLNKB: absence
de mutation
Analyse du gène SLC12A3: une
seule mutation à l’état hétérozygote.
Absence de grand réarrangement
• En 2011: retard de croissance
– Test de la sueur positive
– Confirmation d’une
mucoviscidose
• Mucoviscidose
• Maladie autosomique
récessive
• 1/3000
• CFTR - 7q31.2
• Pseudo-Bartter
• pertes chroniques de NaCl
dans la sueur
• pertes extra rénales
additionnelles
– maladies intercurrentes
– conditions environnementales
particulières (canicule)
Diagnostic Différentiel - SB classique/SG – Dossier 4
•
•
•
•
•
•
•
•
Garçon de 14 ans
Parents non consanguins
Né à terme, pas d’antécédents
Douleurs musculaires (1 an)
Fatigabilité
Episode de douleurs musculaires
sévères après sport et faiblesse
musculaire sévère avec chutes le
21/09/2010
58 kg TA 120/64
Sang
Urines
Na 141 mmol/l
28 mmol/l
K 2.1 mmol/l
29 mmol/l
Cl 79 mmol/l
RA 28 mmol/l
Ca 2.29
Mg 0.82 mmol/l
CPK 404 UI/l
Rénine active 7.38 pg/ml
Aldostérone 159 pmol/l sous perfusion
Ecographie Rénale: normale
26/09/2010
25/01/2011
Sang
Urine
Sang
(mmol/l)
(mmol/j)
Na
139
55
Cl
103
90
K
3.6
134
RA
25
Mg
0.73
5.38
0.77
Ca
2.43
2.5
2.50
FE
0.2%
3.5
9%
27
Ca/cr0.18
Créat
64 µmol/l
14
C 22.6
D 32.6
Renine
(pg/ml)
C 124
D 1531
Aldo
(pmol/l)
Sans traitement
Kaléorid 1cp/j
Paralysie Périodique Hypokaliémique
• Prévalence 1/100.000
• Autosomique dominante –
pénétrance incomplète
• Seconde décennie
• Manifestations après l’exercice
ou un repas riche en glucides ou
en Na
• 70% des cas, mutations du gène
du canal calcium musculaire
CACNL1A3 – 1q32.1
• 10% des cas, mutations du gène
du canal sodium musculaire
SCN4A – 17q23.3
Fontaine B., Adv Genet, 2008
BAN115001
• Premier enfant, famille Greque
non consanguine
• Fille , 2 ans
• Retard de croissance
• Grossesse : hydramnios 33 SA
• Née à 37 SA
• Poids : 2550 gr
• Pas de manifestations cliniques en
période néonatale
• Néphrocalcinose
Na
139 mmol/l
K
3.2 mmol/l
Cl
91 mmol/l
HCO3
32.1 mmol/l
Protéines
82 g/l
Ca
2.8 mmol/l
Mg
1.19 mmol/l
créat
25 µmol/l
Rénine
523 pg/ml
Aldo
30 ng/dl
PTH
76.9 pg/ml
25OHvitD
23.2 ng/ml
Urines
K
43 mmol/l
Cl
14 mmol/l
Ca/Créat
0,41 mmol/mmol
BAN 115
CLCNKA-CLCNKB – 1p36
ATG
ATG
Absence d’amplification
par PCR des exons 2 - 6
Délétion homozygote E2_E6
Exons 7 à 20
Séquences normales
0
CLCNKA
CLCNKB
Mapview
Sondes control
c
c
c
c
c
c
c
c
c
c
c
c
c
c
c
01-016.2 CLCNKB Exon 19
01-016.2 CLCNKB Exon 18
01-016.2 CLCNKB Exon 17
01-016.2 CLCNKB Exon 15
01-016.2 CLCNKB Exon 14
01-016.2 CLCNKB Exon 13
01-016.2 CLCNKB Exon 11
01-016.2 CLCNKB Exon 10
01-016.2 CLCNKB Exon 08
01-016.2 CLCNKB Exon 06
01-016.2 CLCNKB Exon 05
01-016.2 CLCNKB Exon 03
01-016.2 CLCNKB Exon 02
01-016.2 CLCNKB Exon 01
01-016.2 CLCNKA Exon 10
01-016.2 CLCNKA Exon 05
01-015.7 CASP9
01-014.0 PRDM2
Ratio
BAN 115 - patient
D02_ban115001_caro020312.fsa^GMsTXT.txt
1,2
1
0,8
0,6
0,4
0,2
0
CLCNKA
CLCNKB
Mapview
Sondes control
c
c
c
c
c
c
c
c
c
c
c
c
c
c
c
01-016.2 CLCNKB Exon 19
01-016.2 CLCNKB Exon 18
01-016.2 CLCNKB Exon 17
01-016.2 CLCNKB Exon 15
01-016.2 CLCNKB Exon 14
01-016.2 CLCNKB Exon 13
01-016.2 CLCNKB Exon 11
01-016.2 CLCNKB Exon 10
01-016.2 CLCNKB Exon 08
01-016.2 CLCNKB Exon 06
01-016.2 CLCNKB Exon 05
01-016.2 CLCNKB Exon 03
01-016.2 CLCNKB Exon 02
01-016.2 CLCNKB Exon 01
01-016.2 CLCNKA Exon 10
01-016.2 CLCNKA Exon 05
01-015.7 CASP9
01-014.0 PRDM2
Ratio
BAN 115 - père
E02_ban115010_caro020312.fsa^GMsTXT.txt
1,4
1,2
1
0,8
0,6
0,4
0,2
0
CLCNKA
CLCNKB
Mapview
Sondes control
c
c
c
c
c
c
c
c
c
c
c
c
c
c
c
01-016.2 CLCNKB Exon 19
01-016.2 CLCNKB Exon 18
01-016.2 CLCNKB Exon 17
01-016.2 CLCNKB Exon 15
01-016.2 CLCNKB Exon 14
01-016.2 CLCNKB Exon 13
01-016.2 CLCNKB Exon 11
01-016.2 CLCNKB Exon 10
01-016.2 CLCNKB Exon 08
01-016.2 CLCNKB Exon 06
01-016.2 CLCNKB Exon 05
01-016.2 CLCNKB Exon 03
01-016.2 CLCNKB Exon 02
01-016.2 CLCNKB Exon 01
01-016.2 CLCNKA Exon 10
01-016.2 CLCNKA Exon 05
01-015.7 CASP9
01-014.0 PRDM2
Ratio
BAN 115 - mère
F02_ban115011_caro020312.fsa^GMsTXT.txt
1,2
1
0,8
0,6
0,4
0,2
Hypokaliémie d’origine rénale
I
1
II
2
1
3
2
4
3
Famille française non-consanguine avec 5 individus
atteints sur deux générations.
Phénotype
Plasma
Na+
K+
Unités
Cl -
HCO3 -
Urines
Mg
mmol/l
Rénine*
Aldostérone*
mU/l
pmol/l
Na+
K+
Cl-
Mg
Ca
mmol/24h
Ca/Créatinine
mmol/mmol
Normes
135-145
3,5-4,5
95-105
22-27
0,71-1,04
15-50
208-100
II-2 Cas
index
140
2,6
94
33
0,52
272
943
258
119
286
2,9
2,5
0,16
II-1 Sœur
atteinte
138
2,9
99
29
0,62
197
1961
123
87
106
0.7
0.12
0,01
II-3 Sœur
137
3,5
101
26
0,9
I-1 oncle
atteint
138
2,5
92
37
0,49
133
1488
245
179
345
6,2
5,8
0,51
I-2 père
140
4.3
103
29
0.87
I-3 Mère
137
2,2
95
33
0,58
124
596
166
128
243
3,8
3,85
0,41
I-4 tante
atteinte
136
2,2
94
36
0,64
104
917
247
27
324
2,1
3,38
0,4
* Après une heure d’orthostatisme
Séquençage du gène SLC12A3
I
Mutation 1
1
2
3
Mutation 2
Mutations 3 et 4
Mutations
2,3 et 4
II
4
1
Mutations
1,3 et 4
2
Hétérozygote comp.
Mutation 1 et 2
3
Mutations
3 et 4
Mutation 1, exon 10: c.120insGTGATGC, p.Asp400X
Mutation 2, exon 23: c.2747+1G>A
Mutation 3, exon 14: c.1805_1806del, p.Tyr602CysfsX31
Mutation 4, exon 22: c.2660+1G>A
Mutations
2,3 et 4
Séquençage du gène SLC12A3
1
I
3
4
2
3
1
2
3
4
1
II
1
3
4
2
1
2
4
3
4
2
3
3
4
Mutation 1, exon 10: c.120insGTGATGC, p.Asp400X
Mutation 2, exon 23: c.2747+1G>A
Mutation 3, exon 14: c.1805_1806del, p.Tyr602CysfsX31
Mutation 4, exon 22: c.2660+1G>A
2
Traitement
Na+
Cl Na+
Thiazides
7%
Gitelman
ClK+
Na+
Na+
Ca2+
Ca2+
Mg2+
Na+
H+
Na+
Ca2+
Na+
Mg2+
Suppléments en sel,
K, Mg
Diurétiques (amiloride)
Na+
20%
2Cl Na+
K+
Furosémide
K+
K+
Ca++
Mg++
NH4+
(+)
H+
Na+
Na+
K+
Cl Barttin
Cl K+
HCO3-
Na+
(-)
Vte
Bartter
Prise en charge
périnatale
Suppléments en sel,
K, Mg
Indométacine
PHRC- GITAB- Dr Anne BLANCHARD
-
Hommes ou femmes âgés de 18-60 ans,
-
atteints de syndrome de Gitelman génétiquement confirmé.
-
Contraception efficace chez les femmes en âge de procréer. S’il s’agit d’une
contraception œstro-progestative maintenue inchangée pendant toute l’étude.
-
Consentement éclairé signé
Mesure de kaliémie, natrémie, créatininémie en ville
MODAMIDE
20
10
5
CHRONOINDOCID
(+ oméprazole 20 mg)
INSPRA
150
100
50
75
REPONSE AUX TRAITEMENTS
100
Intolerant
Non responder
Intermediate responder
Full responder
Patients (%)
80
60
40
20
0
Indomethacin
(n=30)
Eplerenone
(n=30)
Amiloride
(n=30)
Delta kaliémie
 < 0,1 mmol/l : non répondeur
 0,1-0,3 mmol/l : répondeur intermédiaire
 > 0,3 mmol/l : répondeur
CONCLUSION
-
EFFICACITE :
Indometacine> eplerenone= amiloride
-
TOLERANCE COURT TERME:
eplerenone> amiloride>Indometacine
-
A LONG TERME:
Risques avec indometacine : rénal, digestif, cardiovasculaire
Eplerenone: prise de poids, troubles sexuels
Amiloride à cette dose: troubles du sommeil, douleurs abdominales
 INDICATION A POSER EN FONCTION DU RAPPORT BENEFICE/RISQUE
Signification clinique de l’hétérozygotie pour des mutations du
gène SLC12A3
PHRC 2013, HEPHYGI
Pression artériellle :
Population :
Patient Gitelman -/Pat. hétérozygotes +/Contrôles +/+
Auto mesure, ECG
n= 50
n=100
n=100
National
HEGP : CRC, Pr M Azizi, Dr A
Blanchard, Pr P. Houillier
Hôpital Tenon: Pr JP Haymann
CHU Limoges: Pr M. Essig
HC Lyon: Dr L. Doubourg
CHU Toulouse: Pr I. Tack
Homéostase Na K :
Sang, Ur 24h, rénine, aldostérone
Homéostase Mg, Ca :
Sang, Ur 24h Urine, marqueurs osseux
Vaisseaux :
Mesure de la PAC et de la VOP
Marqueurs ADMA/SDMA
NO2/NO3 Ur
Metabolisme :
Poids, taille, BMI
HGPO; IRI
Métabolisme de lipide
Sérothèque et Urothèque
Signification clinique de l’hétérozygotie pour des mutations du
gène SLC12A3
PHRC 2013, HEPHYGI
H de J
Utilisation appareil
d’automesure
Organisation
dates
Consentement
BP
ECG
Prise de sang
HGPO
SphygmoCor
Mesure PA
Recueil
Ur 24 h
J1
V0
Information
J2
J3
V1
MERCI
Centres de Référence
Centres de Compétences
La Réunion
Author
Document
Category
Uncategorized
Views
1
File Size
4 602 KB
Tags
1/--pages
Report inappropriate content