Compendium of Lectures Winter School on Chemical Analysis of Value Added Dairy Products and Their Quality Assurance January 11-31, 2011 Editing and Compilation Dr. Rajan Sharma Dr. (Mrs.) Bimlesh Mann DAIRY CHEMISTRY DIVISION NATIONAL DAIRY RESEARCH INSTITUTE (Deemed University) Karnal вЂ“ 132 001 (Haryana) INDIA Dr. Rajan Sharma Senior Scientist & Director, Winter School Dr. (Mrs.) Bimlesh Mann Principal Scientist & Co-Director, Winter School Course Advisors Dr. (Mrs.) B.K. Wadhwa Dr. Darshan Lal Dr. Raman Seth ALL RIGHTS RESERVED No part of the lecture compendium may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information, storage and retrieval system without the written permission of Director, NDRI, Karnal. FOREWORD The increased concern of consumers for improving overall health and reducing risk for specific diseases through food, gives an opportunities for expanding the dairy products to provide benefits beyond their traditional nutritional value. Milk is considered as an ideal vehicle for developing valueadded products, as it already contains a number of beneficial major and minor micro-nutrients and bioactive peptides. In society, as incomes rise and economic conditions improve, the demand for more varied foodstuffs increases. Consequently, a large number of new products are being brought to the market every year. The organized dairy industry is constantly looking for technologies for product diversification that can enhance its competitive edge and increase profitability on sustainable basis. The commodities like milk powder and ghee which remain the main stay of the dairy sector at the moment, does not appear to be sustainable in future and hence a major shift in products for organized dairy industry seems inevitable. Empirical evidences also suggest that the composition of an average Indian's food basket is gradually shifting towards value added products. Purchasing power of the consumers is on the upswing and the Indian middle class looks for value and quality and is willing to pay extra bit for this purpose. Dairy products enriched with the health attributes of functional ingredients, which is considered as potential novel foods for health promotion should be safe. However, the level of health claim with optimum sensory and textural properties of such foods has yet to be investigated. As the demand for the value added dairy foods is increasing, so is the requirement for developing analytical methodologies for assuring the consumer about the health claims. In the present Winter School, the curriculum has been designed comprehensively to cover various aspects for assuring the quality of value added dairy products. The emphasis will be given on analytical techniques for the validation of health claims made in the value added dairy products and also to provide hands-on-practical training to the participants on latest techniques being used in the area of Dairy Chemistry. I am sure that the deliberations in the 21 days Winter School on вЂњChemical Analysis of Value Added Dairy Products and Their Quality AssuranceвЂќ will be highly useful for the participants in the area of Quality Assurance of Value Added Dairy Products. Further the information compiled by the organizers in the form of compendium will also benefit the Faculty, Scientists and Students of Dairy Chemistry and Allied Disciplines and serve as a guide to solve their problem at their respective place of work. I wish winter school a great success. (A.K. Srivastava) DAIRY CHEMISTRY DIVISION NATIONAL DAIRY RESEARCH INSTITUTE (Deemed University) Karnal вЂ“ 132 001 (Haryana) INDIA Dr. (Mrs.) B.K. Wadhwa Principal Scientist & Head PREFACE Dairy Chemistry Division, the host division of this Winter School is one of the oldest divisions of the institute. The division has made significant achievements viz. kit for detection of 12 adulterants, tests for detection of synthetic milk, technologies for calcium enriched milk and low cholesterol ghee. The knowhow of these tests and technologies has been commercialized/transferred. Three analytical methods viz. 10.75 ml milk pipette for the accurate estimation of fat in buffalo milk/mixed milk; lactometer for SNF and dual purpose Gerber butyrometer for quantitative and purity determination of fat in milk have been adopted by BIS. The other significant achievements are rapid methods for detection of soya milk; detection of vegetable oils in ghee; technologies for low calorie artificially sweetened dairy products; antioxidant rich fruit whey beverages; value addition through fortification of herbs and cereals in milk and milk products; synbiotic ice cream; protein rich powder from buffalo colostrum, bioactive peptides from whey protein hydrolysates and many more. Number of protocols have been developed for the analysis of contaminants flavor compounds and bioactive components of milk and milk products. The division has also contributed significantly in basic studies namely ghee flavor chemistry, bioactive peptides like lactoferrin, osteopontin, caseinophosphopeptides etc. Currently, the division is progressing towards quality control aspects viz. detection of adulterants at microlevel using nanotechnology; application of nanotechnology in dairy foods, validation of methods for the detection of foreign fats in ghee and development and evaluation of multiple micronutrients fortified milks. The division has completed four externally funded projects and now engaged in four more such projects. The faculty has successfully conducted about 20 trainings/national seminars/summer schools/Winter Schools on fat rich dairy products, on quality control aspects, analytical techniques and bioactive components etc. The faculty has published more than 1000 publications constituting research papers, popular articles, review articles, books, compendium etc. The faculty has also autoured 5 books, 15 book chapters and10 teaching manuals. Milk and milk products serve as an ideal delivery system for micronutrients. The demand for the value added dairy products is continuously increasing because of consumer awareness about health and nutrition. It is also important to ensure the consumer about the quality and health and nutrition claims of such products. This can be achieved by analytical methods and techniques. I am sure the knowledge gained through this Winter School on вЂњChemical Analysis of Value Added Dairy Products and Their Quality AssuranceвЂќ will be of immense use and of great interest for all the participants. I wish you all a great success and a very happy and prosperous new year. (B.K. Wadhwa) ACKNOWLEDGEMENT We feel honored that ICAR has entrusted us with the responsibility of organizing a Winter School on вЂњChemical Analysis of Value Added Dairy Products and Their Quality AssuranceвЂќ to Dairy Chemistry Division at NDRI, Karnal. We are highly thankful to Dr. Kusumakar Sharma, Assistant Director General (HRD), ICAR, New Delhi for giving us this opportunity to organize the Winter school at NDRI, Karnal and for timely release of funds. We want to place on record our deep sense of gratitude for Dr. A.K. Srivastava, Director NDRI Karnal for his keen interest, valuable guidance and encouragement. He personally monitored the arrangements for smooth conduct of the programme without which it would have not been possible to host the school in a befitting manner. We are also thankful to the Dr. S. L. Goswami and Dr. G.R. Patil Joint Directors of NDRI for their constructive suggestions and valuable support. The kind cooperation and overwhelming support of Dr. (Mrs.) B.K. Wadhwa, Head, Dairy Chemistry Division for the conduct of Winter School is gratefully acknowledged. We also express our thanks to other Course Advisors Dr. Darshan Lal and Dr. Raman Seth and other Scientists of Dairy Chemistry Division, who served on various committees and helped in planning and organizing this activity. We take this opportunity in thanking honoured guest speakers who traveled all the way to Karnal to share their knowledge and expertise with us. The faculty for this winter school transcended the boundaries of conventional Divisions at NDRI and was spread to different Divisions i.e. Dairy Microbiology, Dairy Chemistry, Dairy Technology, Animal Biochemistry, Animal Biotechnology, Dairy Cattle Nutrition and Dairy Cattle Breeding. We express our gratitude to the faculty from all these disciplines for delivering lectures and conducting practical classes during the winter school. All our research scholars assiduously and enthusiastically worked for the success of this program, and they deserve high acclaim and appreciation for the same. We also place on record our appreciation for secretarial services of Mr. Ajit Singh and Mrs. Shakuntla Rani and helpful hand extended by Mr. Rajiv Sharma, and Mr. Deepak, Mr. Mahinder Yadav and Mr.Chanderpal in day to day work. We are highly thankful to all the participants for making it to Karnal. We highly appreciate the cooperative spirit displayed by the participants. We are also grateful to the Heads of various Institutions and Departments for sponsoring the participants. (Bimlesh Mann) Principal Scientist & Co-Director Winter School (Rajan Sharma) Senior Scientist & Director Winter School Committees for Organisation of Winter School Organizing Committee Dr. (Mrs.) B.K. Wadhwa, Head & Principal Scientist Dr. Darshan Lal, Principal Scientist Dr. Raman Seth, Principal Scientist Dr. (Mrs) Bimlesh Mann, Principal Scientist Dr. Sumit Arora, Senior Scientist Dr. Vivek Sharma, Senior Scientist Dr. Rajesh Kumar, Senior Scientist Dr. Rajan Sharma, Senior Scientist (Convener) Registration Committee Dr. Raman Seth (Chairman) Dr. Rajesh Kumar (Convener) Dr. Sumit Arora Sh. P.C. Singh Sh. Ajit Singh Technical Comiittee Dr. Darshan Lal (Chairman) Dr. (Mrs) Bimlesh Mann (Convener) Dr. Raman Seth Dr. Rajesh Kumar Dr. Rajan Sharma Hospitality Committee Dr. (Mrs.) B.K. Wadhwa (Chairman) Dr. Vivek Sharma (Convener) Dr. (Mrs.) Bimlesh Mann Sh. Rajeev Sharma Purchase Committee Dr. (Mrs) Bimlesh Mann (Chairman) Dr. Rajan Sharma (Convener) Dr. Rajesh Kumar Dr. Vivek Sharma Contents THEORY 1. Novel and Emerging Food Technologies for Defence Food Supplies 1 A. S. Bawa 2. An Overview of Designer Functional and Health Foods 5 A. K. Srivastava 3. Prospects of Value Addition Through Functional Ingredients 10 G. R. Patil 4. Technological and Nutritional Aspects of Milk Phospholipids 17 B. K. Wadhwa and Rajesh Kumar 5. Methods of Cholesterol Removal to Develop Low вЂ“ Cholesterol Dairy Products 22 Darshan Lal and Vivek Sharma 6. Fortification of Milk and Milk Products for Value Addition 29 Sumit Arora 7. Packaging of Value Added Foods and Their Storage Stability 36 P. P. Gothwal 8. Novel Technologies for Processing and Packaging of Health Foods and Beverages 40 H. N. Mishra 9. Glycomacropeptide вЂ“ Biological Properties and its Application 49 Rajan Sharma and Neelima Sharma 10. New Approaches to Detect the Adulteration of Ghee with Animal Body Fats and Vegetable Oils/ Fats 54 Vivek Sharma, Darshan Lal, Arun Kumar and Amit Kumar 11. Colostrum Powder and its Health Benefits 59 Raman Seth and Anamika Das 12. Cow Ghee Protects from Mammary Carcinogenesis: Mechanism 68 Vinod K. Kansal, Rita Rani and Ekta Bhatia 13. Lateral Flow Assay- Principle and its Application in Analytical Food Science 72 Rajan Sharma and Priyanka Singh Rao 14. Separation Strategies for Bioactive Milk Proteins 77 Rajesh Kumar 15. SDS-PAGE вЂ“ Principle and Applications 81 Y. S. Rajput and Rajan Sharma 16. Western Blot: Theoretical Aspects Y. S. Rajput and Rajan Sharma 85 17. Enzyme Linked Immunosorbent Assay - Theory 88 Rajeev Kapila and Suman Kapila 18. Experimental Determination of Thermal Stability of Proteins: A Theoretical Background 93 Jai K. Kaushik 19. Species-Specific Identification of Milk and Milk Products: A Molecular Approach 97 Archana Verma 20. Proteomic Techniques for Application in Food Science 100 Ashok K. Mohanty 21. Evaluation of Probiotic Attributes of Dairy Starter Cultures Using Various Test Methods 106 Rameshwar Singh 22. Identification of Lactobacillus spp by PCR based Molecular Methodology 110 Sachinandan De and Rupinder Kaur 23. Antimicrobial Substances produced by Lactic Acid Bacteria (LAB) 114 Shilpa Vij, Subrota Hati and Minakshi Dahiya 24. Microbiological Risk Assessment: A New Concept to Ensure Food Safety 117 Naresh Kumar and Raghu H. V. 25. Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria 126 R. K. Malik and Gurpreet Kaur 26. Regulatory Aspects of Functional Foods 135 Bimlesh mann , Rajesh Kumar and Prerna Saini 27. Nanomaterials - Their Applications and Safety Aspects in Foods 142 Bimlesh Mann , Rajesh Kumar and Prabhakar Padgham 28. Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticals 145 Ayyasamy Manimaran and Bimlesh Mann 29. Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation 151 Chand Ram, Manju and Santosh Anand 30. Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water Activity 160 R. R. B. Singh and Prateek Sharma 31. Malt Based Milk Foods as вЂњValue Added Functional Dairy ProductsвЂќ Laxmana Naik, Rajan Sharma, Manju G. and Amit K. Barui 165 PRACTICAL 32. Preparation and Characterization of Gold Nanoparticles, Their Conjugation with Antibodies and Construction of Lateral Flow Devices 170 Priyanka Singh Rao, Swapnil Sonar, Y.S. Rajput and Rajan Sharma 33. Use of Lateral Flow Technique for Detecting Melamine in Milk 173 Raman Seth and Anamika Dass 34. Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and Oils 177 Sumit Arora 35. Estimation of Cholesterol Content in Ghee Using a Cholesterol Estimation Kit 182 Vivek Sharma and Darshan Lal 36. Rapid Methods for Detection of Adulterants in Milk 184 Rajan Sharma, Raman Seth and Amit K. Bauri 37. Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches 189 Darshan Lal, Vivek Sharma, Arun Kumar and Amit Kumar 38. Determination of Total Polyphenolic Content in Fruit Enriched Dairy Product 195 Rajesh Kumar and Richa Singh 39. Separation and Identification of Low Molecular Weight Proteins Using Tricine SDS-PAGE 197 Neelima Sharma, Rajan Sharma and Y. S. Rajput 40. Identification of Proteins Through Western Blotting вЂ“ Practical 200 Neelima Sharma, Amit K.Barui and Y.S. Rajput 41. Typing of Milk for A1 and A2 beta Casein 204 Sachinandan De, C. M. Hari Kishore, Ayan Mukherjee and Rupinder Kaur 42. Enzyme-Linked Immunosorbent Assay-Practical 206 Suman Kapila and Rajeev Kapila 43. Evaluation of Biological Activity of Milk Protein Ingredients 208 Bimlesh Mann, Prerna Saini, Prabhakar Padghan, Anuradha Kumari 44. Purification of Bioactive Proteins from Milk 212 Neha Mishra, Rajesh Kumar and Jai K Kaushik 45. Immunological Method to Detect Buffalo Milk in Cow Milk 214 Archana Verma 46. Conjugated Linoleic Acid and Its Estimation 217 A. K. Tyagi, A. Hossain, A. Tyagi 47. Importance and Estimation of Vitamins A & E in Value Added Dairy Products Harjit Kaur 221 48. Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products 225 Veena Mani 49. Pesticides: Their Analysis in Milk Using High Performance Liquid Chromatography 230 Chander Datt and Monica Puniya 50. Estimation of Microbial GOS by High Performance Liquid Chromatography 233 Vikas Sangwan and Sudhir Kumar Tomar 51. Estimation of Trehalose Production by Propionibacteria 236 Poonam and Sudhir Kumar Tomar 52. Spore Based Biosensor as A Quality Control Tool in Dairy Industry 239 Naresh Kumar, Raghu H. V. and Avinash 53. Detection and Evaluation of Antimicrobial Activities of Bacteriocins and Bioactive Peptides Produced by LAB Shilpa Vij, Subrota Hati and Meenakshi Dahiy 248 Programme Schedule for Winter School Programme Schedule for Winter School Chemical Analysis of Value Added Dairy Products and Their Quality Assurance January 11-31, 2011 11th January 2011(Tuesday) 9.00 AM вЂ“ 9.30 AM Registration of Participants 9.30 AM -12.30 PM Inauguration of Winter School Novel and Emerging Food Technologies for Defence Food Supplies вЂ“ Inagural Lecture by Dr. A.S.Bawa, Director, Defence Food Research Laboratory, Mysore 12.30 PM -1.00 PM Visit to ATIC/Institute Film Lunch 2.15 PM вЂ“ 3.15 PM Achievements of Dairy Chemistry Division Dr. (Mrs.) B.K. Wadhwa 3.15 PM вЂ“ 4.30 PM Prospects of Value Addition Through functional Ingredients Dr. G.R. Patil 12th January 2011 (Wednesday) 9.45 AM -10.45 AM Method of Cholesterol Removal to Develop Low Cholesterol Dairy Products вЂ“ Theory Dr. Darshan Lal 11.00 AM вЂ“ 12.00 PM Fortification of Milk and Milk Products for Value Addition вЂ“ Theory Dr. Sumit Arora 12.00 PM вЂ“ 1.00 PM Cow Ghee Protects from Mammary Carcinogenesis: Mechanism вЂ“ Theory Dr.V.K. Kansal Estimation of Cholesterol Content in Ghee Using a Cholesterol Estimation KitвЂ“ Practical Dr. Vivek Sharma Lunch 2.15 PM -5.00 PM 13th January 2011 (Thursday) 9.45 AM -10.45 AM Evaluation of Probiotic Attributes of Dairy Starter Cultures using Various Test Methods вЂ“ Theory Dr. Rameshwar Singh 11.00 AM вЂ“ 12.00 PM Separation Strategies for Bioactive Milk Proteins вЂ“ Theory Dr. Rajesh Kumar 12.00 PM вЂ“ 1.00 PM New Approaches to Detect the Adulteration of Milk Ghee with Animal Body Fats and Vegetable Oils/ Fats вЂ“ Theory Dr. Vivek Sharma Lunch 2.15 PM вЂ“ 3.15 PM 3.15 PM вЂ“ 5.00 PM Quality and Food Safety in Yoghurt Industry вЂ“ Guest Lecture Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches - Practical Mr. Anuj Mehta (Danone India Ltd.) Dr. Darshan Lal 14th January 2011 (Friday) 9.45 AM -10.45 AM Technological and Nutritional Aspects of Milk Phospholipids Theory Dr.(Mrs.) B.K. Wadhwa 11.00 AM вЂ“ 12.00 PM Colostrum Powder and its Health benefit - Theory Dr. Raman Seth 12.00 PM вЂ“ 1.00 PM Novel Technologies for Processing and Packaging of Health Foods and Beverages вЂ“ Guest Lecture Dr. H.N. Misra IIT, Kharagpur Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Lunch 2.15 PM вЂ“ 5.00 PM Purification of Bioactive Proteins from Milk вЂ“ Practical Dr. Jai K. Kaushik 15th January 2011 (Saturday) 9.45 AM -10.45 AM Nanomaterials - Their Applications and Safety Aspects in Food вЂ“ Theory Dr. (Mrs.) Bimlesh Mann 11.00 AM вЂ“ 12.00 PM Recent Advances in Synbiotic Dairy Foods and their Safety Evaluation вЂ“ Theory Dr. Chand Ram 12.00 PM вЂ“ 1.00 PM Determination of Total Polyphenolic Content in Fruit Enriched Dairy ProductвЂ“ Theory & Practical Dr. Rajesh Kumar 2.15 PM вЂ“ 3.15 PM contdвЂ¦. Determination of Total Polyphenolic Content in Fruit Enriched Dairy Product вЂ“ Practical Dr. Rajesh Kumar 3.15 PM вЂ“ 5.15 PM Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and Oils вЂ“ Theory & Practical Dr. Sumit Arora Lunch 16th January 2011(Sunday) 17th January 2011 (Monday) 9.45 AM -10.45 AM SDS-PAGE вЂ“ Principle and Applications -Theory Dr. Y.S. Rajput 11.00 AM вЂ“ 1.00 PM Separation and Identification of Low Molecular Weight Proteins using SDS-PAGE вЂ“ Practical Dr. Y.S. Rajput 2.15 PM вЂ“ 3.15 PM Western Blot: Theoretical Aspects вЂ“ Theory Dr. Y.S. Rajput 3.15 PM- 5.00 PM Identification of Proteins through Western Blotting вЂ“ Practical Dr. Y.S. Rajput Lunch 18th January 2011 (Tuesday) 9.45 AM -10.45 AM Lateral Flow Assay- Principle and its Application in Analytical Food Science вЂ“ Theory Dr. Rajan Sharma 11.00 AM вЂ“ 1.00 PM Preparation and Characterization of Gold Nanoparticles, their Conjugation with Antibodies and Construction of Lateral Flow Devices вЂ“ Practical Dr. Rajan Sharma 2.15 PM вЂ“ 3.15 PM contdвЂ¦. Preparation and Characterization of Gold Nanoparticles, their Conjugation with Antibodies and Construction of Lateral Flow Devices - Practical Dr. Rajan Sharma 3.15 PM - 4.00 PM Use of Lateral Flow Technique for Detecting Melamine in Milk вЂ“ Practical Dr. Raman Seth 4.00 PM вЂ“ 5.00 PM Regulatory Aspects of Functional Foods Dr. Bimlesh Mann Lunch 19th January 2011 (Wednesday) 9.45 AM -10.45 AM Importance and Estimation of Vitamin A & E in Value Added Dairy Products вЂ“ Theory Dr. (Mrs.) Harjeet Kaur 11.00 AM вЂ“ 1.00 PM contdвЂ¦. Importance and estimation of vitamin A & E in Value Added Dairy Products вЂ“ Practical Dr. (Mrs.) Harjeet Kaur Lunch Programme Schedule for Winter School 2.15 PM вЂ“ 3.30 PM 3.30 PM вЂ“ 5.00 PM Estimation of Microbial GOS by HPLC - Theory and Practical Estimation of Trehalose Production by Propionibacteria вЂ“ Theory and Practical Dr. S.K. Tomar Dr. S.K. Tomar 20th January 2011 (Thursday) 9.45 AM -10.45 AM Microbiological Risk Assessment: A New Concept to Ensure Food Safety вЂ“ Theory Dr. Naresh Kumar 11.00 AM вЂ“ 1.00 PM Spore Based Biosensor as A Quality Control Tool in Dairy Industry вЂ“ Practical Dr. Naresh Kumar 2.15 PM вЂ“ 3.15 PM Enzyme Linked Immunossorbent Assay вЂ“Theory Dr. Rajeev Kapila 3.15 PM вЂ“ 5.00 PM Enzyme Linked Immunossorbent Assay вЂ“ Practical Dr. Suman Kapila Lunch 21st January 2011 (Friday) 9.45 AM -10.45 AM Experimental Determination of Thermal Stability of Proteins: A Dr. Jai K Kaushik Theoretical Background 11.00 AM- 12.00 PM Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria вЂ“ Theory Dr. R.K. Malik 11.00 AM- 1.00 PM Glycomacropeptide вЂ“ Biological Properties and its Application Dr. Rajan Sharma 2.15 PM вЂ“ 3.15 PM Pesticides: Their Analysis in Milk Using High Performance Liquid ChromatographyвЂ“ Theory Dr. Chander Datt 3.15 PM вЂ“ 5.00 PM ContdвЂ¦. Pesticides: Their Analysis in Milk Using High Performance Liquid Chromatography вЂ“ Practical Dr. Chander Datt Lunch 22nd January 2011(Saturday) Exposure of Participants of Winter School to вЂњBrain Storming Session on Promotion of Indigenous Dairy Products in International MarketвЂќ being organized by Alumni Association, NDRI, Karnal 23rd January 2011 (Sunday) 24th January 2011(Monday) 2.15 PM вЂ“ 3.30 PM Identification of Lactobacillus spp by PCR based Molecular Methodology вЂ“ Theory & Practical Dr. Sachinandan De 3.30 PM вЂ“ 5.00 PM Typing of Milk for A1 and A2 beta casein - Theory & Practical Dr. Sachinandan De 2.15 PM вЂ“ 3.15 PM Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products вЂ“ Theory Dr. (Mrs.) Veena Mani 3.15 PM- 5.00 PM ContdвЂ¦. Use of Atomic Absorption Spectrophotometer for the Dr. (Mrs.) Veena Mani Estimation of Minerals in Milk and Milk Products вЂ“ Practical Lunch 25th January 2011(Tuesday) 9.45 AM -12.00 PM 12.00 AM вЂ“ 1.00 PM Lunch Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water Activity вЂ“ Theory & Practical Allergen Mangement in Foods - Emerging Trends Dr. R.R. B. Singh Rajesh Kumar Sharma (Cadbury India Ltd.) Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 2.15 PM вЂ“ 3.15 PM Common Statistical Techniques for Analytical Dairy and Food Science вЂ“ Theory Dr. A.P. Ruhil 3.15 PM- 5.00 PM contdвЂ¦. Common Statistical Techniques for Analytical Dairy and Food Science вЂ“ Practical Dr. A.P. Ruhil 26th January 2011(Wednesday) вЂ“ Republic Day 27th January 2011 (Thursday) 9.45 AM -10.45 AM Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticals вЂ“ Theory Dr. Ayyasamy Manimaran 11.00 AM вЂ“ 12.00 PM Rapid Methods for Detection of Adulterants in Milk вЂ“ Practical Dr. Rajan Sharma 12.00 PM вЂ“ 1.00 PM Visit to Model Dairy Mr. G. Mutreja 2.15 PM вЂ“ 3.15 PM Immunological Method to Detect Buffalo Milk in Cow Milk вЂ“ Practical Dr. (Mrs.) Archana Verma 3.15 PM- 5.00 PM Species-Specific Identification of Milk and Milk Products: A Molecular Approach - Theory Dr. (Mrs.) Archna Verma Lunch 28th January 2011 (Friday) Packaging of Value Added Foods and Their Storage Stability вЂ“ Guest Lecture P.P. Gothwal (CFTRI, Regional Center, Lucknow) Food Additives and Quality Issues вЂ“ Guest Lecture Ravinder Kumar (Danisco India Ltd.) Proteomic Techniques for Application in Food Science Dr. Ashok K. Mohanty 2.15 PM вЂ“ 3.15 PM Evaluation of Biological Activity of Milk Protein Ingredients вЂ“ Theory Dr. (Mrs.) Bimlesh Mann 3.15 PM вЂ“ 5.00 PM contdвЂ¦. Evaluation of Biological Activity of Milk Protein Ingredients вЂ“ Practical Dr. (Mrs.) Bimlesh Mann 9.45 AM -10.45 AM 11.00 AM вЂ“ 12.00 PM 12.00 PM вЂ“ 1.00 PM Lunch 29th January 2011 (Saturday) 9.45 AM -10.45 AM Antimicrobial Substances Produced by Lactic Acid Bacteria (LAB) - Theory Dr. (Mrs.) Shilpa Vij 11.00 AM вЂ“ 1.00 PM Detection and Evaluation of Antimicrobial Activities of Bacteriocins and Bioactive Peptides Produced by LAB вЂ“ Theory & Practical Dr. (Mrs.) Shilpa Vij 2.15 PM вЂ“ 3.15 PM Conjugated Linoleic Acid and Its Estimation вЂ“ Theory Dr. Amrish Tyagi 3.15 PM- 5.00 PM ContdвЂ¦. Conjugated Linoleic Acid and Its Estimation вЂ“ Practical Dr. Amrish Tyagi Lunch 30th January 2011 (Sunday) 31st January 2011(Monday) 9.45 AM -10.45 AM 10.45 AM вЂ“ 1.00 PM Lunch Course Evaluation Dr. (Mrs.) Bimlesh Mann and Dr. Rajan Sharma Interaction with Faculty Chaired by Head, DC Division Novel and Emerging Food Technologies for Defence Food Supplies Novel and Emerging Food Technologies for Defence Food Supplies Dr. A. S. Bawa Director Defence Food Research Laboratory, Mysore The Defence Food Research Laboratory (DFRL) was established in December, 1961 under the aegis of Defence Research & Development Organisation (DRDO), Ministry of Defence to cater to the strategic operational requirements of our Services and to provide logistical support to the Armed forces in the area of food supplies. Our troops often operate in far flung in hospitable treacherous terrains under inclement and hostile weather conditions. In such operational situations, not only are they deprived of the fresh produce needed to sustain life processes even normal regime of cooking becomes extremely cumbersome and difficult. The R & D efforts at DFRL are aimed at designing and engineering light weight convenient, pack rations for Army,Navy,Air force and other paramilitary forces which do not require any elaborate cooking or preparation at the consumerвЂ™s end and remain shelf-stable under varying climate condition for periods ranging from 6 months to 1 year. Through enormous and substantive contribution, DFRL has developed a wide verity of food products of Indian dietary matching the mainframe palate tastes of the country. Many of the DFRL foods, born out of innovative state of the art technology, lend themselves eminently suitable to industrial scale commercial exploitation by enterprising entrepreneurs of different genre. DFRL also has products which are export worthy and amenable to working women. Owing to its singular dedicated contributions in processed foods, DFRL can be reckoned as the leader in convenience food and packed ration developments in this country. Indigenous ingenuity is the hallmark of most of the technologies developed at DFRL. Over the decades, the technological advancements have resulted in several innovative technologies for various applications. Among the dehydration techniques freeze-drying maintains the quality of products which is quite close to that of fresh one. During freeze drying the thermal evaporation of moisture is through sublimation at low temperatures and under high vacuum. Hurdle technology helps to preserve foods for a period of 2-4 months and is applicable to fruits, vegetables and their products as well as meat and fish products and is sparingly used for cereal products preservation. Hurdle technology is an intelligent combination of hurdles such as pH, temperature, water activity, redox potential, preservative etc. to ensure the microbial safety as well as sensory and nutritional acceptance. Membrane technology is used in the manufacture of clarified juices, for initial concentration through ultra filtration, nano-filtration and reverse osmosis processes. Thermal treatment is the most widely used technology for preservation of foods. Thus retort processing of foods has been the most promising technique for preservation of both vegetarian and non-vegetarian foods in the ready-to-eat form. The temperatures in the range of 110 вЂ“ 125ВєC are used for low acid foods with the main objective of inactivating the undesirable micro-organisms to achieve commercial sterilization. High pressure technology is a novel non-thermal processing method of food preservation where the food is subjected to high hydrostatic pressures in the range of 100-600 Mpa at room temperature. The Armed Forces are the biggest consumer of processed foods and approximately 13 thousand tonnes of processed food is used annually. They have to subsist mainly on pack rations during operational situations. With the advancements in technological methods, Defence Food Research Laboratory (DFRL), Mysore, has contributed significantly to develop suitable technologies for preserving traditional Indian foods in light weight flexible packages so that pack rations could be designed based on such items to meet the nutritional requirements of the Defence personnel for operational situations and this has also paved the way for providing variety of foods suiting to their taste. These efforts led to the development of convenience foods based on cereals, pulses, fruits and vegetables with a long shelf-life in flexible packs. 1 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Fruit and vegetable technologies The Indian Army operates on hazardous terrain inclusive of Siachen Glacier and the sandy deserts of Rajasthan. Similarly, the Indian Navy is a blue water navy and the operations go deeper in the oceans to protect the maritime zones used for international shipping. The concept of fruit and vegetable storage as such has undergone a change and the troops favors precut fruits and vegetables in packaged form on operational rations due to the logistic utility and convenience. Therefore, minimal processing of precut fruits and vegetables needs to be emphasized and the unit packages can be formulated as per the ration scales and logistic requirements. The futuristic technologies encompass non-thermal processing i.e. high pressure processing and pulsed electric field applications. Eco-friendly and energy saving technologies are envisaged to occupy their rightful place in the area of fruit and vegetable products. Use of biodegradable packaging for fresh and processed fruits and vegetables is a certainty and an absolute necessity. It is a common site to notice heavy accumulation of wastage and spent packaging material even in partially inhabitated areas including the high altitude locations. Use of biodegradable plastics and other materials of organic or inorganic origin need to be stressed upon to minimize the pollution hazards in the army locations as well as the high seas of naval operations. Minimal processing of fruits and vegetables Supply of fruits and vegetables in precut and packaged form is a challenging task as the precutting operations impose severe physiological stress on the commodity. Minimal processing of fruits and vegetables had been contemplated as a вЂ�bridge technologyвЂ™, touching technologies concerned with post harvest handling of fresh produce on one side and conventional process technologies on the other side. It is well accepted notion that minimally processed products can be defined as вЂ�lightly processedвЂ™ products. This does not describe either the living or non living nature of the plant tissue. In other words, it enlarges the horizons of minimally processed products giving scope for use of minute thermal treatments and also application of anti-metabolic substances. As such the emphasis is on вЂ�fresh likeвЂ™ sensory attributes of the products and any minimal process strategy shall keep the same as the main objective. Microbiological aspects Minimally processed fruits and vegetables encounter incidence of enhanced microbial attacks due to the elimination of natural barriers of the plant tissue and enhanced accessibility to moisture and nutrition on the surface of the plant tissue. A number of contaminating microorganism including spoilage organisms and pathogens were isolated from precut fruits and vegetables. The minimally processed products were successfully subjected to field trials in different Naval commands and the field trials on zero energy cooling devices were successfully completed in the forward locations of desert areas in Rajasthan. Freezing of fruits and vegetables in whole or precut form is a major problem during peak winters in high altitude locations such as Ladakh sector. Antifreeze containers with the rated capacities of 30 and 80 kg were field evaluated in Ladakh sector and the feed back was highly encouraging for the induction of the same in Armed Forces. As such, the time is ripe for consideration of supply of precut fruits and vegetables to Armed Forces in packaged form and the strategies of the transport and storage are encompassed to make the supply chain flexible enough to be accommodated in the existing infrastructure prevailing in the areas of army deployment. Ultra high pressure processing The search for newer methods of food processing aims at processing of food without resorting to thermal processing. The concept of high pressure processing had emerged from the depth of the oceans as the sea beds are devoid of the usual microorganisms that one can find at sea level. Only a few microorganisms can survive under high pressure conditions and the lethality grows manifold from 500 MPa onwards. Ultra high pressure processing is an innovative technological concept under the category of non thermal processing with minimal or no heat treatment. It is a process 2 Novel and Emerging Food Technologies for Defence Food Supplies aimed at controlling growth of microbial populations and also inactivation of quality deteriorating enzymes. High pressure processing involves instantaneous and uniform transmission of the pressure throughout the product independent on the product volume. Upon reaching the desired pressure level, the pressure can be maintained without further inputs of energy. Liquid foods such as fruit juices can be subjected to high pressure processing holding the required pressure for specific duration and decompressing for further aseptic filling as per the standard procedures of aseptic packaging. Apart from these aspects, high pressure processing can also be used for pressure shift freezing, high pressure thawing, texture modifications and enhancement of nutritive value of foods. High pressures result in the physical confirmation of biological entities such as proteins, resulting in positive changes in the bio-accessibility of nutrients. Infrared processing of cereals and pulses The infrared processing is also known as вЂ�micronising processes and is widely used for cooking cereals, oil seeds, pulses and also for the processing of cocoa. Micronisation is used for the development of different types of consumer foods, animal feeds inclusive of pet foods and several brewed products. It is one of the most flexible and efficient means of processing for the development of value added products. Infrared radiation has wavelengths between 0.7 and 500 Вµm. Radiation with wavelengths just below 0.7 Вµm consists visible light, whereas radiation with wavelengths just above 500 Вµm is microwave radiation. Infrared radiation with shorter wavelengths transmits more thermal energy to foods in shallow-bed radiators designed for in-depth processing. Such radiators are equipped with glass-encapsulated heaters operating at about 3,000 kW. Microniser consists of a long flat moving belt of approximately 5 meters in length onto which cereals (wheat, ragi, barley, soy, etc.) are fed at one end. Above the belt and along its length are suspended gas burners which emit infrared energy on the grains which is carried through the machine by the belt. Infrared energy is absorbed by the moist grains, causing expansion of starch gelatinization. Extent of gelatinization depends upon magnitude of infrared heat and the time the material takes to travel from one end to the other. The expanded grain upon processing is subjected to flaking, cooling and subsequent packaging. Infrared processing improves starch accessibility for easy digestion and the same could be attributed to opening up of crystalline starch structurally. Conventional cooking methods also improve the accessibility of starch for digestion but the process may result in nutrient losses besides being a long duration process. Micronization is highly reliable and consistent вЂњShort Time High Temperature ProcessвЂќ using humidity, temperature and mechanical pressure to achieve high levels of starch gelatinization and elimination of anti nutritional factors, without any significant loss in nutrient value. Infrared energy makes the starch soft and turgid, causing it to swell, fracture and gelatinize. Immediate rolling / flaking or secondary processing enhance the digestibility and nutritional value. The nutritive value or protein quality of a food / feed protein depends not only on its content of amino-acids but also their bio-availability. The products as such could be made ready-to-eat or instantized to suit the logistic requirement of defence forces. Retort processing technology Retort processing of foods in rigid, semi rigid and flexible packaging systems is the most acceptable form of food preservation. It represents a unique combination of product, process and package technologies with potential, functional, quality and economical benefits. The increasing consumer awareness and inhibition/dislike to accept other methods of food preservation such as use of chemical preservatives, irradiation etc. has offered a vast scope for retort processed foods. Although retort pouch processing of foods is similar to conventional canning, it has certain major advantages like (i) Consumes less energy for processing (ii) enhances the quality attributes and (iii) reduces the cost of transportation and storage. Retort processing is generally carried out for low acid foods with a pH more than 4.5 at a temperature of 121.1ВєC using moist heat. During heat treatment, undesirable spoilage as well as pathogenic 3 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance microorganisms is inactivated / killed and thereby the food products become commercially sterile. Thermal destruction of microorganisms is measured and monitored by time-temperature history, lethality and Fo-value. Despite distinct advantages, retort pouch processing of foods till recent years did not become popular in India as compared to countries like Japan mainly because of the high cost of processing equipment and non-availability of indigenous multi layer flexible packaging materials. DFRL, Mysore has been a pioneer in developing the retort processing technology indigenously in the country. Over the past two decades, research and development work has been carried out in developing multilayer flexible packaging materials as well as designing a simple low cost retort (semi-automatic and automatic) amenable to Indian food industry. Due to continuous efforts, DFRL has so far successfully transferred the retort pouch processing technology to 40 firms for commercial exploitation. Functional foods Functional food is a three way concept wherein the (i) agricultural or animal origin serves as raw material, (ii) specific ingredients components of the products exerting functionality and (iii) physiological effects with respect to human system. Hence the balanced view of the three factors, with specific ingredient action, imparts the needful strategic effect. Thus functional food is a recent strategic application in the food field and a driving force for the product development in this century. The functional foods viz. antioxidant rich herbal tea, squash, baked foods, anti-ulcerative fruit spread, low calorie squash for diabetics, fibre rich ash gourd juice, etc. are some of the recent developments made in the field. Appetisers are another class of functional foods which improve the appetite. The physiological mechanism in brief is stimulation of trignomial nerves to increase the secretion of digestive juices. On the other hand, the hormone leptin formed at hypothalmous in the brain for the appetite control increases at high altitude stay; thereby satiety setting is signaled and results in lack of appetite. DFRL has developed several appetisers for high altitudes which have proved its efficacy for the cause. In conclusion, the food technologies from the ancient to the advanced technologies adopted in the present, along with the emerging, promising technologies as well as the present day requirement of functional foods have been reviewed in brief. Based on the raw materials i.e., fruits, vegetables, cereals, nuts, medicinal but natural herbs as well as the food requirements of the Defence Forces along with the logistic convenience of longer shelf life, ease of transportation, DFRL has developed more than 100 processed foods with varied technologies adopted. Packed rations with ready-to-eat products, emergency rations with calorie dense products, logistic based foods with functionality, energy dense food bars, functional food bars for low intensity conflicts, convenient processing machine such as automatic chapathi making machine, automatic coconut processing system, on-line continuous blancher for vegetables, soy paneer making plant, etc. are the important contributions of DFRL for Defence Forces, besides the need based techniques and quick test kits for meat and processed foods which are adopted by them. 4 An Overview of Designer Functional and Health Foods An Overview of Designer Functional and Health Foods Prof. A. K. Srivastava Director & Vice-Chancellor National Dairy Research Institute, Karnal Introduction Designer foods can be defined as вЂњfoods that are tailor-made to meet any specific requirement in terms of functionality, nutrition, convenience and therapeutic aspectsвЂќ. They are prepared by manipulating the formulations or engineered genetically or by other conventional means to provide the desired function. In last decades a lot of emphasis is given to designer foods mainly developed to deliver the nutritional and Functional foods and nutraceuticals provide a means to reduce the increasing cost on the health care system by a continuous preventive mechanism. The interest in functional foods has started in early 1990s, becoming one of the fast growing sectors of global food industry. Epidemiological studies and randomized clinical trials carried out in different parts of the world have been demonstrated or at least suggested numerous health effects related to functional food consumption, such as reduction of cancer risk, improvement of heart health, enhancement of immune functions, lowering of menopause symptoms, improvement of gastrointestinal health, antiinflammatory effects, reduction of blood pressure, antibacterial & antiviral activities, reduction of osteoporosis etc. Foods for improved gastrointestinal health Gastrointestinal (GI) organ system in human body is an important link between the food and resultant health benefit. GI tract is known to harbor more than 70% of our immune system. The delicate balance between the intestinal microflora and the host organism is very critical and any disturbance may lead to acute gastro enterititis and more chronic disorders like inflammatory bowel syndrome (IBD), peptic ulcer, colon cancer etc. Many factors influence the gut microflora including medication, age, stress, life-style and above all diet. Hence, dietary management strategies that helps in maintaining or even improving the normal GI microflora need to be prioritized. Probiotics are the well-known means to target the GI microbes with proven disease preventing/curing attributes. Viable probiotic bacteria such as Lactobacilli and Bifidobacteria can survive in sufficient numbers to assist the GI tract to become metabolically active. Their therapeutic effects have been confirmed in clinical trials and they have been utilized effectively in formulation of certain functional and nutritional foods. Probiotics primarily targets immune system through exerting anti-microbial activity, enhancing the proliferation of immune-defense cells, regulating certain metabolic enzymes and inhibiting the degenerative processes. The exact mechanisms related to beneficial effects of probiotics vary with target group and microorganisms. The food products which assist in improving the GI health are also termed as вЂњcolonic foodsвЂќ and include probiotics, prebiotics and synbiotics. Requirement of colonic mucosa for multitude nutrients including Short chain fatty acids (SCFA), vitamins, amino-acids, poly amines, growth factors and antioxidants is met from the beneficial microflora. Colonic foods meet the typical nutritional demand of mucosal cells. The probiotic bacteria partly synthesize them using wide variety of raw material while utilizing them as food such as prebiotics. Complex carbohydrates including dietary fibers, resistant starch and oligosaccharides not only contribute as prebiotic, but also perform certain physiological functions that are beneficial like relieve form constipation, inhibit cholesterol absorption and increase the micronutrient bioavailability. Oligosaccharides, a common constituent of plant and animal cellular constituents have been recognized with number of health attributes and termed as вЂњNew age fiberвЂќ. Moreover, dietary fibers, resistant starch and oligosaccharides, also exhibit novel functionalities like water binding; gelation and emulsification that can be utilized for the development of low fat variants of probiotic products. 5 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Functional foods for infant and weaning purpose India is among the nations with higher incidence of child malnutrition and deficiency diseases. According to an estimate more than 50% of children are born with low birth weight resulting in stunted growth. Lack of key nutrients and bio-protective components in infancy led to prevalence of anaemia and infectious disease among children. MotherвЂ™s milk is considered as perfect food of nature but in many incidences maternal nursing is not possible and new born has to feed with infant formula. Infant formula is the best example of designer foods. Normal infant formulas are manufactured from cowвЂ™s milk, but this requires substantial alteration to parallel the composition of breast milk. These modifications include reduction in protein and minerals, an increase in carbohydrates and the addition of vitamins and trace elements. In recent years, studies have indicated that infants may have an impaired ability of synthesizing taurine and carnitine, and a dietary source is therefore required. Carnitine is necessary for the transportation of long chain fatty acids into cell for the ОІ-oxidation and energy production. Fatty acid profile of different fat sources do not meet the complexity of mature breast milk, therefore mixture of different fat sources is preferred. Most manufacturers use a mixture of vegetable oils (Simmer, 2000). The fat source must also provide the essential fatty acids linoleic (C18:2, П‰-6) and О±-linolenic acid (C18:3, П‰-3). A ratio of 5:1 of П‰-6:П‰-3, as occurs in breast milk, is being suggested. Short chain as well as medium chain fatty acids should also be present in sufficient quantities as they are easy to absorb and assimilate. However there is a need for more short-and long-term studies before the optimum ratio and its effects on growth are evaluated. Linoleic acid and О±-linolenic acid are the precursors of the very-long-chain (C20 - C22), polyunsaturated fatty acids (LCPUFA): Arachidonic and docosahexaenoic acid (DHA). LCPUFA are involved in the neural and vascular development of the fetus and neonates and are present in human milk. Nucleotides, a component of non-protein nitrogen in human milk, may be important for normal immune function. Supplementation of infant formula with nucleotides seems to be beneficial in clinical trials, although further research is needed before routine nucleotide supplementation of infant formula can be considered. The success of commercially prepared infant formulas has stimulated the development of numerous formulations and several hundred varieties of proprietary infant formulas are now available throughout the world. In addition, special formulas for use in clinical situations or for premature infants or for infants with special inborn errors of metabolism are available as special dietary foods. The GI tract of infant is dominated by Bifidobacteria which provides health promoting and protective properties such as activation of immune system, inhibition of pathogens by the secretion of substances which are directly inhibitory towards several bacteria, lowering of pH by the production of acids such as acetate and lactic acid, leading to an antibacterial environment, production of digestive enzymes such as casein phosphatase and lysozyme and production of vitamins. For these reasons it seems desirable to also increase the numbers of Bifidobacteria in the intestinal flora of formula-fed infants. Administration of prebiotic oligosaccharides and probiotic supplements appear to be the most effective way to increase the number of the Bifidobacteria in the intestine. Human milk oligosaccharides are mainly responsible for Bifidogenic effects of breast milk. Several commercial formulations have been developed with the view of providing a predominance of Bifidobacteria in the intestinal flora formula-fed infants. However the inclusion of such unconventional ingredients in formulation of infant formula needs long-term investigations before being approved. Inadequate nutrition during first 2-3 years often leads to problems associated with malnutrition in several developing nations in the world. Complementary nutrition is must for the normal and healthy growth of a child after the age of 6 months, owing to increased requirement of nutrition in addition to those provided by breast milk. Moreover the food preparations consumed as weaning foods do not contain adequate nutrients desired for children. Traditional infant-feeding practiced, in countries like India, is usually cereal based. For the preparation of such foods grains are often germinated, 6 An Overview of Designer Functional and Health Foods fermented, processed and cooked in various ways to improve digestibility, and mixed with oilseeds or animal products to enhance their nutritional profile, however most of these complementary foods are reported to be less energy dense and less safer for children because of the higher proportion of antinutrients. Cereals in combination with milk solids are generally used for the preparation of weaning foods. Milk-Cereal-millet based complementary foods appear to be unique in the sense that they can deliver multitude of nutrients to children and complement each other as well. The correct form of incorporation, effective concentration and required technological inputs determine the effectiveness of the resulted complementary food. Such products could be an attractive option for mass children feeding programmes. Specialized foods with plant bioactive Nutritional significance of plant molecules is well documented and increasing cases of cancers, coronary heart diseases, diabetes and many other chronic diseases, have been attributed to under consumption of fruits and vegetables in our diet. But beyond these known nutrients i.e. vitamins, fibers, plants have clearly more to offer and scientists are scurrying to discover exactly which plant components might fend off specific diseases. An ever-expanding array of previously unknown plant molecules with hard to pronounce names are being uncovered. But there exact metabolic role and how these can be utilized in designer food, need to be clarified. The number of identified physiologically has increased dramatically in the last decades and overwhelming evidence from epidemiological, in vivo, in vitro and clinical trial indicate that plant rich diet can reduce the risk of certain chronic diseases (Hasler, 2000) Health professionals are gradually recognizing the role of phytochemicals in health improvement. The major mechanism associated with therapeutic aspects of plant bioactive is their ability to act as antioxidants. There are certain other compounds present in plant foods, with significant health promoting effect include plant fatty acids, tocotrienols, phenolic derivatives and dietary fibers etc. Docosahexaenoic acid (DHA), which is one of the most important structural component of brain and retina, and de-novo synthesis of this compound, is very rare. The decline in DHA intake could have serious implications for public health, since low plasma, DHA concentrations have been correlated with increased incidence of number of important chronic diseases such as depression, attention deficit disorders and AlzheimerвЂ™s dementia. Crypthecodinium cohmii strain of marine algae is used for the commercial production of DHA rich oil. Spirulina, termed as wonder alga is one of riches source of omeg-3-fatty acids, quality protein and many other therapeutic molecules. Plant polyphenols are secondary metabolites widely distributed in higher plants. Polyphenols historically have been considered as anti-nutrients by nutritionists, because some, eg. tannins have such adverse effects as decreasing the activities of digestive enzymes, energy, protein and amino acid availabilities, mineral uptake and having other toxic effects. Recognition of the antioxidant activities of many polyphenols has realigned thinking toward the health benefits provided by many of these compounds. Phytoestrogens are a broad group of plant-derived compounds that are structural mimics of endogenous 17 beta-estradiol. Two major phytoestrogens, which are of great importance from nutritional and health perspectives, include lignans (Flaxseed) and isoflavones (soy bean). These compounds either compete with or antagonize estrdiol action. Exact biochemical mechanism involving CYP3A monoxygenase activity in presence of phase I enzyme inducers such as dixamethane. Phytosterols are another important terpene subclass. Two sterol molecules that are synthesized by plants are ОІ - sitosterol and its glycoside. In animals, these two molecules exhibit anti-inflammatory, anti-neoplastic, anti-pyretic and immune-modulating activity. In the body, phytosterols can compete with cholesterol in the intestine for uptake, and aid in the elimination of cholesterol from the body. Saturated phytosterols appear to be more effective than unsaturated ones in decreasing cholesterol concentrations in the body. Certain designer foods like phytosterol containing yoghurt, ОІ-glucan rich dairy drink, DHA containing infant foods etc. have already reach to the stage of commercialization. 7 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Milk proteins and peptides based nutraceuticals Dietary proteins possess nutritional, functional and biological properties, and the technological processes used in food manufacture and processing often affect these properties. The role of proteins as physiologically active components in the diet has been increasingly acknowledged in recent years. Such proteins or their precursors may occur naturally in raw food materials, exerting their physiological action directly or upon enzymatic hydrolysis in vitro or in vivo. Several dietary proteins, can act as a source of biologically active peptides. These peptides inactive within remain the parent protein, and released during gastrointestinal digestion or food processing. Once liberated, the bioactive peptides may provide different functions in vitro or in vivo. Bioactive peptides have to be released from the parent protein by enzymatic hydrolysis. This can be achieved by the use of isolated enzymes, as well by microbial fermentation. Biologically active peptides are of particular interest for pharma industry because they have been shown to play different physiological roles, including opioid like activity, antimicrobial, immunomodulatory and antihypertensive. Such peptides can be released during hydrolysis by digestive or microbial enzymes. Microbial enzymes from lactic acid bacteria have demonstrated to be able to liberate theses peptides from milk proteins, in various fermented milk products. Upon oral administration bioactive peptides may affect the major body systems- namely the cardiovascular, digestive, immune and nervous systems. For this reason, the potential of certain peptides sequences to reduce the risk of chronic diseases or boost natural immune protection has aroused a lot of scientific interest over the past few years. These beneficial health effects may be attributed to known peptide sequences exhibiting, e.g., antimicrobial, antioxidative, antithrombotic, antihypertensive and immunomodulatory activities. Milk proteins are considered the most important source of bioactive peptides and an increasing number of bioactive peptides have been identified in milk protein hydrolysates and fermented dairy products. Over the last few years a number of investigations have been carried out across the world to elucidate the bioactivity of milk proteins and derivatives. These components may be either serve as functional ingredients in development of functional foods or can be utilized by pharma industry as nutraceuticals. Most of the claimed physiological properties of milk proteins and derivatives have been carried out in in-vitro or animal models, these hypothesized properties remains to be proven in humans. Whey proteins are becoming an important constituent in the recipe of wide range of functional and health foods because of the unique amino acid composition and bioactivity. Whey proteins based commercially available food products include sports supplements, low fat dairy desserts, medical foods, infant formulations and geriatric foods. Antihypertensive bioactive peptides may be utilized in development of mood drinks and also foods for cardiac patients. Other prospective designer foods Beverages are another range of products that offer tremendous market potential for Indian food industry because of being nutritionally-rich. Similarly, minor cereals and millets based milk beverages seem to be lucrative products for school feeding programmes. Liquid milk fortification with vitamins A and/D is mandatory in several countries. However, the milk fortification usually impaired its sensory and processing quality characteristics. Moreover, bio-availability of fortified nutrients is another major concern. Investigations carried out at NDRI suggest possibilities of fortification of liquid milk with calcium and iron. Beverages and soups based on whey continue to receive a considerable amount of attention nowadays. These indicate the growing awareness among consumers and manufacturers alike for the enormous potential these offered for diversifying product profile. Other designer foods include low calories/low fat variants, low sodium foods and fun foods etc. Conclusion Consumer interest in the relationship between diet and health has increased the demand for information on functional foods. Rapid advances in science and technology, increasing healthcare 8 An Overview of Designer Functional and Health Foods costs, changes in food laws affecting label and product claims, an aging population, and rising interest in attaining wellness through diet are among the factors fueling interest in functional foods. Credible scientific research indicates many potential health benefits from milk components. References Finley, J.W. 2005. Proposed criteria for assessing the efficacy of cancer reduction by plant foods enriched in carotenoids, glucosinolates, polyphenols and selenocompounds. Annals of Botany, 95:1075-1096 pp. Hasler, C.M. 1998. Functional Foods: Their role in disease prevention and health promotion. Food Technology 52(11), 63-70 pp Hasler, C.M. 2000. The changing face of functional foods. Journal of American College of Nutrition 19 (5), 499S-506S pp. Hirayama, M. 2002. Novel physiological functions of oligosaccharides. Pure Appl. Chem. 74 (7) 1271-1279 pp Shah, N. P. 2000. Probiotic Bacteria: Slective Enumeration and survival in dairy foods. J. Dairy Science, 88:894-907 Simmer, K. 2000 a. Long-chain polyunsaturated fatty acid supplementation in preterm infants. Cochrane Database Syst. Rev., -HD-(2): CD 000375 2000. Wollowski, I. 2001. Protective role of probiotics and prebiotics in colon cancer. Am. J. Clin. Nutrition: 73 (Suppl):451S-5S 9 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Prospects of Value Addition Through Functional Ingredients G. R. Patil Dairy Technology Division, NDRI, Karnal Introduction: In recent years, there has been a vast and rapidly growing body of scientific data showing that diet plays an important part in diseases. Diet is thought to contribute to six of the 10 leading causes of death. Nutrients and nonnutritive food components have been associated with the prevention and/ or treatment of chronic diseases such as cancer, coronary heart disease, diabetes, hypertension, and osteoporosis. Up to 70% of certain cancers may be attributed to diet. As the data supporting the role of diet in health promotion and disease prevention continue to mount, it is likely that the quantity of enhanced foods will expand substantially. There is an increasing demand by consumers for quality of life, which is fueling the functional foods revolution. Functional foods are viewed as one option available for seeking cost-effective health care and improved health status. Moreover, the large babyboomer segment of the population is aging and considerable health care budget in most country is focused on treatment rather than prevention. Thus, the use of nutraceuticals in daily diets can be seen as means to reduce escalating health care costs that will contribute not only to a longer lifespan, but also more importantly, to a longer health span. Development of functional food products will continue to grow throughout the 21st century as consumer demand for healthful products grows. The exploding area of functional foods and probiotics shows considerable promise to expand the industry into new arenas. Both convenience and better for you attitudes are selling. Consumers clearly believe in the concept of functional nutrition, or specific association between foods/nutrients and health functions. They are interested in foods that boost the immure system, reduce the risk of disease and enhance health, which consumers self-prescribe for themselves and their families. Hence, there are clear opportunities to offer consumers dietary alternatives to medical solutions. These opportunities, however, will be highly consumer driven and success will ultimately be dependent upon defining your segment and knowing your target group. The markets of traditional dairy products are increasingly getting overcrowded and our future success will depend on our ability to provide innovative products, which consumers want and need. Whatever the innovation - products, processing method or packaging - it should meet the real consumer need. We know todayвЂ™s families want вЂњgrab-and-goвЂќ convenience. They are also concerned about nutrition and health. Different ages and demographics want different things. Therefore, investment at this level is essential if we are to respond rapidly to customers who are increasingly demanding new and different taste experiences from products that are also competitively priced. Thanks to advancements in technology, researchers have shown that specific components of milk, as well as ingredients can be readily added to dairy products, which contribute to health and wellness, and assist consumers with feeling balanced and satisfied. There is a golden opportunity for dairy marketers to formulate innovative products to meet consumersвЂ™ needs and to effectively market the productвЂ™s value. New variants of sweets can be developed. Dairy products containing health-promoting ingredients may be developed and promoted. Host of ingredients with health benefits are available for value addition of dairy products. Some of these issues are discussed hereunder. Functional ingredients for value addition Functional nutrition is a broad topic, and covers many ingredient categories. The functional components used in formulation of these formulated foods are given in Table 1. 10 Prospects of Value Addition Through Functional Ingredients Table 1: Examples of Functional Ingredients* Class/ Ingredients Source* Potential Benefit Carotenoids Beta-carotene carrots, various fruits neutralizes free radicals which may damage cells; bolsters cellular antioxidant defenses Lutein, Zeaxanthin kale, collards, spinach, corn, eggs, citrus may contribute to maintenance of healthy vision Lycopene tomatoes and processed tomato products may contribute to maintenance of prostate health Insoluble fiber wheat bran may contribute to maintenance of a healthy digestive tract Beta glucan oat bran, rolled oats, oat flour may reduce risk of coronary heart disease (CHD) Soluble fiber psyllium seed husk may reduce risk of CHD Whole grains cereal grains may reduce risk of CHD and cancer; may contribute to maintenance of healthy blood glucose levels Monounsaturated fatty acids (MUFAs) tree nuts may reduce risk of CHD Polyunsaturated fatty acids (PUFAs) - Omega-3 fatty acidsвЂ”ALA walnuts, flax may contribute to maintenance of mental and visual function PUFAs - Omega-3 fatty acidsвЂ”DHA/ EPA salmon, tuna, marine and other fish oils may reduce risk of CHD; may contribute to maintenance of mental and visual function PUFAs - Conjugated linoleic acid (CLA) beef and lamb; some cheese may contribute to maintenance of desirable body composition and healthy immune function Anthocyanidins berries, cherries, red grapes bolster cellular antioxidant defenses; may contribute to maintenance of brain function FlavanolsвЂ”Catechins, Epicatechins, Procyanidins tea, cocoa, chocolate, apples, grapes may contribute to maintenance of heart health Flavanones citrus foods neutralize free radicals which may damage cells; bolster cellular antioxidant defenses Flavonols onions, apples, tea, broccoli neutralize free radicals which may damage cells; bolster cellular antioxidant defenses Proanthocyanidins cranberries, cocoa, apples, strawberries, grapes, wine, peanuts, cinnamon may contribute to maintenance of urinary tract health and heart health Dietary (functional and total) Fiber Fatty Acids Flavonoids Isothiocyanates Sulforaphane cauliflower, broccoli, broccoli sprouts, may enhance detoxification of cabbage, kale, horseradish undesirable compounds and bolster cellular antioxidant defenses Phenols Caffeic acid, Ferulic acid apples, pears, citrus fruits, some vegetables may bolster cellular antioxidant defenses; may contribute to maintenance of healthy vision and heart health 11 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Class/ Ingredients Source* Potential Benefit Plant Stanols/Sterols Free Stanols/Sterols corn, soy, wheat, wood oils, fortified foods and beverages may reduce risk of CHD Stanol/Sterol esters fortified table spreads, stanol ester dietary supplements may reduce risk of CHD some chewing gums and other food applications may reduce risk of dental caries Polyols Sugar alcoholsвЂ”xylitol, sorbitol, mannitol, lactitol Prebiotic/Probiotics Inulin, Fructo-oligosaccharides (FOS), Polydextrose whole grains, onions, some fruits, garlic, honey, leeks, fortified foods and beverages may improve gastrointestinal health; may improve calcium absorption Lactobacilli, Bifidobacteria yogurt, other dairy and non-dairy applications may improve gastrointestinal health and systemic immunity IsoflavonesвЂ”Daidzein, Genistein soybeans and soy-based foods may contribute to maintenance of bone health, healthy brain and immune function; for women, maintenance of menopausal health Lignans flax, rye, some vegetables may contribute to maintenance of heart health and healthy immune function soybeans and soy-based foods may reduce risk of CHD Diallyl sulfide, Allyl methyl trisulfide garlic, onions, leeks, scallions may enhance detoxification of undesirable compounds; may contribute to maintenance of heart health and healthy immune function Dithiolthiones cruciferous vegetables contribute to maintenance of healthy immune function Phytoestrogens Soy Protein Soy Protein Sulfides/Thiols Source: IIFC (2004) Examples are not an all-inclusive list. Several functional dairy products can be developed using either single or combination of ingredients given in the table targeting specific health benefits. Besides these functional ingredients, which are mostly obtained from plant source, there are other ingredients such as fat replacers, artificial sweeteners, micronutrients like vitamins and minerals, which can be used for value addition. 3.0 What are the possibilities? Innovative milk beverages: Recently, a whole new generation of beverages containing milk and dairy ingredient are emerging. Thanks to new technologies, including processes and ingredients, such dairy based beverages not only offer a wider range of flavour, texture and other sensory properties than are current present but also provides new marketing opportunities for these products in the healthy/ neutraceutical/ bioactive foods category foods todayвЂ™s consumerвЂ™s want. Some of the ingredients highlighted above, along with other ingredients that are currently used or can be used for development of such beverages. Dairy manufacturers can develop a signature formula to appeal to specific market segments. Select European countries use whey as a base for nutritional, fruity dairy-based beverages. A refreshing beverage made from fermented milk and whey and containing fruit juice, or a probiotic beverage from whey and fruit juice that is fortified with vitamins and calcium are being marketed in these countries. NDRI has also recently developed formulations from whey such as whey-jaljeera beverage, whey-bael beverage, and whey вЂ“mango beverage, which are available for commercial exploitation. 12 Prospects of Value Addition Through Functional Ingredients Probiotic dairy products: вЂњProbiotic, food products in generals and вЂњprobiotic вЂњ organism in particular are in the center of current R & D activities all over the world. вЂњFunctional foodsвЂќ segment that is registering a steady and consistent growth at present, among processed food products, gathered the momentum primarily from the scientific investigations based on вЂњprobioticвЂќ food products. A probiotic is a mono-or mixed culture of live microorganisms which benefits man or animals by improving the properties of the indigenous microflora. Viable counts delivered to the gastrointestinal tract are key to the functionality of probiotics. The consumption of probiotic culture positively affect the composition of this microflora or extends a range of host benefits including. 1. Pathogen interference, exclusion and antagonism. 2. Immunostimulation and immunomodulation. 3. Anticarcinogenic or antimutagenic activities. 4. Alleviation of symptoms of lactose intolerance. 5. Reductiion in serum cholesterols. 6. Reduction in blood pressures. 7. Decreased incidence & duration of diarrhoea. 8. Prevention of vaginitis. 9. Maintenance of mucosal integrity. Industrial interest in developing probiotics and probiotic functional foods is thriving, driven largely by the market potential for foods that target general health or well being. NDRI has made some progress in this area by developing probiotic dahi, lassi and probiotic cheese. There is possibility of developing other milk based fermented traditional dairy products such as probiotic shrikand and Rabadi вЂ“ a milk-cereal based fermented product. Fat-replacement in dairy products: High fat consumption has been linked to several chronic diseases including cardiovascular diseases, obesity and certain forms of cancer. Nutrition experts recommend a total fat intake of less than 30 per cent of total daily calories. These dietary recommendations are one reason for the increasing demand for lower fat food products of the world market has been flooded with the food products carrying the labels вЂњlow fatвЂќ, вЂ�no fatвЂ™ or вЂ�reduced fatвЂ™. Fat mimics or fat substitutes are normally used to produce low-fat foods, fat mimics are substances that help replace the mouthfeel of fat but can not substitute for fat on a gram for gram basis and can not be used for applications involving frying. Substances whose physical or thermal properties resemble fat are termed as fat substitutes and can replace fat on a gram-for gram basis and can also be used for frying applications. Categories of fat replacers Fat mimics Protein based Fat replacers Carbohydrate based - whey protein conc. - Microparticulated protein - Starches - Maltodextrins - Polydextrose -Emulsifiers -Medium chain triacylglycerols. -Structural lipids. -Acaloric synthetic compounds. * fatty alcohol esters of alkyl malonic or malonic acid. * esterified propoxylated glycerols * trialkoxy tricarballylate * poly carboxylic acid. * Sucrose polyesters Low-fat cheese, processed cheese, cultured products, frozen desserts, butters and spreads have been successfully developed using commercially available fat mimics/replacers. Using similar technique several low fat varieties of traditional dairy products can be developed. An attempt has been made to develop low fat burfi at this institute. 13 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Dairy products for providing satiety: There are a few dairy products currently in the marketplace, which claim to provide satiety. This is an opportunity dairy product manufacturers need to tap into, too. Satiety is the state of being full or gratified to the point of satisfaction. Scientific studies indicate that satiety is dependant on not only how much food you eat, but what type of food you eat as well. Satiety is being addressed on food labels with synonymous terms such as вЂњheartyвЂќ and вЂњcontrols or reduces hunger.вЂќ Unabsorbed nutrients in the ileum, which is the final section of the small intestine, inhibit gastric emptying, providing a sense of satiety. Fat, in particular, penetrates the ileum when a person has eaten too much for the body to process. When this happens the ileum triggers a вЂњfullвЂќ message to the brain. That full message is the result of the secretion of cholecystokinin (CCK), a peptide hormone of the gastrointestinal system responsible for stimulating the digestion of fat and protein. It is secreted by the duodenum, the first segment of the small intestine, and causes the release of digestive enzymes and bile from the pancreas and gall bladder, respectively. A satiety ingredient concept is available to dairy foods manufacturers. A patented combination of oat and palm oils has been formulated into a novel emulsion with the oat oil extract containing a large quantity of polar lipids that coat the palm oil droplets. This coating prevents digestion of the palm oil in the stomach until it reaches the ileum. Fiber ingredient suppliers, too, are touting some of their products for satiety value. For example, research shows consumers on diets supplemented with inulin and oligofructose report higher levels of satiety, longer feelings of fullness and lower calorie intake, which can all assist with weight loss. Research also shows that foods high in fiber and protein slow digestion and extend the release of CCK. With knowledge of this relationship between fiber, protein and satiety, several convenient, nutritious and delicious products can be created for obese people, which can help them feel full and thus prevent unhealthful snacking between meals. A heart-healthy opportunity With the functional food market abuzz about the heart-health benefits of plant sterols, dairy foods formulators have excellent opportunity to develop variety of dairy products with heart healthy benefit. Plant sterols can help lower serum low-density lipoprotein (LDL)вЂ”or badвЂ”cholesterol levels, which are well recognized as impacting heart disease risk. Eating foods low in saturated fat and cholesterol and high in sterols can reduce LDL cholesterol by 20%. Plant sterols provide an effective, dietary method for countering elevated cholesterol, a crisis facing millions of Indians. Plant sterols are relatively easy to formulate into existing dairy applications, and sterols are available in different forms to aid in the ease of processing. Likewise, plant sterols can be used in virtually any dairy application. If included in the amounts specified for health claim, plant sterols also enhance a finished dairy productвЂ™s nutritional profile without altering its flavor or texture. The qualified claim states that foods containing at least 0.4g per serving of plant sterols, eaten twice a day with meals for a daily total intake of at least 0.8g, as part of a diet low in saturated fat and cholesterol, may reduce the risk of heart disease. Arjuna Ghee: Arjuna ghee, with functionalities like resistance against heart diseases and blood pressure regulating properties was developed at this institute. The developed ghee was found sensorily similar to the market ghee. It had overall acceptability score of 85.1 compared to the control (90.84). The Arjuna ghee was found to be 4 times more stable to oxidative deterioration as compared to control ghee. This is due to the fact that Arjuna extract contains several antioxidants like polyphenols, terpenoids in addition to phytosterol, which are beneficial in case of Cardio-vascular Diseases (CVD), high blood pressure and to boost up our immune system. Dietetic dairy products The dairy industry has responded to the growing needs of health conscious consumers for lowcalorie foods. Consequently, a large number of dairy products made with low-calorie and nonnutritive 14 Prospects of Value Addition Through Functional Ingredients sweeteners have been witnessed in the market. Low calorie sweeteners have become sugar alternatives to replace sucrose in a wide variety of dairy products. Kumar (2000) developed a low calorie lassi by using aspartame and reported that aspartame at a level of 0.08% was required to replace 15% of cane sugar in lassi. The technology for the production of rasogolla, the most popular channa based Indian sweetmeat, was developed by Jayaprakash (2003) using sorbitol (40%) and aspartame (0.08%). Chetana, et al. (2004) developed gulabjamun, a popular khoa based sweet, using sorbitol. Burfi, another khoa based sweet delicacy was developed by completely replacing sugar using acesulfame-K (Yarrakula, 2006), aspartame (Muralidhar, 2006), saccharin (Narendra, 2006), sucralose (Singh, 2006), and sucralose and bulking agents (Prabha, 2006). Kalakand and flavored milk were developed using acesulfame-K (Yarrakula, 2006), aspartame (Muralidhar, 2006), saccharin (Narendra, 2006), and sucralose (Singh, 2006). The Indian counterpart for ice cream, kulfi was developed by Pandit (2004) using sorbitol (5.5%), maltodextrin (4.26%) and aspartame (742 ppm). Dairy products fortified with dietary fiber Milk and most dairy products are devoid of dietary fiber. With the growing interest in dietary fiber and its health benefits, dairy industry has geared up for fortifying the dairy products with fiber. Yogurt is one of the dairy products whose sales continues to increase due to diversification in the range of yogurt-like products including reduced fat content yogurts, yogurt shakes, drinkable yogurts, yogurt mousse, yogurt ice cream, etc. (Fiszman and Salvador, 1999). In India, there are few traditional dairy products that contain significant quantities of fiber e.g., Gajar-pak (carrot halwa), Giya-ka-halwa (bottle gourd halwa), Doda-burfi, and Kaju-burfi. Traditionally made cereals-based milk desserts like kheer and dalia-dessert are other dairy food sources of dietary fiber in Indian diets (Patel and Arora, 2005). Recently, dahi (Chandrakant, 2002), lassi and other dairy products have been fortified with fruits and commercial dietary fibers to give the benefits of dietary fiber. Kantha (2005) developed a low fat paneer using soy fiber and inulin and reported that milk with 2.5% fat and 0.56% soy fiber or 1.8% fat and 4.5% inulin yielded a paneer similar to that prepared from full cream milk (6% fat) in respect to sensory quality. Amul has launched a new variety of isabgolenriched ice cream. Isabgol is the seed derived from Plantago ovata. Being a вЂ�true dietary fibreвЂ™, the isabgol husk is considered to be a natural laxative that aids easy bowel movement. Besides it is also known to possess serum cholesterol reducing properties (Mann and Singh, 2005) Targeting a successful product launch In order to launch the product successfully in the market it is necessary to look in to following points: вЂў Identifying where the gaps are in a specific market--what the new/unmet consumer needs are. вЂў Developing product concepts and consumer value propositions to fill the gaps. вЂў Prper ingredient selection, formulating prototypes and evaluating product concepts at an inhouse pilot plant. Fundamentally the product needs to pass the taste test. If it does not taste good, it is not possible to get that repeat buy from consumer. Any product that has been developed by hitting a bullвЂ™s eye in each one of these areas (health and wellness, simplicity and taste) will certainly have a stronger chance for a successful product launch. What are the prospects for functional foods in india? Population growth, rising incomes, increasing awareness on health, urbanization, lifestyle changes (вЂњon-the-goвЂќ eating) and growing organized retailing are contributing to the potential for functional foods. Just as for processed foods in general, India will be the largest potential markets for functional foods with their GDP growth, demographics and burgeoning consumption. 15 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Thanks to the growing acceptance of functional foods, India could hope to leverage the countryвЂ™s key resources in this area to gain a foothold in the global market. Functional foods are among the New Age drugs that are being developed to provide better health. Functional foods are gaining public acceptance in many developed countries in recent times. Looking at the changing trends, the market of functional foods has huge potential. These days, industries are showing interest in the functional foods area. Within few years this potential can turn into a healthy growing market. The ingredients used in health/functional foods are mainly plant-based products and most of them being predominantly herbal. Hence clues to these functional ingredients could be got from our ancient and traditional systems of medicine like Ayurveda, Siddha and Unani. The вЂ�RasayanвЂ™ and вЂ�VajikarnaвЂ™ therapeutics of Ayurveda are essentially nutraceuticals and therefore there is ample scope for India to develop a range of health food products. And to succeed, these products have to be standardized and with scientific validation to ensure safety and efficacy so as to instill confidence in the customers to use them not as an alternative medicine but as a well defined system of medicine. For this to happen, there has to be research carried out on these products. Thus IndiaвЂ™s own traditional knowledge base gathered from Unani, Ayurveda and Siddha can help out in research work on nutraceuticals. And we can take a lead on this from the western world. What are the key challenges for functional foods in india? In India, we have traditional products touted as functional but have little scientific validation. Regulations will thus have to evolve to weigh R&D, ensure validation and prevent exploitation of consumers. Companies will also have to be sincere and honest in their claims while marketing and communicating with consumers till appropriate regulations for scientific validation are evolved. Processors will need to provide an optimal merger between taste, convenience and health attributes. References: Chandrakant, P.N. (2002) Development of Technology for Fruit Dahi. M. Tech Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Chetana, R., Manohar, B. and Reddy S.R. (2004) Process optimization of Gulab Jamun, an Indian traditional sweet, using sugar substitutes. Eur. Food Res. Technol. 209:386 вЂ“ 392 Fiszman, S.M. and Salvador, A. (1999) Effect of gelatine on the texture of yoghurt and of acid-heat-induced milk gels. Z. Lebensm. Unters. Forsch. 208: 100 вЂ“ 05. IIFC (2004) Background on functional foods. http://www.ific.org/nutrition/ functional/ upload/FuncFdsBackgrounder. pdf Jayaprakash, K.T. (2003) Technological Studies on the Manufacture of Rasogulla Using Artificial Sweeteners. M. Tech Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Kantha, K.L. (2005) Enhancement of Sensory and Functional Properties of Low-fat Paneer Using Dietary Fibre. M. Tech. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Kumar, M. (2000) Physico-chemical Characteristics of Low-Calorie Lassi and Flavoured Dairy Drink Using Fat Replacer and Artificial Sweetener. M. Tech Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Mann, R.S. and Singh, P.K. (2005) Specialty frozen products. In: lecture compendium of вЂњRecent Developments in Health Foods and NutraceuticalsвЂќ 18th Short Course organized by Centre of Advanced stuies in Dairy Technology, NDRI, Karnal, pp 127 вЂ“ 132. Muralidhar, G.H. (2006) Determination of Aspartame and its Stability in Indigenous Dairy Products. M.Sc. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Narendra, K. (2006) Estimation and Stability of Saccharin in Indigenous Dairy Products. M.Sc. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Pandit, P. (2004) Technological Studies on manufacture of Kulfi using Artificial Sweeteners. M. Tech. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Patel, A. A. and Arora, S.K. (2005) Fibre fortification of dairy products.Proceedings of the Seminar on Value Added Dairy Products held at NDRI, Karnal from Dec. 21 вЂ“ 22, 2005. Prabha, S. (2006) Development of Technology for the Manufacture of Dietetic Burfi. Ph. D. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Singh, V.P. (2006) Analysis of Sucralose and its Stability in Indigenous Dairy Products. M.Sc. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. Yarrakula, S. (2006) Analysis of Acesulfame-K and its Stability in Indigenous Dairy Products. M.Sc. Thesis submitted to National Dairy Research Institute, Deemed University, Karnal. 16 Technological and Nutritional Aspects of Milk Phospholipids Technological and Nutritional Aspects of Milk Phospholipids B. K. Wadhwa and Rajesh Kumar Dairy Chemistry Division, NDRI, Karnal Introduction Milk fat in the lactating cow is secreted as myriads of lipid droplets of size 0.1 to 15 Вµm. These micro lipid droplets are encircled by a special membrane composed of lipid bilayer and proteins. This membrane has been designated the milk fat/ lipid globule membrane (MFGM). Milk fat globule membrane is composed of proteins and lipids in a 1:1 weight ratio. Bovine MFGM is a potential nutraceutical. The health beneficial factors are contributed by both protein and non protein components of bovine MFGM. Among the health-beneficial components of the MFGM are cholesterolemia-lowering factor, inhibitors of cancer cell growth, vitamin binders, inhibitor of Helicobacter pylori, inhibitor of betaglucuronidase of the intestinal Escherichia coli, xanthine oxidase as a bactericidal agent, butyrophilin as a possible suppressor of multiple sclerosis, and phospholipids as agents against colon cancer, gastrointestinal pathogens, AlzheimerвЂ™s disease, depression, and stress (Spitsberg, 2005). Sources of phospholipids Until recently commercially available phospholipids were predominantly made from vegetable lecithin, the by-products of vegetable oil refining. Phospholipids of animal origin were extracted from egg yolk or from fish roe, but played less important role compared to the plant derived products, which mainly found applications as food additives.Bovine milk is a very new source for a commercial production of phospholipids as milk fat globule membrane Table 1: Phospholipid profile (%) phospholipids are very unique in terms of phospholipid of different raw materials composition and application profile (Schneider, 2007). Soya Egg Milk Marine Vegetable lecithin is a complex mixture of phospho- and glycolipids, some carbohydrates and optionally triglycerides. PC 23 73 27 82 Most animal lecithin does not contain glycolipids, nor PE 22 18 22 04 carbohydrates. Vegetable oilseeds are solvent extracted to PI 14 2 08 03 obtain the oil. Traces of phospholipids are co-extracted and PA 7 need to be removed during the refining process in order to PS Traces 12 01 improve the oil for clarity and stability reasons. This is done SPM 3 27 02 by the addition of small amounts of water; the phospholipids Glycolipids 12 07 start swelling which makes them insoluble in oil. Mechanical separation and drying of the so-called wet Table 2: Fatty acid profile (%) of phospholipids gums finally gives vegetable lecithin. To from different raw materials produce egg and/or milk phospholipids Soya Egg Milk Marine the process is much more sophisticated. Especially in the case of milk, it is a multi Saturated 22 41 50 17 step approach to separate them from the Mono-unsaturated 12 35 35 21 milk fat globule membrane - predominantly Poly-unsaturated 66 24 15 62 milk processing technology, followed by some solvent based steps. Concentrated or isolated phospholipids are made by solvent-based extraction or fractionation processes from lecithin, often followed by chromatographic purification steps. The qualitative and quantitative profile of phospholipids varies with the type of raw materials used (Table 1). Milk phospholipids contain sphingomyelin whereas soya phospholipids do not contain sphingomyelin (Schneider, 2007). Also, the fatty acid profile of phospholipids from different raw materials is variable (Table 2). Milk phospholipids are richer in saturated and MUFA but poorer in PUFA in comparison to soya phospholipids. 17 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Properties of phospholipids The molecular structure of phospholipids is bipolar and amphiphilic, means it combines a lipophilic part (the fatty acid tails linked to the glycerol backbone) and a hydrophilic part (the polar head group, a phosphoric acid ester mostly of an amino alcohol like choline, ethanolamine, etc.). Technological applications Their bipolar structure makes phospholipids excellent natural emulsifiers, widely used in foods, cosmetics and also pharmaceutical applications. The application properties of the food additive lecithin relates to a great extent to their phospholipid content and profile. The most prominent applications are for margarine, chocolate, baked products, instant powders, etc. The cosmetic industry appreciates their emulsifying, skin friendly and moisturising properties; pharmaceuticals use them as emulsifiers for intravenous fat emulsions, but also for complex drug delivery systems (Iiposome). Liposomes are versatile delivery systems, originally for pharmaceutical uses, but also widely used in cosmetics. Liposomes are tiny, artificial cell-like structures, surrounded by either one (unilamellar) or many phospholipid double layers. Inside the vesicular structure, or between the different phosВ¬pholipid membranes, water compartments are entrapped, carrying and protecting water-soluble actives. But also lipophilic payloads can be entrapped and protected from the environment inside the lipophilic domains of the phospholipid double layers. Nutritiona1 profile of phospholipids Besides their widely used technological properties, phospholipids have a very Interesting nutritiona1 profile. Lots of clinical studies have shown вЂў Cholesterol reducing properties ( soya phosphatidylcholine - PC) вЂў Improvement of cognitive performance - stress symptom (soya phosphatidylserlne - PS) вЂў Liver tissue detoxification and regeneration ( soya PC). вЂў Egg phospholipids are used to supplement infant formulae because of their content of long chain polyunsaturated fatty acids (docosahexaenoic and arachidonic acid DHA and ARA). Milk polar lipids Another biologically interesting lipid group in milk fat is the polar lipids, which are mainly located in the milk fat globule membrane (MFGM). It is a highly complex biological structure that surrounds the fat globulestabilizing it in the continuous aqueous phase of milk and preventing it from enzymatic degradation by lipases (Spitsberg, 2005 ). The membrane consists of about 60% proteins and 40% lipids that are mainly composed of triglycerides, cholesterol, phospholipids, and sphingolipids. The polar lipid content of raw milk is reported to range between 9.4 and 35.5 mg per 100 g of milk. The major phospholipid fractions are phosphatidylethanolamine and phosphatidylcholine followed by smaller amounts of phosphatidylserine and phosphatidylinositol. The major sphingolipid fraction is sphingomyelin with smaller portions of ceramides and gangliosides. In processing milk into different dairy products, the polar lipids are preferentially enriched in the aqueous phases like skimmed milk, buttermilk and butter serum. The polar lipids in milk are gaining increasing interest due to their nutritional and technological properties. These compounds are secondary messengers involved in transmembrane signal transduction and regulation, growth, proliferation, differentiation, and apoptosis of cells. They also play a role in neuronal signaling and are linked to age - related diseases, blood coagulation, immunity, and inflammatory responses. In particular, sphingolipids and their derivatives are considered highly bioactive components possessing anticancer, cholesterol - lowering, and antibacterial activities.These promising results from cell culture and animal - model studies warrant further confirmation and human clinical studies but suggest that sphingolipid - rich foods or supplements could be beneficial in the prevention of breast and colon cancers and bowel - related diseases (Korhonen, 2010). 18 Technological and Nutritional Aspects of Milk Phospholipids Properties of milk phospholipids Milk phospholipids are different from all other commercial lecithin and phospholipid products, both in phospholipid pattern and fatty acid profile (Tables 1 and 2). Both differences make them very attractive for a variety of new and innovative applications. Technological applications of milk phospholipids Because of the relatively high degree of saturated (50%) or mono-unsaturated fatty acids (approximately 35%) milk phospholipids are quite stable against oxidation and are вЂў Very Important for food applications вЂў Very stable against hydrolytic break-down in aqueous environments. вЂў Hence, the taste and flavour profile is not negatively affected by liberated free fatty acids (as with soya phospholipids which are richer in PUFA). вЂў Milk phospholipids are versatile ingredients for functional cosmetics. They are excellent emulsifiers, creating a very good and soft skin feel, avoid trans-epidermal water loss and allow preparing efficient Iiposomal systems with good entrapment stability.Milk phospholipids now have a clear advantage over all other phospholipids used so far for liposome production. вЂў They are relatively stable against oxidation вЂў They have a phase transition temperature of approximately 28В°C, ideal for a lot of cosmetic and food applications. вЂў (The phase transition temperature is the temperature at which the membrane undergoes transition from an organized fatty acid region (a kind of crystalline structure) to an unorganized one (a kind of liquid structure). вЂў At ambient temperature milk phospholipids liposome membranes are crystalline with excellent entrapment characteristics . At higher temperature they tend to release their payload вЂ“ a simple approach to protect sensitive ingredients and to release them at targeted conditions (Schneider, 2007). Preparation of liposomes from milk fat globule membrane phospholipids using a microfluidizer The isolation of MFGM material from buttermilk on a commercial scale has provided a new ingredient rich in phospholipids and sphingolipids. An MFGM-derived phospholipid fraction was used to produce liposomes via a high-pressure homogenizer (Microfluidizer). This technique does not require the use of solvents or detergents, and is suitable for use in the food industry. The liposome dispersion had an average hydrodynamic diameter of 95 nm, with a broad particle-size distribution. Increasing the number of passes through the Microfluidizer, increasing the pressure, or reducing the phospholipid concentration all resulted in a smaller average liposome diameter. Changing these variables did not have a significant effect on the polydispersity of the dispersion. Electron microscopy showed that the dispersions formed had a range of structures, including unilamellar, multilamellar, and multivesicular liposomes. The composition of the MFGM phospholipid material is different from that of the phospholipids usually used for liposome production in the pharmaceutical and cosmetic industries. The MFGM-derived fraction comprises approximately 25% sphingomyelin, and the fatty acids are primarily saturated and monounsaturated These differences are likely to affect the properties of the liposomes produced from the phospholipid material, and it may be possible to exploit the unique composition of the MFGM phospholipid fraction in the delivery of bioactive ingredients in functional foods ( Thompson and Singh, 2006). 19 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Nutritional applications Phospholipids The consumption of the MFGM alone as a nutraceutical or as a dairy food, or the consumption of food products enriched by the MFGM has health benefits due to the presence of phospholipids in the MFGM. Phospholipids of bovine MFGM constitute almost 30% of the total MFGM lipids. The three main MFGM phospholipids are sphingomyelin, phosphatidyl choline, and phosphatidyl ethanolamine comprising (weight %) 19.2 to 23.0, 25.7 to 41.1, and 27.0 to 35.0% of total MFGM phospholipids, respectively. Currently, it is considered that phospholipids, including milk-derived, affect numerous cell functions including growth and development, molecular transport systems, absorption processes, memory, stress responses, development of AlzheimerвЂ™s disease, and myelination in the central nervous system . Phospholipids also affect the development of colon cancer as discussed above (Spitsberg, 2005). Phospholipids and glycosphingolipids Phospholipids and glycosphingolipids accounts to about 1% of total milk lipids. They have functional roles in a number of reactions, such as binding enzymes on the globule surface, cellcell interactions, differentiation, proliferation, immune recognition. Gangliosides are one of these components found in milk. The small amount of gangliosides (very complex neuraminic acid derivatives of a glycosylatcd ceramide) in milk polar lipid fractions has triggered interest to incorporate milk phospholipid compounds into infant formula products. Gangliosides have been confirmed as having immune stimulating effects and can modulate the binding of microbial toxins in the intestinal tract ( Haug, 2007). Sphingomyelin Sphingomyelin (N-acylsphingosine-l phosphocho line or ceramide phosphocholine) is a phospho lipid preferentially located in the outer leaflet of the plasma membrane of most mammalian cells. In bovine milk, phospholipids account for 0.2-1.0 g/l00 g of total lipids, where they are as sociated with the milk fat globule membrane. Sphingomyelin represents about one third of total milk phospholipids, variation in content is influenced by season and the stage of lactation, Digestion products of sphingomyelin and other sphingolipids, the ceramides(fatty acid amides of sphingosine), sphingosines and sphingosine-phosphates are highly bioactive compounds that are associated with cell regulation. They arrest cell growth and induce differentiation and apoptosis mechanisms that are deregulated in carcinogenesis. Ceramide and sphingosine are referred to as tumor supВ¬pressor lipids. The major metabo-lites, ceramide and sphingosine, pass from the lumen to intestinal cells where they are utilized to resynthesize sphingomyelin and other sphingolipids, which than largely pass to the circulation. Because ceramide and sphingosine participate in major anti proliferative pathways of cell regulation that suppress oncogenesis, they have been termed tumor suppressor lipids. Both sphingolipids and their active metabolites, ceramides and sphingosines, were determined as effective bactericidal agents on pathogens like Listeria monocytogenes. In addition, studies with experimental animals have shown that feeding sphingolipids inhibits colon carcinogenesis, reduces serum LDL cholesterol and regulates immune system. A series of study showed that dietary milkderived sphingomylein (0.025 to 0.1%) of diet inhibited chemically induced colon tumors development in mice, reduced aberrant crypt foci (ACF) (ACF -early precursors of colon cancer) formation and suppressed the conversion of benign adenomas to malignant adenocarcinomas. Feeding the milk derived sphingolipids, ceramide monohexoside (glucosyl) ceramide dihexoside (lactosyl) and the ganglioside to mice at 0.025 to 1.0 g/100g diet has shown that there complex sphingolipids were hydrolysed to ceramide by colonic enzymes. Supplementation reduced proliferation particularly in the upper-half of the colonic crypt cells and reduced the number of ACF by 50-60 per cent. The reduction in the ACF formation is similar to that previously obtained with sphingomyelin. Another aspect confirmed in human clinical trials is sphingomyelin cholesterol lowering activity by inhibiting intestinal absorption of food based cholesterol (Sibel et al, 2006; Schneider, 2007; Chaudhary et al, 2008). 20 Technological and Nutritional Aspects of Milk Phospholipids Conclusion Milk phospholipids are a new class of natural phospholipids now commercially available. They offer a broad spectrum of both technological and nutritional properties which are unique to this kind of polar lipid extract and which are different from all other phospholipid products on the market. These are potent emulsifier, stable liposome forming compound, cholesterol lowering, improving cognitive performance, stress dampening effects, colon cancer preventive effects, additive for infant formulae. References Chaudhry, I; Kathirvelan, C; Tyagi, A.K. (2008).Anticancer property of milk. Indian Dairyman, 60(5)37-53. Haug, A; Hestmark, A.T; Harstad, O.M. (2007).Bovine milk in human nutrition-a review.Lipids in health and disease. p1-26. Korhonen, H.J. (2010).Bioactive components in bovine milk. Chapter2 p.15-42.cited from book- Bioactive components in milk and dairy products Edt. By Young W.Park. Willey blackwell A John Wiley & Sons, Ltd., Publication. Schneider, M.(2007). Milk phospholipids - technological and nutritional aspects.Bulletin of the IDF 413/2007.p.35-39. Sibel Akal, GГ¶nГ§ and GГјlfem Гњnal (2006). Functional Properties of Bioactive Components of Milk Fat in Metabolism. Pakistan Journal of Nutrition 5 (3): 194-197. Spitsberg,V.L.(2005).Bovine MFGM as a potential nutraceutical. J. Dairy Sci. 88:2289-2294. Thompson, A.K and Singh, H.(2006). Preparation of Liposomes from Milk Fat Globule Membrane Phospholipids Using a Microfluidizer. J.Dairy Sci. 89:410-419. 21 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Methods of Cholesterol Removal to Develop Low вЂ“ Cholesterol Dairy Products Darshan Lal and Vivek Sharma Dairy Chemistry Division, NDRI, Karnal Introduction: The importance of milk and milk products, in India, has been recognized since Vedic times. Milk is considered to be a complete food as it contains almost all essential nutrients required for human health and growth. Lipids, the most important constituent of milk, play significant role in the nutrition, flavour and physico-chemical properties of milk and milk products. They are also rich source of fat-soluble vitamins (A, D, E & K) and essential fatty acids, apart from having pleasant sensory attributes. Milk fat is easily digestible than other oils and fats. It contains number of components which show anticarcinogenic activity, e.g. sphingomyeline, conjugated linoleic acid, ОІ-carotene etc. So one (especially vegetarians) cannot avoid it in oneвЂ™s diet. But recent trend, in the society, is against fat-rich dairy products due to the presence of saturated fat & cholesterol as these are known to increase the incidence of coronary heart disease (CHD). CHD is one of the common causes of heart attack. Through a period of time, many researchers have shown that dietary cholesterol, serum cholesterol and occurrence of coronary heart disease (CHD) have positive correlation. Milk fat contains about 0.25 to 0.40% cholesterol. Consumption of ghee and other fat-rich dairy products makes appreciable contribution to cholesterol intake. Furthermore, some cholesterol oxidation products (COPs) have been reported to be more harmful than cholesterol itself as they are cytotoxic, atherogenic, mutagenic and carcinogenic. Recent wave against cholesterolcontaining foods has damaged the image and market growth of fat-rich dairy products. The educated and urban society, in particular, is more conscious about the presence of cholesterol in their diet. This segment of the society is the major consumer of dairy and other food items manufactured by the organized sector. In recent years, demand of cholesterol-free foods has increased tremendously. This has led to increase in market of margarine, vegetable fat filled dairy products, milk fat replaced dairy products, etc. Owing to the adverse affects of cholesterol on human health, various physical, chemical and biological methods have been developed for reducing cholesterol in foods. These include blending of milk fat with vegetable oils, extraction with organic solvent, adsorption with activated charcoal and saponin, vacuum distillation, molecular distillation, degradation of cholesterol by enzyme (cholesterol oxidase) and removal of cholesterol by supercritical carbon dioxide. Recently, ОІ- cyclodextrin (a starch hydrolysed product) has been effectively used for cholesterol removal from milk, cream, cheese, lard and egg-yolk. Beta cyclodextrin is reported to be non-toxic, non-hygroscopic, chemically stable and edible. Cholesterol: Cholesterol is a waxy material found in all cells of the body and is a necessary part of cell membranes, some hormones and other body components. In particular, it participates in the formation of myelin sheaths in the brain and peripheral nerves, and modulates the absorption of dietary fats in the intestine. It also acts as a precursor in the biosynthesis of bile acids, steroid hormones and vitamin D. The body makes all the cholesterol it needs; it is not necessary to get any cholesterol from the diet. A high level of cholesterol in the blood is a major risk factor for CHD and heart attack. 22 Methods of Cholesterol Removal to Develop Low вЂ“ Cholesterol Dairy Products Structure and properties of cholesterol: The term cholesterol was derived from the Greek words chole and stear, which mean вЂњbileвЂќ and вЂњhard fat,вЂќ respectively. The origin of the term is a reflection of the fact that the substance was first identified as a hard & white solid in gallstones. Though discovered by Poulletier de la Salle in 1769, cholesterol was not named until 1818, when Michel Chevreul rediscovered it and dubbed it as cholesterine, believing that the material was like a fat (Sabine, 1977). Cholesterol is a hydrophobic sterol consisting of a four-ring structure (Figure A) with molecular weight 386.66 and molecular formula: C27H46O. Cholesterol is insoluble in water, sparingly soluble in cold alcohol or petroleum ether, and soluble in hot alcohol and most other organic solvents. Cholesterol melts at 148.5ВєC. It can be sublimed and distilled under high vacuum. The polar hydroxyl group, which gives cholesterol a slightly hydrophilic nature, can be esterified to a fatty acid, producing cholesterol ester. Both cholesterol and cholesterol ester are important structural components of cell membranes. Cholesterol is also a major determinant of membrane fluidity due to its hydrophobic and hydrophilic regions (Webb et al, 1987). Sources of cholesterol in body: In the body, cholesterol appears through endogenous synthesis and from the diet. Cholesterol synthesis in the body is most active in the liver and intestine and averages 11 mg per kg body weight per day. This equals 770 mg for a 70 kg man on a low (less than 300 mg per day) cholesterol diet (McNamara, 1987). Normally, liver makes 80% of the total blood cholesterol and only 20% comes from the diet (Renner and Gurr, 1991; Allred, 1993). Cholesterol is not considered as an essential dietary nutrient because of its endogenous synthesis. On the other hand, Thomas and Holub (1994) reported that if less dietary cholesterol is consumed, the body compensates by making more cholesterol. Digestion, absorption and transportation of cholesterol in the blood: Digestion and absorption of cholesterol occurs in the small intestine (Grundy, 1983). Cholesterol ester is broken down by a pancreatic cholesterol esterase into free cholesterol, which, absorbed into the cells lining of the intestine. The absorption of endogenous cholesterol (as bile acids) is more efficient than dietary cholesterol absorption. Fat, including cholesterol, absorbed from the diet, is insoluble in the aqueous medium of the blood. To enable transport through blood system, the various fat components are incorporated into particles called lipoproteins (Grundy, 1983; Mahley and Innerarity, 1983). Lipoproteins consist of a lipid core of triglyceride and cholesterol ester with a surface of mainly phospholipids, protein and some free cholesterol. The four major lipoprotein fractions found in the blood are chylomicrons, verylow density lipoprotein (VLDL), low-density lipoprotein (LDL) and high-density lipoprotein (HDL). Chylomicrons are very rich in triglycerides (about 85%) but also contain absorbed cholesterol in the free or esterified form. VLDL is also rich in triglyceride (about 50%) and contains a substantial portion of cholesterol mainly as cholesterol ester. VLDL transport about 15% of the total cholesterol found in the blood. LDL is enriched in cholesterol and accounts for about 60% of the total blood cholesterol level. It is deposited in artery walls, increasing the buildup of plaque and hence also known as bad cholesterol. HDL carries as much as 20% of the total blood cholesterol level. HDL is thought to be antiatherogenic since it picks up cholesterol from peripheral tissues for delivery to the liver and excretion. Consequently, HDL is called good cholesterol. A better indicator of risk for CHD is the LDL/HDL cholesterol ratio (Thomas and Holub, 1994; Gurr, 1995). Synergistic effect of cholesterol with saturated fatty acids on plasma cholesterol level: Some saturated fatty acids are reported to affect total plasma cholesterol concentration. While, stearic acid has little effect on plasma cholesterol concentration, myristic and palmitic acids have been reported to have the greatest cholesterol raising potential (Hegsted et al., 1965). Some evidence suggests that the effect of myristic and palmitic acids depends on the concomitant intake of dietary 23 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance cholesterol (National Academy of Sciences, 1989). Such an interaction is clear in several experimental mammals (Spady et al., 1993) and has also been found in some human studies (Fielding et al., 1995). The above reports suggesting an interaction between cholesterol and saturated fat intake; provide a further reason to limit dietary cholesterol. Coronary heart disease and atherosclerosis: Coronary heart disease (CHD) is a condition in which the main coronary arteries which supply blood to the heart are no longer able to supply sufficient blood and oxygen to the heart muscle. CHD, the common cause of heart attack, is one of the most frequent causes of death in the developed and developing countries (AHA, 1989). The rates of mortality due to CHD throughout the world vary. For example, in one study among men aged 40-59 years, the annual incidence rate varied from 15 per 100,000 in Japan to 198 per 100,000 in Finland (Lovegrove and Jackson, 2003). According to Chopra (1997), 2.5 million Indians become victims of heart disease every year, and Indian women are the fastest rising group of coronary patients in the world. He further observed that 33 per 1000 Indians have a greater chance of requiring treatment and intervention for heart disease than either European or Americans. Atherosclerosis is a silent, painless process and the main cause of CHD characterized by build up of cholesterol-rich fatty deposits on the inner lining of the coronary arteries, which decrease blood flow to the heart muscle by narrowing the arteries substantially (Tabas, 2002). The atherosclerosis plaques usually develop at a point of minor injury in the arterial wall. Cholesterol in milk and milk products: Animal food products like milk and milk products, meat and meat products and eggs are the major sources of cholesterol in our diet. Among these, chicken egg contains highest amount (about 215 mg/egg) of cholesterol. Normally, most of the dieticians believe milk fat as a main source of dietary cholesterol and the main culprit for CHD disease. Cholesterol accounts for 0.25-0.45% of the total lipids in milk. Cholesterol concentrates in the milk fat globule membrane (MFGM). In milk, 80% of the cholesterol is associated with the milk fat globules and the remaining 20% is partitioned into the skim milk phase where it is associated with fragments of cell membrane (Patton & Jensen, 1975). However, any event disrupting the membrane structure, e.g. churning of cream will result in the partial passing of cholesterol alongwith ruptured membrane material to the aqueous phase. Arul et. al., (1987) studied the distribution of cholesterol in various milk fat fractions viz., solid fraction (m. pt. 39ВєC), semisolid fraction (m. pt. 21В°C) and liquid fraction (m. pt. 12ВєC) and reported that 80% of the total cholesterol content was present in the liquid fraction of the milk fat. 80-90% of the cholesterol is present in milk in the free form, while 10-20% is esterified (Bindal and Jain, 1973; Wood and Bitman, 1986; Jensen, 1987; Schlimme & Kiel, 1989). Pantulu and Murthy (1982) observed 8-10 times higher content of cholesterol in whey than in whole milk. Srinivasan (1984) reported the average cholesterol content of cow and buffalo milk as 2.8 and 1.9 mg/g fat, respectively. However, Prasad and Pandita (1990) showed that buffalo milk (20 mg%) contained more cholesterol than cow milk (15.5 mg%). Similarly, they found that dahi from buffalo milk contained more cholesterol as compared to dahi from milk of different breed of cows. In general, dahi had lower cholesterol values than the fresh milk (Ismail and Ahmad, 1978; Prasad and Pandita, 1990). Cholesterol in channa samples exhibited a highly significant variation, being minimum in buffalo, while such species variations were not observed in case of khoa calculated on dry weight basis (Prasad and Pandita, 1990). Cheese was found to contain 52.3-76.6 (av. 69.3) mg of cholesterol/100 g of cheese and 198-298 (av. 273) mg/100g fat in cheese (Fuke and Matsuoka, 1974). Tylkin et al., (1975) reported 9 times higher cholesterol/g fat in butter milk than butter. Aristova and Bekhova (1976) observed cholesterol content in unsalted butter as 244 mg/100 g. Vyshemirskii et al., (1977) reported that 80-90% cholesterol initially present in cream passed into butter and 10-20% to butter milk. Masson and Martinez (1984) reported cholesterol content as 177вЂ“208 mg/100 g fat in butter. Bindal and Jain (1972) estimated free 24 Methods of Cholesterol Removal to Develop Low вЂ“ Cholesterol Dairy Products and esterified cholesterol in Desi ghee, using TLC method and reported their contents as 0.288 and 0.038% and 0.214 and 0.056% in cow and buffalo ghee, respectively. Prasad and Pandita (1987) observed cholesterol content of ghee prepared from milk of Haryana, Sahiwal and Sahiwal X Friesian cows and from Murrah buffaloes, to be 303, 310, 328 and 240 mg/100 g fat, respectively. Factors affecting level of cholesterol in milk and milk products Effect of Species/Breeds: Bindal and Jain (1973) reported that cow ghee (0.31%) contained higher cholesterol than buffalo ghee (0.267%). Bernolak (1979) observed that cow milk, with 2.8% fat, contained 237 mg total sterols/100 g fat (92.8% cholesterol of total sterols). Prasad and Pandita (1987, 1990) also reported higher cholesterol content in cow ghee compared to that in buffalo ghee. Singh and Gupta (1982) observed that goat ghee contain higher cholesterol (0.236 g/100 g fat) than cow (0.230 g/100 g fat) and buffalo (0.196 g/100 g fat) ghee. Effect of Season/Stage of lactation: Season has also been reported to affect the cholesterol content of milk fat. Treiger (1979) reported that total cholesterol content of cow milk fat ranged from 0.24-0.29 g/100 g fat in spring and 0.18-0.25 g/100 g fat in summer season. Prasad and Pandita (1987, 1990) observed that cholesterol content of ghee was higher in winter than in summer (301 vs 291 mg/100g fat). Krzyzewski et al. (2003) also observed a significantly lower (by about 16%) concentration of cholesterol in milk during winter season. Ghee prepared from milk of old animals (Lal, 1982) and late lactation milk (Nigam, 1989) was found to contain highest level of cholesterol. Effect of Heat: Bector and Narayanan (1975) observed that when cow and buffalo ghee were heated at 225В°C for 2 h, respectively 26.1 and 27.3% of cholesterol was lost. Similarly, Rai and Narayanan (1984) also reported 28.2 and 49% loss of cholesterol after 12 h of intermittent frying in aluminium and iron container. Methods of cholesterol removal from milk fat: Since dairy products contain significant amounts of cholesterol, a number of processes for removal of cholesterol have been developed to produce low-cholesterol dairy products. These include steam stripping, molecular distillation, solvent or super-critical extraction, reaction with cyclic anhydride, enzymatic method and treatments with adsorbents like saponin, activated charcoal and cyclodextrin. These are briefly discussed below. 1. Steam stripping This process is similar to that used in the deodorization of vegetable oils and removal of unsaponifiable matter. To remove cholesterol by steam stripping, the fat is first deairated under vacuum after which it is heated with steam upto 232ВєC and then subjected to steam at low pressure in cylindrical tall chamber. The anhydrous milk fat (AMF) passing over a series of plates is spread in many thin layers, which increases the stripping efficiency. The steam rises and carries with it the evaporated cholesterol to be condensed and collected with other volatiles. This process can remove upto 93% of cholesterol though with 5% fat losses. The major disadvantage to the process is that it removes flavouring compounds also (Schlimme & Kiel, 1989). 2. Molecular distillation In this process, AMF is molecularly distilled at temperature 190 and 210ВєC at a vacuum of 10-4 Torr. Fractions distilled at 190 and 210ВєC represented 3.43 and 3.99 % of the initial mass and contained more than 93% of the total cholesterol (Lanzani et al, 1994 and Sharma et al., 1999). Arul et al. (1988) fractionated AMF into four fractions at temperatures of 245 and 265ВєC and pressure of 220 and 100 mm Hg. Two low melting point fractions were blended together to yield a total of three fractions (liquid, intermediate and solid). About 78% of the total cholesterol was found in the liquid fraction while the remaining was found in the intermediate (18%) and solid (4%) fractions in the esterified form. But, because of the high heat used in the process, the quality of the end product is adversely affected. 25 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 3. Solvent extraction: In this process butter oil is mixed with propane and ethanol in the mixing vessel. The low viscous mixture of butter fat, ethanol and propane is fed into the extraction column. A mixture of ethanol and water, containing a small amount of propane is used as extractant. The extract, a solution of cholesterol and butter fat in a mixture of ethanol, water and some propane is withdrawn at the bottom of the extraction column, which is splitted into two phases. The upper phase consists of fat and cholesterol, which are subsequently separated, in a further processing step. Around 90 to 95% of the cholesterol is extracted in this counter-current procedure operated at 30ВєC and 10 bar (Czech et al., 1993). 4. Supercritical carbon dioxide extraction: Some studies have shown that supercritical carbon dioxide (SC-CO2) can be used to fractionate AMF with evidence that cholesterol can be concentrated into selected fractions. Kaufmann et al., (1982) obtained two fractions of milk fat by SC-CO2 extraction at a pressure of 200 bars and temperature of 80ВєC. In this process, the liquid fractions were enriched in total cholesterol. However, Huber et al. (1996) observed that direct supercritical extraction of cholesterol from AMF is not feasible because of the low selectivity of cholesterol and poor solubility of AMF. Moreover, under these conditions, important milk flavours also get separated with the cholesterol. Therefore, they proposed another process for cholesterol removal from AMF, dissolved in SC-CO2 under high solubility conditions for AMF (40 MPa at 70ВєC) to achieve rapid extraction. In this process, the dissolved AMF in SC-CO2 is passed isobarically and isothermally through a high-pressure column, filled with a suitable adsorbent (e.g. silica gel) to eliminate cholesterol. Finally, the supercritical mixture is fractionated by either descending or ascending temperature profile in separators connected in series. Karkare and Alkio (1993) found that over 99% of cholesterol from milk fat could be removed using an SC-CO2 extraction system equipped with a silica gel column. 5. Reaction with cyclic anhydride: Gu et al. (1994) developed a method for cholesterol removal from milk fat based on the reaction between the hydroxyl group of cholesterol and a cyclic anhydride such as succinic anhydride. The conversion of cholesterol into an acid derivative makes it possible to remove these from fats by extraction with aqueous alkali. Addition of acetic acid increases the rate of reaction and prevents the distillation of cyclic anhydride from reaction mixture. They removed 50% cholesterol from animal fats but alongwith it О±- tocopherol (50%), Оі- and Оґ- lactones also get removed. 6. Enzymatic method: McDonald et al. (1983) have described an enzymatic process using cholesterol reductase for conversion of cholesterol to biologically inactive, e.g., non-toxic, non-absorbable products like coprosterol, which is either not or is only poorly adsorbed by the body. This approach, which is theoretically suitable for reducing the cholesterol content of milk fat, has been verified biologically at least in part, by the finding that a portion of the intestinal cholesterol is reduced to coprosterol by intestinal bacteria and subsequently eliminated. 7. Adsorption methods Cholesterol can be removed by its adsorption on certain material. Adsorbents, which are used to remove cholesterol, are activated charcoal, saponins and ОІ cyclodextrin. (A) Activated charcoal Bindal et al., (1994) could remove half of the cholesterol present in milk fat through treatment of liquid fat with activated charcoal. Another activated charcoal method claimed 95% of cholesterol removal from AMF but many other compounds including yellow pigments were also removed simultaneously (Sharma et al., 1999). (B) Saponins Saponins are naturally occurring plant compounds that can be used to selectively bind to cholesterol and precipitate it out. 80% and 90% cholesterol reduction in cream and anhydrous milk 26 Methods of Cholesterol Removal to Develop Low вЂ“ Cholesterol Dairy Products fat was obtained by using this method (Riccomini et al., 1990). Oh et al. (1998) found 70.5% of the cholesterol removal when milk was treated with 1.5% saponin at 45ВєC for 30 min. Further, addition of 0.25% celite increased cholesterol removal to 72%. However, the methods using activated charcoal or saponins are relatively non-selective and remove flavour and nutritional components also when cholesterol is removed (Lee et al., 1999; Sharma et al., 1999). (C) ОІ-cyclodextrin Beta cyclodextrin, one of the well known members of cyclodextrin family, is a cyclic oligosaccharide of seven glucose units joined вЂ�head to tailвЂ™ by О±-1, 4 linkage and is produced by the action of enzyme cyclodextrin glycosyl transferase (CGT) on hydrolyzed starch syrup. Beta cyclodextrin has torus like structure. The central cavity is hydrophobic, giving the molecule its affinity for non-polar molecules such as cholesterol (Szejtli, 2004). The radius of the cavity can accommodate a cholesterol molecule almost exactly, explaining the highly specific nature of ОІ-cyclodextrinвЂ™s ability to form an inclusion complex with cholesterol (Hettinga, 1996). References: AHA (1989) Heart Facts. American Heart Association. Dallas, A. Heart. A. Ahn, J. and Kwak, H. S. (1999) Optimizing cholesterol removal in cream using beta-cyclodextrin and response surface methodology. J. Food Sci. 64(4): 629-632. Allred, J. B. (1993) Lowering serum cholesterol. Who benefits? J. Nutr. 123: 1453. Aristova, V. P. and Bekhova, E. K. (1976) Cholesterol in milk and milk products. Trudy, Vsesoyuznyi NanchnoissledovatelвЂ™skii Institut Malochoi Promyshlennosti No. 42: 45 (cf. DSA 1977(39), 2748). Arul, J. A., Boudreau, A., Makhlouf, J., Tardif, R. and Grenier, B. (1988). Distribution of cholesterol in milk fat fractions. J. Dairy Res. 55: 361-371. Bector, B.S. and Narayanan, K.M. (1975) Comparative stability of unsaponifiable constituents of ghee during thermal oxidation. Indian J. Nutr. Dietetics. 12(6): 178-180. Bindal, M. P. and Jain, M. K. (1973) Studies on cholesterol content of cow and buffalo ghee. Indian J. Anim. Sci. 43(10): 918-924. Bindal, M. P., Wadhwa, B. K., Lal, D., Rai, T. and Aggarwal, P. K. (1994) Removal of cholesterol from milk and milk products: Application of biotechnical processes. NDRI Annual Report. pp. 98-99. Czech, B., Peter, S. and Weidner E. (1993) Effective removal of cholesterol from butter fat. Scandinavian Dairy Information, 7(4): 56-58. Fielding, C. J., Havel, R. J., Todd, K. M., Yeo, K. E., Schloetter, M.C., Weinberg, V. and Frost, P. H. (1995) Effects of dietary cholesterol and fat saturation on plasma lipoproteins in an ethnically diverse population of healthy young men. J. Clin. Invest. 95: 611-618. Fuke, Y. and Matsuoka, H. (1974) Cholesterol content and identification of foreign fats in processed cheese. J. Jap Soc. Food Nutr. 27: 269. Grundy, S. M. (1983) Absorption and metabolism of dietary cholesterol. Annu. Rev. Nutr. 3: 71-96. Gu, Y. F., Chen, Y. and Hammond, E. G. (1994) Use of cyclic anhydrides to remove cholesterol and other hydroxy compounds from animal fats and oils. J. Am. Oil Chem. Soc. 71: 1205-1207. Gurr, M. I. (1995) Dietary lipids in health and disease. In Advanced Dairy Chemistry-2: Lipids, 2nd edn, (eds P. F. Fox), Chapman & Hall, New York, pp. 349-402. Hegsted, D.M., McGandy, R.B., Myers, M.L. and Stare, F.J. (1965) Quantitative effects of dietary fat on serum cholesterol in man. Am. J. Clin. Nutr. 17: 281-95. Hettinga, D. (1996) Butter. in BaileyвЂ™s industrial oil and fat products, Vol. 3, 5th edn, (eds Y. H. Hui), John Wiley & Sons, INC. New York, pp. 1-23. Huber, W., Molero, A., Pereyra, C. and Martinez de la Ossa E. (1996) Dynamic supercritical carbon dioxide extraction for removal of cholesterol from anhydrous milk fat. Int. J. Food Sci. Tech. 31: 143-151. Ismail, A.A. and Ahmad, N.S. (1978) Cholesterol content in buffalo milk and its distribution in some dairy products. Egypt. J. Dairy Sci. 6: 92-95. Jensen, R. J. (1987) Cholesterol in human milk. in Human Lactation. 3. The effect of human milk on the recipient infant (eds A. S. Goldman, S. A. Atkinson and S. S. Hanson), Plenum Press, New York, pp. 151. Karkare, V. and Alkio, M. (1993) Removal of cholesterol during milk fat fractionation by supercritical carbon dioxide. Agric. Sci. Finland. 2(5): 387-393. (Cited in DSA, 56: 1522). Kaufmann, W. , Biernoth, G., Frede, E., Merk, W., Precht, D. and Timmens, W. (1982) Fractionation of butter fat by extraction with supercritical carbon dioxide. Milchwissenschaft. 37: 92-96. Krzyzewski, J., Strzakowska, N., Jozwik, A., Bagnicka, E. and Ryniewicz, Z. (2003) Effect of nutrition and season on cholesterol level in milk of Holstein-Friesian cows. Annals Anim. Sci. 3: 45-49. Lal, D. (1982) Effect of lactation number on the physicochemical status of milk lipids. Ph.D. Thesis, Kurukshetra Univ., Kurukshetra. Lanzani, A., Bondioli, P. Mariai, C., Folegatti, L., Venturii, S., Fedeli, E. and Barreteau, P. (1994) A new short-path distillation system applied to the reduction of cholesterol in butter and lard. J. Am. Oil Chem. Soc. 71(6): 609-614. 27 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Lee, D. K., Ahn, J. and Kwak, H. S. (1999) Cholesterol removal from homogenized milk with beta-cyclodextrin. J. Dairy Sci. 82: 2327-2330. Lovegrove, J. and Jackson, K. (2003) Coronary heart disease. In Functional Dairy Products (eds Tina Mattila- Sandholm and Maria Saarela), CRC Press, Boca Raton, pp: 54-93. Masson, L and Martinez, M. (1984) Determination of cholesterol content in butter. International Dairy Federation Bulletin no 7: 165. McDonald, I. A., Bokkenheuser, V. D., McErnon, A. M., Mosbach, E. H. and Winter, J. (1983) Degradation of steroids in human gut. J. Lipid Res. 24: 675-700. McNamara, D. J. (1987) Diet and heart disease: The role of cholesterol and fat. J. Am. Oil Chem. Soc. 64: 1565-74. Mahley, R. W. and Innerarity, T. L. (1983) Lipoprotein receptors and cholesterol homeostasis. Biochim. Biophys. Acta, 737: 197-222. Nigam, S. (1989) Studies on the physico-chemical status of milk lipids from cross breed cattle. Ph.D. Thesis, Kurukshetra Univ., Kurukshetra. Oh, H. I., Chang, E. J. and Kwak, H. S. (1998) Conditions of the removal of cholesterol from milk by treatment with saponin. Korean J. Dairy Sci. 20: 253-260. Pantulu, P. C. and Murthy, M. K. R. (1982) Lipid composition of skimmed milk and whey. Asian. J. Dairy Res. 1(1): 1720. Patton, S. and Jensen, R.G. (1975). Lipid metabolism and membrane functions of the mammary gland. In Progress in the chemistry of fats and other lipids (eds R.T. Holman), Pergamon Press Oxford. pp. 163-277. Prasad, R. and Pandita, N. N. (1990) Cholesterol content of milk and its fractionation during processing. Indian J. Dairy Sci. 43(2):190-193. Prasad, C.R., Subramanian, R. and Ramaprasad, C. (1992) Qualitative and comparative studies of cholesterol oxides in commercial and home-made Indian ghee. Food Chemistry. 45(1): 71-73. Prasad, R. and Pandita, N. N. (1987) Variations in the cholesterol content of dairy fat. Indian J. Dairy Sci. 40(1): 55-57. Rai, T. and Narayanan, K.M. (1986) Unsaponifiable constituents of ghee as affected by intermittent frying. Indian j. Anim. Sci. 56 (5): 610-611. Renner, E. and Gurr, M.I. (1991) Do we need cholesterol reduced dairy products? Dairy Industry International. 56: 34. Riccomini, M. A., Wick, C., Peterson, A, Jimenez-Flores, R. and Richardson, T. (1990) Cholesterol removal from cream and anhydrous milk fat using saponins. J. Dairy Sci. 73(1): 107. Sabine, J. R. (1977) Methods in cholesterol research. in Cholesterol, (eds J.R. Sabine) Marcel Dekker, Inc. New York and Basel. pp. 29-55. Schlimme, E. and Kiel, D. (1989) Removal of cholesterol from milk fat. European Dairy Magazine, 12-21. Seth, R. and Singh, A. (1994-95) Removal of cholesterol from milk using ОІ-cyclodextrin and preparation of milk products from such treated milk. NDRI Annual Report. pp. 95. Sharma, R., Nath, B. S. and Lal D. (1999) Approaches for cholesterol removal from milk fat: An overview. Indian J. Dairy and Biosciences. 10:138-146. Singh, I. and Gupta, M. P. (1982) Physico-chemical characteristics of ghee prepared from Goat milk. Asian J. Dairy Res. 1: 201-205. Spady, D. K. Woollett, L. A. and Dietschy, J. M. (1993) Regulation of plasma LDL-cholesterol levels by dietary cholesterol and fatty acids. Annual. Rev. Nutr. 13: 355-381.. 28 Fortification of Milk and Milk Products for Value Addition Fortification of Milk and Milk Products for Value Addition Sumit Arora Dairy Chemistry Division, NDRI, Karnal Introduction Food fortification is thought to be a highly effective solution and among the most cost effective public health interventions currently available. It may be defined as the addition of one or more essential nutrients to food whether or not it is normally contained in the food, for the purpose of preventing /correcting a demonstrated deficiency of one / more nutrients in the population or specific population groups (Codex Alimentarius Commission, 1994). It is practiced in those areas where the problems of malnutrition are prevalent. According to FAO/WHO guidelines (1995) essential nutrients may be added (i) to replace losses that occur during manufacture, storage and handling of food (restoration). For example the removal of cream from milk takes almost all the natural vitamins A and D and therefore skimmed milk may be fortified with the same vitamins at levels as fluid whole milk. (ii) To ensure nutritional equivalence in imitation or substitute foods. (iii) To compensate for naturally occurring variations in nutrient levels. For instance, milk and butter are subjected to seasonal variations in vitamins A & D contents. Some dairy products are fortified with the vitamins A & D in order to maintain constant vitamin levels. (iv) To provide levels higher that those normally found in a food. For example, margarine is fortified with vitamins A & D (in western countries) to render it nutritionally equivalent to butter, and (v) to provide a balanced intake of micronutrient in special case (dietetic foods) for example infant formulas, special food for athletics, medical food etc. General criteria for fortification вЂў The intake of nutrients is below the desirable level in the diet of significant number of people. вЂў The vehicle used for fortification should be consumed in significant quantities by target population. вЂў Addition of nutrient should not create an imbalance of essential nutrients. вЂў The added nutrients should be stable under proper conditions of storage and use. вЂў Biological availability of added nutrients should be high. вЂў There should be reasonable insurance against excessive intake to a level of toxicity.(Food and Nutrition Board, 1973) Milk and milk products as a suitable vehicle for fortification Milk in its natural form is almost unique as a balanced source of manвЂ™s dietary need (Table 1). The various steps in processing and storage have a measurable impact on some specific nutrients. Milk also provides a convenient and useful vehicle for addition of certain nutrients to manвЂ™s diet and has following benefits: - Since milk is centrally processed so that the quality control can be effectively implemented. - Milk and milk products are widely consumed regularly in predictable amounts by people of all age groups. - Cost is affordable by target population. - The stability and bioavailability of the added micronutrients to the milk remains high. - Since milk is nearly a complete food and all nutrients exist in almost fully available form, the bioavailability of added nutrients remains high. Addition of fortificants usually caused minimum change in colour, taste and appearance. - 29 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Nutrients generally added to milk Liquid milk fortification with vitamins A and/D is mandated in several countries. ОІ-carotene is added as a colour-enhancing agent to some milk products such as butter. Dried milk is often fortified with vitamins A and D, calcium, and iron. Milk based infant formula and weaning foods are fortified with a range of vitamins, minerals, and other nutrients such as polyunsaturated fatty acids. Powdered milk used for complementary feeding in Chile is fortified with vitamin C, iron, copper and zinc. Fortification of milk & milk products with vitamins Under ambient conditions the water soluble vitamin C and vitamins of the B-complex group such as thiamin, riboflavin, vitamin B6, niacin, pantothenic acid, folic acid, biotin and vitamin B12 are powdered and thus relatively easy to work with when producing most dairy products. The fat soluble vitamins which include vitamin A, D, E and K, however, exist either as an oil or as crystals, which may cause processing difficulties during the production of certain types of dairy products (Mortensen and Gotfredson, 1996). One of the problem encountered with the vitamins, is their limited stability in presence of heat, humidity and oxygen. Among the water soluble vitamins, vitamin C, folic acid, vitamin B6 and vitamin B12 are the less stable. While in the case of fat soluble vitamins vitamin A, D and E are least stable. In order to improve the stability of these vitamins, a number of different coating technologies have been developed. One of the most important methods to protect the fat soluble vitamins is microencapsulation, which results in a highly sophisticated powder, where the vitamin is kept protected from degradation by the coating material used for the encapsulation. During microencapsulation, the fat soluble vitamins are brought from the form of oil or a crystal вЂ“ which in some processes would be difficult to handle вЂ“ to the form of a free flowing powder much easier to handle and mix with other dry ingredients (Mortensen and Gotfredson, 1996). When two or more vitamins are added to a food product at the same manufacturing stage, this is commonly done in the form of premix or as blend. Premix is a homogenous mixture of desired vitamins in a dry powder from, whereas a blend is the same for the fat soluble vitamins, but in an oily form. A premix can consist of both water soluble and fat soluble vitamins and carotenoids, in which case the fat soluble vitamins have to be microencapsulated. Fortification of milk and milk products with iron, calcium and other minerals Selection of an appropriate mineral fortificant (iron, calcium etc) is based on its organoleptic considerations, bioavailability, cost and safety. The colour of iron compounds is often a critical factor when fortifying milk and milk products. The use of more soluble iron compounds often leads to the development of off-colours and off-flavours due to reactions with other components of the food material. Infant cereals have been found to turn grey or green on addition of ferrous sulphate. Offflavours can be the result of lipid oxidation catalysed by iron. The iron compounds themselves may contribute to a metallic flavour. Some of these undesirable interactions with the food matrix can be avoided by coating the fortificant with hydrogenated oils or ethyl cellulose (Jackson and Lee, 1991). Bioavailability of iron compounds is normally stated relative to a ferrous sulphate standard. The highly water soluble iron compounds have superior bioavailability (Richardson, 1990). Bioavailability of the insoluble or very poorly soluble iron compounds can be improved by reducing particle size. Unfortunately this is accompanied by increased reactivity in deteriorative processes. The problem of low bioavailability of some of the less reactive forms of iron is often circumvented by the use of absorption enhancers like, ascorbic acid, sodium acid sulphate and orthophosphoric acid, added along with the fortificant. The other important mineral for the fortification of milk and milk products, which has been studied, is calcium. Several commercial calcium salts are available for calcium fortification, which include carbonate, phosphate, citrate, lactate and gluconate. In general, organic acid salts of calcium are more bioavailable than inorganic salts (Labin-Godscher and Edelstein, 1996). The pH of the milk should be 30 Fortification of Milk and Milk Products for Value Addition taken care of during Ca fortification. Manufacturers of calcium fortified milk products should consider adding, magnesium, riboflavin and perhaps vitamin D as well, in amounts that would normally be obtained in a serving of vitamin D fortified milk (Weaver, 1998). Milk and milk products can also be fortified with a range of other mineral salts such as Mg, P, Zn, Cu and Mn. Prudent selection of mineral compounds is based largely on consideration of mineral reactivity and solubility of the salt. To overcome problems of flavour, texture and colour deterioration due to addition of minerals, some companies have engineered new fortificant preparations, which generally involve the use of stabilisers and emulsifiers to maintain the mineral in solution (FAO, 1995). Technology for fortification: 1. Liquid milk The technology of milk fortification is relatively simple and no additional equipments are needed or can be practiced with minor modifications in the existing plant. Mineral/vitamin fortification can be practiced at several stages in the production. But liquid milk is usually fortified prior to pasteurization or ultra-heat treatment. Homogenization is essential for oily preparations of vitamins. Usually two methods of additions are practiced i.e. batch process for small operations and metered additions for continuous process. A metered injection of the vitamin preparation upstream to the homogenizer has been the standard set up in continuous operation plants (Cornell University, 1994). Oily preparations are diluted with 10 parts of warm oil (45 вЂ“ 50В°C), usually butter oil and homogenized with a suitable quantity of skim milk or it can be mixed with appropriate quantity of milk and cream and finally homogenized. In the case of water soluble or water dispersible micronutrients, a premix can be made by diluting the nutrients to 20 times their weight with milk at 45В°C, followed by stirring and thorough mixing (USAID, 2001). A simple procedure for fortification of skim milk with vitamins A without using homogenizer was developed by Bector and Rani (1998). This process is basically a batch process and is suitable for small plants of low capital cost. Many iron compounds have been assessed in the fortification of pasteurised whole milk. The best fortification procedure was judged to be the addition of ferric ammonium citrate followed by pasteurisation at 81 В°C. In this way fortified milk containing 30 ppm iron was found to be acceptable after 7 days storage. Levels of vitamin E, vitamin A and carotene were not affected by the presence of iron. At pasteurisation temperatures below 79 В°C off-flavours developed due to lipolytic rancidity (Edmondson et al, 1971). De-aeration of the milk prior to the addition of iron compounds was also found to reduce flavour problems. In the production of iron fortified evaporated milk, ferric orthophosphate was shown to be useful (FAO, 1995). Calcium fortificant preparations including stabilizers and emulsifiers have been used for fortification of milk and milk-based beverages. It maintains calcium in suspension so as to improve mouth feel and appearance of products (FAO, 1995). In Germany a milk-based fruit beverage has been marketed which is fortified with calcium, phosphorous as well as vitamins A, E, B and C. Dried milk Here particle size of the fortificant as well as density of the fortificant has to be taken care as large and heavier size particles will lead to separation. In order to achieve stability of vitamins, the safest way to fortify dried milk is to blend dry forms of premix with the dried milk powder, thereby protecting the effect of microencapsulation. However, this requires an effective mixing system. If blends are used, they are added directly to milk, provided homogenization is done before spray drying. If vitamins are added before spray drying, overage addition (Table 2) will be necessary in order to compensate the losses (Mortensen and Gotfredsen, 1996). 31 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Iron fortification of powdered non-fat dry milk, ferrous sulphate at a level of 10 ppm was found to be stable for a period of 12 months. Ferric ammonium citrate and ferric chloride at a level of 20 ppm iron in the reconstituted product gave acceptable results (FAO, 1995). Infant formulas The mineral content of cow milk, from which many formulas are produced, is highly variable. Production methods have been adapted to control this source of variability. Operations have been included which remove most of the minerals, but at the same time some vitamins and other components of the milk are lost: technologies used include ion exchange, ultra filtration, electrodialysis, reverse osmosis and gel filtration. Mineral compounds are then added at the required levels. There must be careful selection of mineral compounds added to the formulas, as cereal products are highly susceptible to lipid oxidation during storage. The use of ferrous fumarate and ferrous succinate is recommended for fortification of infant cereals as they gave rise to no objectionable flavours/odours or colours on storage. Ferrous sulphate coated with hydrogenated fats, mono- or di-glycerides and ethyl cellulose caused discolouration on reconstitution with hot milk and hot water. Although some allowance is made for the natural vitamin content of the ingredients used, most of the vitamins are added to the formula. The Codex Alimentarius Commission (FAO/WHO, 1994) has published an advisory list of mineral salts and vitamin compounds which can be added to formulas. Predetermined excesses of vitamins have to be added to allow for processing and storage losses. UHT processing followed by aseptic packaging has been preferred to in-can sterilisation since less nutrient losses occur in the former case. Losses have been noted particularly for vitamin C, thiamin, folic acid and vitamin B6. Iron absorption from formulas has been reported to be 5-10% compared to 50% for human milk. It has been suggested that bovine milk proteins or elevated calcium and phosphorus levels account for this difference. Zinc levels in formulas are also higher than in human milk to make up for reduced bioavailability. Ice-cream: The unit operations used in the manufacture of ice-cream is not highly destructive to vitamins. Vitamins are added in the dry form to the mix. Since whipping and consequent operation of the mix is carried out around freezing temperature, oxidative losses of vitamins are minimized. The greatest processing losses, which occur during manufacture of fortified ice-cream, are during pasteurization of ice cream mix. Calcium enriched ice-cream is also available in USA and is marketed under the name of TruCal. Fermented milk products: In the production of yoghurt, the low pH renders it unsuitable as a carrier of vitamins such as vitamin A. Water soluble vitamins are best used in a encapsulated form, protected for odour and flavour considerations. Some vitamin losses can occur through metabolism by microorganisms during fermentation (O'Brien and Roberton, 1993). The sensory quality of iron fortified yoghurt was acceptable to when tested by a consumer panel. No significant difference in the appearance, mouthfeel, flavour, or overall quality was observed between iron fortified and unfortified yoghurts (Hekman and McMahon, 1997). In Germany, enrichment of cheese with iodine through the use of iodised salt has been approved. Considerations while fortification of milk & milk products 1. Bioavailability of commercial preparations: Bioavailability of different compounds facilitates the selection of the optimal compound. Bioavailability refers to the rate of absorption and utilization of a nutrient from a given matrix. 2. NutrientвЂ“nutrient reaction: Interaction among the nutrients and other food components is a key factor in nutrient addition. For example, Vitamin C will improve the absorption of iron 32 Fortification of Milk and Milk Products for Value Addition (Kiran et al, 1977). On the other hand, the iron will accelerate vitamin degradation. Fortification of calcium in milk may interfere with absorption of iron or zinc (Weaver, 1998). 3. Nutrient-matrix reaction: The added nutrient must not react with any component of the milk. For example, iron is a pro-oxidant and can accelerate the development of fat rancidity, destroy some of the vitamins and form coloured products. 4. Shelf-life & packaging: Many of the fortified milk and milk products may have limited shelf life and thus may need different types of packaging which can be either oxygen impermeable or opaque to light. This is particularly true for the fortification of liquid milk with vitamin A as vitamin A fortified milk develops off flavour within 6 h when exposed to light, compared to 12 h for control (Fellman et al, 1991). All the fortified products require proper labelling on the pack. 5. Process considerations: The stability of all the vitamins is well known during various processing conditions and the same knowledge can be applied while processing the vitamin fortified milk. 6. Cost factor: Cost may not be a crucial factor in the manufacture and marketing of fortified milk and milk products. 7. Safety factor: There should be sufficient insurance against excessive intake of the fortificant. Unlike water soluble vitamins, fat soluble vitamins exhibited toxicity at higher concentrations. Conclusion Fortification should not alter the organoleptic properties (taste, smell, colour, consistency) and shelf life (conditions related to storage, transport) of the product. Often there is a delicate balance between bioavailability and other properties of fortified food. Milk and milk products provide a convenient and useful vehicle for fortification with micronutrients. The risks associated with fortification are minimal except if good manufacturing practices are not followed and only isolated incidents of this type have ever been reported. Improved understanding of interactions between food ingredients and health and ingenuity of food technologists in food formulation and fabrication will contribute to the advances in food fortification. Table 1: Micronutrient content of cow milk vs recommended dietary allowances (RDA) Micronutrient Quantity /Litre RDA Men Women Vitamin A (IU) 1300 1000 800 Vitamin D (IU) 42 5-10 5-10 Vitamin E (IU) 1.5 10 8 Vitamin K (Ојg) 41 45-80 45-65 Vitamin B1(mg) 0.4 1.5 1.1 Vitamin B2 (mg) 1.7 1.7 1.3 Vitamin B6 (mg) 0.4 2 1.6 Folic acid (Ојg) 62 200 180 Niacin (mg) 1 19 15 Vitamin B12 (mg) 3 2 2 Vitamin C (mg) 15 60 60 Iron (mg) 0.52 28 30 Calcium (mg) 1300 400 400 Copper (mg) 0.1 2.2 2.2 4 15.5 15.5 Zinc (mg) (OMNI, 2001) 33 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Table 2: Micronutrient content of cow milk vs recommended overages Micronutrient Quantity /Litre Recommended Overages (%) Pasteurised UHT Dry Milk Milk Desserts Vitamin A (IU) 1300 20 30 40 20 Vitamin D (IU) 42 20 30 40 20 Vitamin E (IU) 1.5 10 30 20 10 Vitamin K (Ојg) 41 - - - - Vitamin B1(mg) 0.4 25 50 20 25 Vitamin B2 (mg) 1.7 15 40 20 15 Vitamin B6 (mg) 0.4 30 30 20-30 30 Folic acid (Ојg) 62 20 40 40 20 Niacin (mg) 1 15 20 20 15 Vitamin B12 (mg) 3 15 30 40 20 Vitamin C (mg) 15 30 100 50 30 Iron (mg) 0.52 5 5 5 5 Calcium (mg) 1300 5 5 5 5 Copper (mg) 0.1 - - - - 4 - - - - Phosphorus (mg) 960 - - - - Iodine (Еіg) 237 - - - - Zinc (mg) (OMNI, 2001) References Anderson, H. C. and Thomas, E. L. (1974) Fortification of fluid milk products with ascorbic acid. J Dairy Sci. 57:5. Bector, B.S. and Rani, S. (1998) A methodology to fortify low fat milk with vitamin A without using a homogenizer. Indian J. Dairy Sci. 51: 69-72. Bender, A. E. (1993) Food fortification. In. Encyclopedia on Food Science, Food Technology and Nutrition. Vol 3. p.19901993. Bullock, D. H., Singh, S. and Pearson, A. M. (1968) Stability of vitamin C in enriched commercial evaporated milk. J. Dairy Sci. 51: 921-923. Conochie, J. (1958) The stability of sodium ascorbate in evaporated milk. Australian J. Dairy Technol. 80-82. Cornell University: Dairy Science Facts (1999) Vitamin fortification of fluid milk. Department of Food Science, Stocking Hall, New York. Edmondson, L. F., Douglas, F. W. and Avants, J. K. (1971) Enrichment of pasteurized whole milk with iron. J. Dairy Sci. 54: 1422-1426. Elliott, J. G. (1999) Application of antioxidant vitamins in foods and beverages. Food Technol. 53: 46-48. El-Sayed, M. M., Abd-Rabou, N. S., Sayed, A. F. and El-Samragy, Y. A. (1995) Iron fortification of processed Ras cheese. Egyptian J. Dairy Sci. 35: 289-298. FAO (1995) Micronutrient fortification of food: Technology and quality control. FAO Technical Consultation of Food Fortification: Technology and Quality Control. Rome, Italy, 20-23 November. Fellman, R.L., Dimick, P,S and Hollender, R. (1991) Photooxidative stability of vitamin A fortified 2% low fat milk and skim milk. J. Food Protection 54:113-116. Food and Nutrition Board (1973) General policies in regard to improvement of nutritive quality of foods: policy statement. National academy of Sciences Washington DC. p. 6. Food Fortification Roundtable. (1996) Food Technol. 86-94. Ford, J. E., Porter, J. W. G. and Thompson, S. Y. (1974) Influence of added ascorbic acid on the stability of folic acid and vitamin B12 in milk during UHT processing and subsequent storage. Proceedings 19 th Intr. Dairy Congress, 567569. Goldscher, R. L. and Edelstein, S. (1996) Calcium citrate: A revised look at calcium fortification. Food Technol. 96-98. Graham, D. M. (1974) Alteration of nutritive value resulting from processing and fortification of milk and milk products. J. Dairy Sci. 57: 738-745. Head, M. K. and Hansen, A. P. (1979) Stability of L- ascorbic acid added to whole, chocolate, and low fat milks. J. dairy Sci. 62: 352-354. Hekmat, S and McMahon, D.J. (1997) Manufacture and quality of iron fortified yoghurt. J. Dairy Sci. 80: 3114-3122. 34 Fortification of Milk and Milk Products for Value Addition Hekmat, S. and McMahon, D. J. (1997) Manufacture and quality of iron fortified yoghurt. J. Dairy Sci. 80: 3114-3122. Hicks, T. Hansen, A. P. and Rushing, J. E. (1996) Procedures used by north Carolina dairies for Vitamins A and D fortification of milk. J. Dairy Sci. 79: 329-333. Ilic, D. B. and Ashoor, S. H. (1988) Stability of vitamins A and C in fortified yoghurt. J. Dairy Sci. 71:1492-1498. Indyk, H., Littlejohn, V. and Woodland, D. C. (1996) Stability of Vit D3 during spray drying of milk. Food Chem. 57: 283-286. Jackson, L. and Lee, K. (1991) Microencapsulated iron for food fortification. J. Food Sci. 56: 1047-1050. Johnson, L. E. (1994) Vitamin and mineral fortification in foods. Food Technol. 124. Kiran, R., Amma. M. K. P. and Sareen, K. N. (1977) Milk fortification with a system containing both iron and ascorbic acid. The Indian J. Nutr. Dietet. 14:260-266. Kiran, R., Kaur, I. P. and Vaneja, K. (19860 Studies on the acceptability and availability of fortificants present in milk and whey. J. Food Sci. 23: 110-111. Labin-Goldscher, R and Edelstein, S (1996) Calcium citrate: a-revised look at calcium fortification. Food Technol. 96-97. Lopez, G. B., Terre, J. M. Q., Lopez, B. G. and Terre, J. M. Q. (1996) Calcium enrichment of skim milk subjected to UHT treatment. Almentaria 34: 79-82. McNamara, S. H. (1995) Food fortification in United States: a legal and regulatory perspective. Nutr. Reviews 53: 140144. Mertz, W. (1997) Food fortification in United States. Nutr. Reviews 55: 44-49. Mortensen, B. L. and Gotfredsen, P. (1996) Fortification- nutritional improvement of dairy products. Danish Dairy Food Industry..worldwide 64-65. Newsome, R.L. (1997) Use of vitamins as additives in processed food. Food Technol. 163-168. Nordmark, B. (1999) A brief history of fortification. Food Technol.15-16. OвЂ™Brien, A. and Robertson. D. (1993) In. The technology of vitamins in Food. P. Berry Ottaway (Ed.) p-30. Olivares, m., Pizarro, F., Pineda, O., Name, J. J. Hertrampf, E. and Walter, T. (1997) Milk inhibits and ascorbic acid favors ferrous bis-glycine chelate bioavilability in humans. American Society Nutr. Sci. 1407-1411. OMNI/Roche/USAID (2001) Fortification basics: Milk. http://www. roche.com Rao, B. V. R. and Mathur, B. N. (1988) Stability of vitamins A, D and E in spray dried infant formula during storage. Indian J. Dairy Sci. 41:86-88. Richardson, D. P (1990) Food fortification. Proceedings of the Nutrition Society. 49: 39-50. Rosenthal, I., Rosen, B. and Bernstein, S. (1993) effects of milk fortification with ascorbic acid and iron. Milchwissenschaft 48: 676-679. Saini, S. P. S., Jain, S. C. and Bains, G. S. (1987) Effect on iron fortification on flavour of buffalo milk. Indian J. Dairy Sci. 40: 88-93. Sloan, A. E. and Stiedemann, M. K. Food Technol. 100-108. Subbulakshmi, G. and Nai(1996) Food fortification: from public health solution to contemporary demand. l, M. (1999) Food fortification in developing countries- current status and strategies. J. Food Sci. Technol. 36: 371-395. Sweeney, M. A. and Ashoor, S. H. (1989) Fortification of cottage cheese with vitamins A and C. J. Dairy Sci. 72: 587590. Tateo, F., Bononi, M., Testolin, G., Ybarra, L. and Fumagalli, M. (1997) Experiments in the use of calcium and magnesium lactates in milk enrichment. Industrie-Almentari 36: 614-617. Vahcic, N., Palic, A. and Ritz, M. (1992) Mathematical evaluation of relationship between copper, iron, ascorbic acid and redox potential of milk. Milchwissenschaft 47:228-230. Weaver, C.M. (1998) Calcium in food fortification strategies. Int. Dairy J. 8: 443-449. Ziegler, E. E. and Fomon, S. J. (1996) Strategies for the prevention of iron deficiency: iron in infant formulas and baby foods. Nutr. Reviews. 54: 348-354. 35 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Packaging of Value Added Foods and Their Storage Stability P. P. Gothwal Central Food Technological Research Institute, Reseach Centre, Lucknow Introduction India produces nearly 300 million MT of food products which comprise cereals, pulses, fruits, vegetables, mushrooms, algae, spices and plantation, meat, fish, poultry, milk and dairy based products. It is estimated that nearly 30% of produce is lost due to poor handling, processing and packaging. In the present scenario packaging has been identified as an integral part of processing in the food industry. Packaging sector is an important global industry representing about 2% of GNP of developed countries. The value of packaging industry is expected about 345 Million Euros world wide with 50% for packaging of food materials. Scientific method of packaging and safe transportation of food materials plays a significant role in reducing the post harvest processing losses. Food, both in its fresh and processed form needs appropriate packaging to facilitate storage, preservation, transportation and distribution. Packaged foods offer enormous export opportunities and foreign exchange earnings to the country. Research and development in the area of food packaging has resulted in building up a database on deteriorative characteristics and packaging needs of a large number and varieties of food products stored under different environmental conditions. Accelerated testing conditions drastically cut down the time required to identify suitable packaging materials to increase shelf life of processed food products under various controlled conditions. Packaging is a coordinated system of preparing food for transportation, distribution, storage, retailing and end use. It is mean to ensure safe delivery of product to the ultimate consumer in sound condition at minimum cost. Projected growth rate of demand and consumption for packaging in India is 10%. Value added processed food products comprising of fruits & vegetables based, cereal and pulses based, meat/fish/poultry based products, milk and dairy based products need specialized types of packages depending upon the type of preservation method used and extent of storage desired. All successful food processing industries continually develop and launch new value added products with new attracting packaging. To ensure that these new value added products perform well in the market, the food industries have to follow product development with food packaging procedures, which maximize their chances of success and reduce their risk of failure. Some food is made possible by the introduction of new technology and new packaging technologies. New or latest technologies under active development or in the early stages of adoption as such can be expected to impact on the type of value added products developed in the future. Different packaging materials: Packaging of fresh produce in consumer unit packs at the producing centers or terminal markets protects the produce against damage and excess moisture loss. The packaging materials used i) should have sufficient permeability to oxygen, carbon dioxide and water vapor ii) should have desired protective physical properties, iii) should be transparent. The permeability requirement depends upon rate of respiration of the produce, the package bulk density and temperature of storage. Food packaging can be categorized in to primary, secondary and tertiary types. вЂў Primary packaging is the material that first envelopes the product and holds it. This usually is the smallest unit of distribution or use and is the package which is in direct contact with the contents. Primary packaging is the main package that holds the food that is being processed. вЂў The secondary packaging is outside the primary packaging, perhaps used to group primary packages together. Secondary packaging combines the primary packages into one box being made. Corrugated fiber board is most commonly used to make secondary shipping cartons. 36 Packaging of Value Added Foods and Their Storage Stability вЂў Tertiary packaging is used for bulk handling, warehouse storage and transport shipping. The most common form is a palletized unit load that packs tightly into containers. Tertiary packaging combines all of the secondary packages into one pallet. ExamplesвЂў Form-Fill-Seal packaging вЂў Bag-in-box вЂў Dip-a- sauca packaging вЂў Combi system of packaging вЂў Boil in bag packs вЂў Metals cans вЂў Retort able pouches and trays Packaging material consumption pattern: With changing consumer preferences, the composition of substrate used in packaging industry has also changed. The consumption pattern of various packaging material is shown below: Selection of packaging system for processed foods: вЂў вЂў Drastic changes are seen in the system of food supply. The conventional means of harvesting processing and handling are slowly replaced by improved systems, bringing in modernization. It is obvious that the produce in its natural or value added processed form should also be properly stored, so that it is available during non-seasonal period and in emergency. Material India% Global% Paper and paperboard 40 29 Glass 16 8 Metal 5 19 Plastic 15 39 Others 24 05 The selection of package for a food product is to Source: Indian Institute of Packaging, New Delhi identify the properties of the food, its sensitivity (2010 report) to environment, the length of life desired, the market condition, consumer needs and existing regulation. The technological need is to evaluate the вЂ�product-package compatibilityвЂ™. A product can be sensitive and susceptible to different factors like bio-chemical changes and microbial changes; physical and chemical (including toxic and traces elements), flavor loss, odor pick up, texture, moisture and gases. Packaging used for fresh produce: Corrugated Fiber Board boxes (CFB): These are most commonly used shipping container. Their major attributes are; вЂў Low cost to strength and weight ratio вЂў Smooth non abrasive surface that is minimum bruising damage вЂў Good cushioning characteristics вЂў Excellent printability вЂў Easy to set up and collapsible for storage вЂў Reusability and recycle вЂў Easy handling and stack ability вЂў Can be turned out quickly in to highly precise and accurate sizes; can be appropriately punched for ventilation and the most acceptable form in international markets. вЂў Most of the perishables exported from India are packed in CFB cartons. вЂў Plastic corrugated boxes: In recent years plastic corrugated boxes made of polypropylene (PP) and high density polyethylene (HDPE) are partly replacing CFB. Its advantage over CFB is low weight to strength ration high degree of wet resistance and its reusability. 37 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Modified atmosphere packaging: MAP is the method for extending the shelf life of perishables by altering the relative proportion of atmospheric gases that surround the food. This is becoming increasingly popular technique to meet both distribution and retailing needs of fruits and vegetables. Modified atmospheric conditions are created inside the packages by the commodities themselves by controlling respiration and selecting suitable permeable films or by using carbon dioxide and ethylene absorbers (scavengers) within the package to prevent the build up of a particular gas. Compounds like hydrated lime, activated charcoal, and magnesium oxide are used to absorb carbon dioxide, iron powder for absorbing oxygen and potassium permanganate, squalene and phenyl methyl silicone for absorbing ethylene within the package. The modified atmosphere desirable for vegetables comprises reduced oxygen (2-3%) and increased carbon dioxide levels (10%). Future scope of tinplate container: вЂў As long as the tin metal exists in the earthвЂ™s crust, tinplate continues to be an ideal packaging material for processed foods and beverages. There is a good scope in reducing the thickness of tin coating if suitable lacquer is coated, which may help in reducing the cost of container. Recycling of tinplate container is another important aspect to be considered. Packages for specific processed food products: Bakery based processed food such as breads, buns, cakes, biscuits, pastries, etc. ensured by very short life. The goal of these products packaging is partial moisture control especially in breads, but the main purpose is to allow the product to be distributed safely and hygienically. Still cakes and pastries are often packs in cardboard boxes. The packaging material recommended for bakery industry is of good quality waked papers, cellophane etc. There is a good scope in the development of good packaging material for bakery and confectionary products. Statutory marking, international packaging regulations: Standards and Regulatory issues are dealt with by multiple agencies: Most of the packaging related regulatory initiatives are concerned with the product quality, public health and hygiene, safety, Export promotion, transportation and consumer protection. BIS : All Agricultural products DMI : Spices, walnuts, casings, fruits and vegetables PFA : Pesticides residues, contaminants EIC : Only export inspection APEDA: Only export standards PPA : Issue of phytosanitary certificates Codex : International standards on processed foods Areas of research and development in food packaging: вЂў Design and development of suitable packages based on processed food products characteristics and performance properties of packaging materials, and finished package forms вЂў Development of economical, flexible packages for processed food/agro based products вЂў Development of indigenous aluminum containers for processed food/agro based products foods and beverages вЂў Pre-packaging and bulk-packaging of fresh as well as processed produce вЂў Safety evaluation of packaging components and plastic packaging materials for food contact applications Development of environment-friendly packaging materials today need вЂў вЂў 38 Utilization of agricultural waste materials and eco-friendly natural and synthetic materials Development of bio-film from secretion of insects Packaging of Value Added Foods and Their Storage Stability вЂў Design and fabrication of packaging machinery such as bio-plate making machine вЂў Development of vacuum packaging equipment; volumetric machine for filling free-flowing solid materials; continuous heat sealers for flexible films; and vibration testers with variable amplitude вЂў Functional and economical (and suitable for marketing and distribution) package design for a variety of processed food products including traditional foods, infant foods, bakery and confectionery products вЂў Design of transport packages for fresh produce and processed foods, and development of costreduction techniques in transport package design вЂў Development of computer-aided package design techniques вЂў Modeling and computer simulation of package performance вЂў Standardization of process schedules for thermal processing of foods in cans, glass, tin-free steel and aluminum containers, and retort able pouches based on heat penetration studies and sterilization value вЂў Development of quality standards and government regulation Work carried out at CFTRI: вЂў Technology packages for convenient and ready-to-eat foods вЂў Economical and functional packages to contain edible oils and fats вЂў Shelf-life prediction methods and generation of data on flexible packaging вЂў Materials вЂў Process modification and in-retort exhaust-cum-sterilization system for вЂў Heat processing of food products in plastic containers вЂў Transport package from traditional indigenous materials вЂў Improvements in metal containers for processed food products and beverages вЂў Migration aspects of plastic constituents into food simulants under use conditions вЂў Development of rigid aluminum containers for packaging of processed foods and beverages вЂў Development of bulk packages for storage and transportation of commercially important fruit and vegetables вЂў Studies on the suitability of alternatives to tin plate containers for packing processed food products Technical services offered for: вЂў Unit packages, transport packages, fresh-produce packages; packaging materials; computeraided and graphic package designs; fabrication of canning and other packaging machinery вЂў Sorption isotherm studies and shelf-life studies in controlled environments for inland and export markets вЂў Thermal processing of foods: Establishment of processes and evaluation of containers вЂў Testing of packaging materials for their physico-chemical properties, safety and transport worthiness вЂў Migration testing for food-grade quality of plastic packaging materials вЂў Evaluation of finished packages for performance under simulated storage and distribution conditions вЂў Routine quality control services 39 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Novel Technologies for Processing and Packaging of Health Foods and Beverages H. N. Mishra Indian Institute of Technology, Kharagpur Introduction Food is basically energy вЂ“ a form of solar energy - stored in plant and animal foods in chemical forms. On consumption, this stored form gets converted to physiological energy. Processing and storage of food become imperative because availability of food is mostly seasonal, whereas its consumption goes on throughout the year unfettered by any types of seasonal bounds. Over the last five decades, India has made great strides in the production of food grains, milk, fruits and vegetables etc., and there is semblance of self-sufficiency, albeit fragile in view of the burgeoning population. Even so, the net amount of the produce for consumption is further reduced due to insufficient storage and processing. Food processing industry is one of the largest manufacturing industries worldwide and possesses global strategic importance. With the advancement of science and technology, new food processing technologies are capturing the attention of many scientists in academia and industry. Consumers prefer high-quality foods with longer shelf life and, clearly, some of the new technologies can meet these demands. Newer strategies have been devised to modify the existing food processing techniques and the adoption of novel processing technologies. In industrialized countries the market for processed foods is changing. Consumers no longer require a shelf life of several months at ambient temperature for the majority of their foods. Changes in family lifestyle, and increased ownership of freezers and microwave ovens, are reflected in demands for foods that are convenient to prepare, are suitable for frozen storage or have a moderate shelf life at ambient temperature. There is also an increased demand by some consumers for foods that have fewer changes during processing and thus either closely resemble the original material or have a healthy image. New preservation technologies, such as high pressure processing and pulsed electric fields offer advantages in meeting consumer demands of freshness, convenience and safety. Minimally processed foods In recent years the consumers have become more health conscious in their food choices but have less time to prepare healthful meals. As a result the market demand for вЂњminimally processedвЂќ or вЂњlightly processedвЂќ foods has rapidly increased. Consumers increasingly demand foods which retain their natural flavor, colour and texture and contain fewer additives such as preservatives. In response to these needs, one of the most important recent developments in the food industry has been the development of minimal processing technologies designed to limit the impact of processing on nutritional and sensory quality and to preserve food without the use of synthetic additives. Minimal processed foods have been defined as products that include all the operations which add some value to conventional food preservation processes like washing, selecting, peeling, slicing, chopping, coring and packaging that cause fewer possible changes in food quality and maintain their quality attributes similar to those of fresh produce, but at the same time provide the food enough useful life to transport it from production site to the consumer. Minimal processed foods may be meant for direct consumption or can be later transformed in to the final products by any conventional techniques. The demand for minimally processed, easily prepared and ready-to-eat вЂ�freshвЂ™ food products, globalization of food trade, and distribution from centralized processing pose major challenges for food safety and quality. Recent food-borne microbial outbreaks are driving a search for innovative 40 Novel Technologies for Processing and Packaging of Health Foods and Beverages ways to inhibit microbial growth in the foods while maintaining quality, freshness, and safety. One option is to use packaging to provide an increased margin of safety and quality. The next generation of food packaging may include materials with antimicrobial properties. These packaging technologies could play a role in extending shelf-life of foods and reduce the risk from pathogens. Antimicrobial polymers may find use in other food contact applications as well Traditional thermal processing techniques can be both beneficial to foods in such areas as preservation and flavor formation but detrimental in damaging other sensory and nutritional properties. Minimizing undesirable changes can be achieved in a number of ways, whether through more effective process control, the use of High Temperature Short Time (HTST) techniques such as aseptic processing, or newer technologies such as volume heating methods. The various approaches and the range of technologies such as infrared heating, dielectric methods such as the use of microwaves, and ohmic heating is complemented by the following alternatives to thermal processing, ranging from irradiation to high pressure processing and the use of pulsed electric fields. Ultrasound method (USM) Ultrasound is probably the most simple and most versatile method for the disruption of cells and for the production of extracts. It is efficient safe and reliable. Ultrasound techniques have the relatively low cost and robust process. Ultrasound cavitation creates shear forces that break cell walls mechanically and improves material transfer. This effect is being used in the extraction of liquid compounds from solid cells. The compound to be dissolved into a solvent is enclosed in an insoluble structure. In order to extract it, the cell membrane must be destructed. For the purpose, ultrasound is faster and more completed than maceration or stirring. The particle size reduction by the ultrasonic cavitation increases the surface area in contact between the solid and liquid phase, significantly. The mechanical activity of this technique enhances the diffusion of the solvent into the tissue; Ultrasound breaks the cell wall mechanically by the cavitation shear forces at it facilitate the transfer from the cell into the solvent. This technique has potential advantages over other techniques including freedom from radiation hazards, which may appear in some of the existing nondestructive methods. The presence of the small gas bubbles in a sample can greatly attenuate ultrasound making signal detection impossible. This can be solved by using reflection Figure 1 Ultrasound set up for crystallization measurements rather than transmission measurement. Figure 1 shows an ultrasound set up for crystallization. In United States, ultrasound techniques are being used for processing of fresh juices like oranges, mango, grape fruit, plum, purees, sauces and dairy products. Oil extraction from oil seed, cell membrane permeabilization of fruits like grapes, plums and mango, extraction of lipids and proteins from plant seeds such as soybean, extraction of phenolic compounds from vascular structures by disrupting plant tissues etc are also achieved by this method. The most effective use is for microbial and enzyme inactivation. This technique is used even in the emulsification, dispersing and homogenizing as well as to improve chemical reactions and surface chemistry or to influence crystallization process. Oscillating Magnetic Fields (OMF) Inactivating microbes has the potential to pasteurize food with an improvement in the quality and shelf-life compared to conventional pasteurization processes. Strong static or oscillating magnetic fields (5-50 TesLa) have the potential to inactivate the vegetative microorganisms. The impulse duration is in between 10us and several milliseconds and the frequencies are maximally 500 MHz because above this items begin to warm up noticeably. The preservation of foods with oscillating magnetic field involves sealing of foods in a plastic bags and subjecting it into 1-100 pulses in can OMF at temperature of 0В°C to 50В°C for a total exposure time ranging from 25 to 100 minutes and for this no special preparation of food 41 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance is required. Magnetic field treatments are carried out at atmospheric pressure and at a temperature that stabilizes the food material. It does not have any influence on the organoleptic properties as the temperature raises only 2-5В°C. High pressure processing (HPP) In this food processing method the food is subjected to very high pressure (up to 8.4 kg/cm2) to kill bacteria present in the raw food. This technique can improve food safety by destroying the bacteria that can cause food borne illness and spoilage and parasites that causes diseases. High pressure works like heat to kill bacteria, but the food remains fresh and rich. In a typical process, pre-packaged raw product is placed in a pressure chamber and subjected to very high pressures for specific time (< 10 minutes). This process causes high changes in the characteristics of food. The foods can be kept for a longer period under better condition. Small molecules which are the characteristics of flavouring and nutritional components typically remain unchanged by pressure. These pressure processed foods have better texture, nutrient retention and colour compared to heat processed foods. Any food with sufficient moisture can be subjected to high pressure processing. This technique can be used to process both the Figure 2 : A typical high-pressure processing liquid and solid foods expect for food materials containing system for treating pre-packaged foods large quality of air pockets. This technique was first time used by Royer (1895) to kill bacteria and subsequently in 1899 by Hite to see its effect on milk, meat, fruits and vegetables. In Japan, in 1990 first commercial products like fruit juices, jams, fruit topping and tenderized meats were introduced. HPP treatment consumes less energy e.g. energy required pressurization at 400 MPa is equivalent to heating the same material at 300 В°C. The main benefits of HPP in food processing include inactivation of microorganisms, structural modification of biopolymers and depression of freezing point of water. These could be used advantageously in several segments of food industry including sea food meat and meat industry. Since 1990 onwards, in Japan, HPP treated jam prepared from strawberries, kiwi fruit and apples are available without any application of heat treatment. HPP treated orange juices, pickles, soybean paste, rice, seaweeds are available in Japanese markets. The key components of a high-pressure system are the pressure vessel, pressurizing system, and ancillary components (Figure 2). The processing by HPP is carried out usually in a low compressibility liquid such as water. The second principle is that of Lechatelier which states that phenomenon of phase transition chemical changes etc are accompanied by decrease Figure 3: Schematic representation of microwave drying process in volume are favoured by pressure and vice versa. Pressure influences most biochemical reactions occurring in foods since they often involve a change in volume. Pressure may also inhabit the availability of energy by affecting energy producing enzymatic reactions. 42 Novel Technologies for Processing and Packaging of Health Foods and Beverages Microwave processing The increasing consumer demands for foods which offer more convenience in usage and time savings in preparation made microwave over as an alternative for conventional thermal ovens. The microwave processing has been made use of for drying of fruit juices, pulps, apple segments and finished drying of potato chips. Microwaves are endowed with some special characteristics such as, high penetrating quality which results in the uniform heating of materials, selective absorption of radiation by liquid water and capacity for easy control. These impart some unique effects to the dehydrated material such as improved quality and good texture. In the wider field of preservation, microwaves have been used in drying, blanching and vacuum drying. Typical product areas where microwaves have been used commercially include blanching of vegetables, where it is claimed that there is less need for mechanical handling with consequent better product. Also, microwaves in combination with hot air have been shown to be a positive route to drying of food stuffs, in selective product areas, where, other methods cannot be employed. Finally, microwave vacuum drying has found some outlets in producing fruit juices and meat extracts. By aim of using microwave processing in preservation in general and pasteurization or sterilization in particular is to deliver a more homogeneous heat treatment at a faster rate than conventional method of heating. Figure 3 is a schematic representation of a microwave drying system. Ohmic heating This technology has been around since early 1900s. The food processing researcher, however, began investigating the potential of ohmic heating on food quality and cost and energy savings in 1980s. In this method an AC current is pass through a food sample which leads to generate internal energy in foods. As a result an inside out heating patterns is generated. Ohmic heating is some what similar to microwave heating but with Figure 4: Ohmic heating equipment very different frequencies. The advantage of this technique is that it uniformly heats food with different densities such as chicken soup. The quality product with minimal structural nutritional and organoleptic changes can be produced. Potential application of this technique includes blanching, evaporation, dehydration, fermentation and extraction. It saves significant time energy in hot air and freeze drying of foods and enhances extraction yields some processing operations. The parameters used during ohmic heating such as frequency of alternating current applied voltage and the temperature to which the sample was heated have a significant effect on itвЂ™s success. The electrical conductivity is also a significant factor. The ohmic heating is useful for value added processing, and it has great potential for use in wide variety of food processing operations involving a heat and mass transfer. Ohmic heating equipment is shown in figure 4. Ohmic heating is currently used in Europe, Asia and North America to produce a variety of high quality low and high acid products containing particulates. Electrical resistance heating allows particles and liquids to heat at the same rate and permits the rapid heating of mixtures of high solid fractions. The technique has been applied to a number of food processes, and has recently been developed into a commercial process for the sterilization of food mixtures. Ohmic heating occurs, when an electric current is passed through an electrically conducive product. Low frequency current from domestic supply could be effectively used for ohmic heating. The ohmic heating has many advantages over conventional heating. Continuous processing is possible without any heat transfer surface. Liquid-solid mixture can be rapidly and evenly heated with minimal heat damage and residence time difference. Nutrient retention will also be more. This process can obtain fresher-tasting, high quality products with high microbiological safety. Maintenance cost is minimum due to absence of any moving parts. The process is easy to control. Ambient temperature storage and distribution is possible when combined with an aseptic filling system. 43 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Membrane technology With the inception of new composite membranes and tubular system, reverse osmosis (RO) and ultra filtration (UF) are being used extensively in food and dairy industries. RO is a single phase concentration process which uses a pressure gradient across a semi permeable membrane to squeeze water through membrane. RO process is extremely energy efficient compared to both evaporation and freeze concentration. Ultra filtration uses much lower pressure 1 to 10 bars and much more open membranes, which pass salts, sugars and organics in the molecular range typically from 5,000 to 1,00,000 depending on the membrane type. It is limited by osmotic pressures, since the sugars are not concentrated. Both RO and UF have promising uses in fruit and vegetable juice industry as a unit operation for concentration or aroma recovery and clarification of juices respectively. The primary goal of UF in fruit industry is to replace the holding filtration and decantation steps of traditional process. Enzyme treatment is required to reduce viscosity of juice by partially hydrolyzing. It is Figure 5: A simplified general design of a pulsed electric field apparatus. a clarification process to remove pectin, enzyme and other fibrous components, constituting the clear juice. For separation of molecules, semi permeable membrane is used at a temperature of 50 -55 В°C (high) on 10-15 В°C (low), depending on the type of juice and sensitivity. Tubular modules can be used for viscous partially depectinized juice whereas where as pre filtration of juice is necessary when this channel on boiled fibre UF system is used. Many case studies have done on apple juice. UF system generates cost savings and manpower reduction, uses only electrical energy to raise the pressure of juice feed, operating costs are typically 5-10 times Figure 6: Treatment chamber with different electrode geometries lower than normal operations, process control and enhanced electric fields in the insulator channel is simple, no cooling water equipment is needed and products have better flavour. In nutshell, UF has become economical viable alternative for clarification of juice in comparison to conventional method of clarification. RO is a well established process for concentration/pre concentration of raw and clear depectinized juice from fruits and vegetable. It consumes 10 times less energy for renouncing water when compared with conventional evaporators. Figure 7: Continuous PEF chamber with baffles 44 Novel Technologies for Processing and Packaging of Health Foods and Beverages Pulsed electric field (PEF) It was in US where in 1920s first attempt to treat milk with electro impulse was made. Further, experimentations followed in the 1960s primarily with in molecular biological research for incorporation of foreign gene materials into microorganisms. This technique involves application of pulse of high voltage (typically 20-80 KV/cm) to foods placed between two electrodes. Only pumpable food products can be treated. This is the more novel process. PEF imposes a strong electric field on a flowering fluid for a very short time. Above critical field strength of about 15,000 V/cm, vegetable cells are killed. Generally higher field strength up to about 35,000 V/cm for disinfection like destruction of bacteria, fungi and other microbes. When exposed to high electric field pulses, cell membranes develop pores either by enlargement of existing pores or by creation of new ones. The pores increase membrane permeability allowing loss of cell contents or inclusion of surrounding media either of which can cause cell death. It has limited effect on pores and only appears to affect a few enzymes. Figure 5 shows a simplified design of pulsed electric field and figures 6 and 7 describe different electrode geometries in the treatment chamber and Continuous PEF chamber with baffles respectively. PEF offers a five log reduction of most pathogens and is considered as a pasteurization process so products must be refrigerated. PEF also applies to fruit and vegetables cell well, concentration of sewage sludge. It kills live cells and reduces their ability to retain water, greatly improves filtration. Extraction of sugars from beats and starches from potatoes can also be improved by PEF. The important process variables of PEF include the electric field, temperature, pressure and time of exposure. PEF units differ primarily in their fluid handling capacity: OSU-4, has 0.5-1.0 cm diameter tubing; OSU-5, has 1 cm diameter tubing; and OSU-6, has 1-1.2 cm diameter tubing. Food irradiation Food Irradiation is the new addition to the methods of food preservation. A great deal of work is being carried out at the utilization of ionizing radiation. The irradiation of foods does destroy the microorganisms and enzymes. It may be desirable to inactivate some enzymes by other means, in complementation to irradiation action. Irradiation does not leave any residue in foods like chemical and hence is safe. The sterilization of food with ionizing radiation involves a major consideration, the food products and suitable radiation source, since the temperature remains 4-50C. It is also called вЂњcold sterilizationвЂќ technique. These techniques in controlling the ripening process of fruits and also for checking sprouting of roots, tubers and bulbs apart from general food preservation techniques. Modified atmosphere packaging (MAP) and controlled atmosphere storage (CAS) The main objective of modified atmosphere packaging (MAP) is to interrupt or slow down the derivative processes and also to prevent the attack of pathogens until the food is consumed. Controlled atmosphere (CA) is the alteration of the natural gaseous environment and maintenance of this atmosphere at pre specified conditions throughout the storage time. Modified atmosphere (MA) is the initial alteration of the gaseous environment in the immediate vicinity of stored and packaged product. These are used for retail distribution and for consumer product packages. The CA and MAP extend the shelf life of the product. Lot of work has been carried out and further research is on. RTE health foods In our country processed food product are available in both organized and unorganized sectors. Developments in production technology, emergence of new products like ready-to-eat (RTE) mixes, enhancement of product shelf life and packaging are driving the shift from the non organized to organized commercial business. Due to growing urbanization and changing food habits, the demand has been rising at a good pace and there is enough latent market potential waiting to be exploited through developmental efforts. It is high time for the organized sector to take initiative in technology improvement, process modeling and automation, overall improvement in quality, investment in R&D to develop new products and enhance shelf life of existing products and further 45 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance improvement in packaging. The size of the industry might increase substantially if the product portfolio were to include at least one each of the daily staples; ready chapatti from the chapatti-subzi staple and precooked or concentrated dal from the dalвЂ“chawal combination. India is a vast country with different eating habits and yet North Indian cuisine is an acceptable restaurant fare and the ubiquitous idli and dosa are available in every part of country. From dishes consumed throughout the country at different eating occasions of breakfast, lunch, tea time and dinner, it should be possible to systematically examine similarities and come up with a short list of products that would find a place in the menu of a major part of the country, which could then be developed as processed food. The Western concept of hamburger or a sandwich and its local equivalent chapatti-subzi takeaways cooked in perceived hygienic surrounding are a boon for the working women and can be nurtured into big business. With the increasing dominance of large and technically more sophisticated companies in food processing, attention also should be paid to small operations, which do not enjoy the same economies of scale. To this end, an increase in the number of regionally centralized facilities offering the latest processing technique and advice should be encouraged. It would be necessary to develop the appropriate technology to produce an authentic product, with low cost or reusable packaging and an efficient distribution system to market them at an acceptable price. The prime aim will be to provide all consumers with increasing levels of convenience. Health / nutritional benefits of functional foods During recent years importance of B-complex vitamins, beta-carotene and vitamin C has been realized in terms of their antioxidative and anticarcinogenic properties. Fruits and vegetables are the rich sources of these vitamins. Fermented foods and beverages possess various nutritional and therapeutic properties. Lactic acid bacteria play a major role in determining the positive health effects of fermented milks and related products. The L. acidophilus and Bifidobacteria spp are known for their use in probiotic dairy foods. Cultured products sold with any claims of health benefits should meet the criteria of suggested minimum number of more than 106 cfu / g at the expiry date. Other health benefits of fermented milk products include prevention of gastrointestinal infections, reduction of serum cholesterol levels and anti -mutagenic activity. They are recommended for lactose intolerant individuals and patients suffering from atherosclerosis. Health claims Health claims describe a relationship between a food, food component, or dietary supplement ingredient, and reducing risk of a disease or health-related condition. There are three ways by which FDA exercises its oversight in determining which health claims may be used on a label or in labeling for a food or dietary supplement: (i) the 1990 Nutrition Labeling and Education Act (NLEA), (ii) the 1997 Food and Drug Administration Modernization Act (FDAMA) and (iii) the 2003 FDA Consumer Health Information for Better Nutrition Initiative. Such health claims must be qualified to assure accuracy and non-misleading presentation to consumers. FDA authorizes these types of health claims based on an extensive review of the scientific literature, generally as a result of the submission of a health claim petition, using the significant scientific agreement standard to determine that the nutrient/ disease relationship is well established. Nutrient content claims Nutrient content claims describe the level of a nutrient or dietary substance in the product, using terms such as free, high, and low, or they compare the level of a nutrient in a food to that of another food, using terms such as more, reduced etc. An accurate quantitative statement (e.g., 200 mg of sodium) that does not вЂњcharacterizeвЂќ the nutrient level may be used to describe any amount of a nutrient present. Structure/ function claims Structure/ function claims describe the role of a nutrient or dietary ingredient intended to affect normal structure or function in humans, for example, вЂњcalcium builds strong bonesвЂќ. In addition, they 46 Novel Technologies for Processing and Packaging of Health Foods and Beverages may characterize the means by which a nutrient or dietary ingredient acts to maintain such structure or function, for example, вЂњfiber maintains bowel regularity,вЂќ or вЂњantioxidants maintain cell integrity,вЂќ or they may describe general well-being from consumption of a nutrient or dietary ingredient. Structure/ function claims may also describe a benefit related to a nutrient deficiency disease (like vitamin C and scurvy), as long as the statement also tells how widespread such a disease is in the United States. Technology of formulation of health foods There are several methods of manufacturing functional foods, based either on the method used to produce them or on their purpose. Functional foods may be processed by modification or they may be fortified with different substances and the functionality of a product can be targeted to a special disease or just to improve overall well being. A particular food may be made more functional by increasing or adding a potential health promoting entity. Alternatively concentration of adverse components may be reduced or there may be a partial interchange between toxic and beneficial ingredients. Health drinks are formulated taking into account the nutritional requirements or recommended dietary allowances for the target group. It is not only essential to balance the energy protein and vitamin requirements, but also to make it palatable, sparkling and thirst quenching. Challenges in formulation of health foods There are many obstacles within food system that hinder the development processes of these specific foods. There are considerable processing losses of vitamins, and information on vitamin contents of processed foods is essential for assessing the adequacy of vitamin intakes. Problems associated with the iron fortification of fruit juices and drinks have been outlined as: accelerated loss of vitamin C, flavour and taste deterioration in the presence of thiamine, folic acid, vitamin A and vitamin C, levels of fortification beyond 2.7 mg per serving result in metallic off-flavors, decolourisation of some pigments. Fortification of beverages with calcium has become a popular practice. Insoluble Ca and Mg salts cause lightening of food colour, whereas soluble salts may interact with other food components such as tannins to cause darkening. The prooxidant effect of many minerals has caused rancidity development in lipid containing beverages. In beverages with high protein content, the addition of Ca or Mg salts have caused destabilization of the protein component. The use of soy lecithin to coat calcium ions for use in the calcium fortification of soymilk prevented the Ca induced precipitation of soy proteins. In the production of yoghurt, the low pH conditions render it unsuitable as a carrier for vitamins such as vitamin A. Health foods for control of cardiovascular disease (CVD) & diabetes Functional foods that are marketed with claims to reduce heart disease focus primarily on the risk factors of blood cholesterol, homocysteine and hypertension. This can be done by a reduced content of food components that are known to increase risk, saturated fat or sodium. More recently products have been designed that are enriched in components thought to reduce risk. The most common protective ingredients include fibres, ПЋ-3 fatty acids, phytostanols, phytosterols and (antioxidant) vitamins. Replacement of saturated or trans fat in the diet by carbohydrates or other types of fat reduces the risk of coronary heart disease (CHD). High intakes of tea rich in catechins and other flavonoid polyphenols have also been associated with a reduced risk of CHD. Many well-controlled trials have documented the efficacy of sterols and stanols for lowering low density lipoprotein (LDL) cholesterol. A high consumption of soy protein has been associated with a low risk of cardio vascular disease (CVD) in ecological studies. Besides soy protein, isoflavonones (phytoestrogens) such as genistein might be responsible for the effects on CVD risk. Thus, any dietary pattern combining a high intake of natural antioxidants, a low intake of saturated fatty acids, a high intake of oleic acid, a low intake of ПЋ-6 fatty acids and a high intake of ПЋ-3 fatty acids would logically produce a highly cardio protective effect. Diabetes mellitus is a heterogeneous metabolic syndrome with several different causes characterized by chronic hyperglycaemia with partial or total lack of insulin secretion and a reduced sensitivity to 47 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance the hormone in peripheral tissues. If monitored inadequately and associated with other lipid and protein disorders, long term complications may develop in several organs and systems, resulting in both high morbidity and mortality rates. Type 1 diabetes is the result of complete ОІ-cell destruction. Type 2 diabetes is the primary result of either insulin resistance or deficiency in insulin secretion, and having a completely different clinical perspective and presentation is usually characterized by a mixture of the two. It has been suggested that for type 1 diabetes an early exposure to cowsвЂ™ milk proteins may play a role in triggering the immune response that destroys pancreatic ОІ-cells. In general a good nutritional diet that is low in fat and salt is important. For someone with type 1 diabetes, regular meal times and snacks and the right proportion of nutrients should be emphasized. Someone with type 2 diabetes, where in most cases weight reduction is necessary, not only should consider calorie intake but also the component and type of food that is eaten. Conclusion Improving food technology not only improves health, but reduces poverty. When food products are safe, nutritious, well marketed, and competitively priced thanks to efficient manufacturing, they attract consumers. Rising consumer demand, in turn, expands a nationвЂ™s entrepreneurial base in food products, creating jobs and raising family incomes. Larger family food budgets then contribute to a further drop in malnutrition. New preservation technologies, such as high pressure processing and pulsed electric fields offer advantages in meeting consumer demands of freshness, convenience and safety. There is no single process that will allow the high-quality production of every food product while ensuring safety; all of these processes, as well as thermal processing, have their own set of limitations and advantages. References CГЎnovas, B. G. V, Gongora-Nieto, M.M., Pothakamury, U. R. and Swanson, B. G. (1999). Preservation of foods with pulsed electric fields. 1-9, 76-107, 108-155. Academic Press Ltd. London. Chandrasekhar, U. (2004) Soy proteins - an ideal functional food for growth promotion. Proc Nutr Soc Aust , Vol. 28. Asia Pac J Clin Nutr 2004; 13 (Suppl):S118. GonГ§alo,E. B. (2003) CertificaГ§ГЈo de sistemas de qualidade na indГєstria de laticГnios, Revista do Instituto de Laticinios CГўndido Tostes 58 , (333): 9вЂ“14 http://www.fao.org/ ag/ags/agsi/Nonthermal/nonthermal_1.htm Ilbery, B. and Kneafsey, M. (2000). Producer constructions of quality in regional speciality food production: a case study from South West England. Journal of Rural Studies 16 2 (2000), pp. 217вЂ“230. Ruecroft, G. (2007) Power Ultrasound, Crystals and Particle Engineering, Paper presented in вЂњChemsource Symposium 2007вЂќ during 27th & 28th June at RAI, Amsterdam. Zhang, M and Xu, Y. Y. (2003) Research developments of combination drying technology for fruits and vegetables at home and abroad, Journal of Wuxi University of Light Industry 22, (6): 103вЂ“106. 48 Glycomacropeptide вЂ“ Biological Properties and its Application Glycomacropeptide вЂ“ Biological Properties and its Application Rajan Sharma and Neelima Sharma Dairy Chemistry Division, NDRI, Karnal Introduction Whey proteins have been singled out as a super star ingredient for health promoting products including ones formulated for weight loss, infant nutrition and immune support. The major whey proteins are О±-lactalbumin (О±-la), ОІ-lactoglobulin (ОІ-lg), bovine serum albumin, immunoglobulins and lactoferrin. In addition, sweet whey/rennet whey also contains glycomacropeptide (GMP) which is a C-terminal hydrophilic glycopeptide released from Оє-casein (Оє-CN) by the action of chymosin during cheese making. GMP lacks aromatic amino acids (phenylalanine, tyrosine, and tryptophan), and contains varying amounts of sugars which are made up of N-acetylneuraminic acid (sialic acid or NANA), galactose, and N-acetylgalactosamine. GMP found in sweet whey is an acidic glycopeptide. The bond sensitive to chymosin (rennin) hydrolysis occurs between the phenylalanine (Phe) residue at position 105 and the methionine (Met) residue at position 106. The hydrolytic products are para Оє-CN (residue 1-105) and macropeptide (residue 106-169). Next to ОІ-lg and О±-la, GMP is the most abundant protein/peptide in whey protein isolate (WPI) and whey protein concentrate (WPC) produced from cheese whey with typical concentrations between 20-25% of the proteins (Thoma-Worringer et al., 2006). It is a heterogeneous peptide of 64 amino acids formed by Оє-CN (Delfour et al., 1964). It contains 47% (w/w) indispensable amino acids, but contains no histidine (His), tryptophan (Trp), tyrosine (Tyr), arginine (Arg), cysteine (Cys) or Phe (Laclair et al. 2009). There are four hydrophobic domains in GMP and most of them are masked by the strong charge density of the glutamic acid (Glu) and asparatic acid (Asp) residues over a wide range of neutral and basic pH, therefore the hydrophobic domains cannot interact. Only the N-terminal hydrophobic domain (amino acid 1-5) is not covered by the negative charge and is available for interaction (Kreub et al., 2009). GMP has received much attention in recent years because of its several biological properties. The various biological activities of GMP include its ability to bind cholera toxin and Escherichia coli enterotoxins, inhibition of bacterial and viral adhesion, modulation of immune system responses, promotion of bifido-bacterial growth, suppression of gastric secretions and regulation of blood circulation etc. Further, GMP can find application in various food systems because of its functional characteristics, mainly its high solubility and emulsifying properties. Chemical properties of GMP GMP is one of the various names given to the peptide formed by Оє-CN rupture. This peptide is also known as caseinomacropeptide (CMP) or casein-derived peptide (CDP). Usually GMP refers to the glycosylated form, due to its high carbohydrate content, and CMP to the peptideВґs non-glycosylated form. Its composition varies and depends particularly on the whey source and on the technology used for its isolation (MartГn-Diana et al., 2006). The major chemical properties of GMP include: вЂў Glycosylation; вЂў Isoelectric point and UV absorption; вЂў Molecular weight; вЂў UV Characteristic 1. Glycosylation: The glycosylated form represents 50 to 60% of total GMP and the carbohydrate part is composed of galactose, (Gal) N-acetylgalactosamine (GalNAc) and N-acetylneuraminic acid (NeuAc) (Thoma et al., 2006). The most predominant is NeuAc, known as sialic acid. GMP purified to 49 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 90% is highly glycosylated with 7 to 8% sialic acid (MartГn-Diana et al., 2003). Sialic acid present in the GMP gives the peptide anionic character and may react with other compounds like thiobarbituric acid (TBA) and ninhydrin to give chromophores which can be spectrophotometrically determined. This property can be utilized for the estimation of GMP as the sialic acid content and can be correlated with the GMP concentration. In one approach Nakano and Ozimek (1999) determined the sialic acid content for the estimation of GMP in cheese whey by using TBA. The other approach for the determination of sialic acid content in GMP has been given by the use of acidic ninhydrin by spectrophotometric method (Fukuda et al., 2004). 2. Isoelectric point and UV absorption: The exact isoelectric point of GMP is still unclear. Using anion exchange chromatography Nakano and Ozimek (2000) suggested that all sialylated GMP had an apparent pI < 3.8. GMP is rich in branched-chain amino acids (valine and isoleucine) and it lacks aromatic amino acids, including phenylalanine, tryptophan and tyrosine (Oliva et al., 2002). 3. Molecular weight: Several works have informed that the theoretical molecular weight of GMP is between 7 and 8 kDa. Some authors suggest that GMP has the ability of associating and dissociating under selected pH conditions. Kawasaki et al. (1993a) proposed that the monomer of k-casein GMP of molecular weight 9 kDa is obtained at pH в‰¤ 4 and the polymer of k-casein GMP of molecular weight between 45- 50 kDa is obtained at pH higher than 4. Later, Nakano and Ozimek (1998) also studied the influence of pH on GMP behaviour. Using chromatography in Sephacryl S-200 gel, the authors collected fractions that were monitored for sialic acid. The results suggested that GMP is an aggregate of three monomers and the molecular weight was not affected by changes in pH. Farias et al. (2009) studied self assembly of 3-5% (w/w) GMP at pH 3-6.5 using DLS (Dynamic Light Scattering). The hydrodynamic diameter increased when decreasing the pH from 6.5 to 3. GMP solution at a pH below 4.5 shows time dependent self assembly at room temperature, which over time leads to gelation. Currently there is an overall consensus that the experimental molecular weight of GMP is higher than the theoretical weight. 4. UV Characteristic: Because of the absence of aromatic amino acids, GMP has no absorption at 280 nm. It is known that GMP is only detected in the range of 205-217 nm and differences in the absorption at 210/280 nm are frequently used to characterize GMP (Oliva et al., 2002). Biological activities and nutritional properties Biological activity of bovine GMP has received much attention in recent years. The various physiological functions attributed to GMP include: вЂў Binding of cholera toxin (CT); вЂў Inhibition of bacterial and viral adhesion; вЂў Suppression of gastric secretions; вЂў Promotion of Bifidobacterial growth; вЂў Modulation of immune system response; вЂў Regulation of blood circulation through antihypertensive and antithrombotic activity; 1. Binding of cholera toxin (CT): Kawasaki et al. (1992) showed that GMP is capable of binding CT. Normal Chinese hamster ovary (CHO)-K1 cells are spherical but in the presence of CT, CHO-K1 cells take on a spindle shape. As little as 20 ppm GMP is enough to cause considerable rounding of CHO-K1 cells and 100 ppm GMP results in almost completely rounded CHO-K1 cells which indicate that GMP has bound to CT. When the GMP was treated with sialidase, which hydrolyses the sialic acid, complete loss of CT inhibiting activity occurred. The peptide chain must also participate in the binding as partial loss of CT inhibiting activity occurred after treatment with proteases. CT binding activity of purified GMP from bovine Оє-CN was also detected by Oh et al. (2000) using ELISA. The CT binding activity is rapidly lost by carbohydrase treatment. 50 Glycomacropeptide вЂ“ Biological Properties and its Application 2. Inhibition of bacterial and viral adhesion: Many bacteria and viruses bind themselves to their hosts as a part of the colonization process. Binding to the intestine or other mucosal surfaces is achieved by adhesins, capsular material on the bacterial cell surface or hair-like fimbriae or pili which are specific for the various ceramide and ganglioside glycoconjugates which make up epithelial cell membranes (Simon, 1996). Nakajima et al. (2005) studied the prevention of intestinal infection by GMP. The binding ability of GMP to intestinal pathogenic bacteria was evaluated by a binding assay with biotinylated bacteria. GMP showed the ability to bind to Salmonella enteritidis and enterohemorrhagic E.coli O157:H7. This binding ability was decreased by a sialidase treatment and completely eliminated by periodate oxidation indicating that sialic acid in GMP are involved in binding to the bacteria. Neeser et al. (1988a) investigated the mechanism by which milk components prevent dental caries. They evaluated the role of GMP in inhibiting adhesion of cariogenic bacteria (Streptococcus mutans, S. sanguis, S. sobrinus and Actinomyces viscosus) to oral surfaces. Haemagglutination by S. mutans, S. sanguis and A. viscosus is prevented by GMP with a disaccharide (Gal ОІ1 в†’ 3GalNAc - O вЂ“ R). 3. Suppression of gastric secretions: Guilloteau et al. (1994) while investing the effect of GMP on gastric secretion in preruminant calves found that intravenous injection of GMP had no inhibition of gastric secretion. Beucher et al. (1994b) found that feeding GMP fraction, stimulated the intestinal hormone cholecystokinin which, in turn, regulates gastrointestinal functions. Yvon et al. (1994) demonstrated that GMP acts by triggering receptors on the intestinal mucosa. 4. Promotion of bifidobacterial growth: Supplementation of milk with 2% GMP, either of bovine, ovine or caprine origin increased the counts of Bifidobacterium lactis by 1.5 log cycles after 24 h incubation at 37В°C when compared with unsupplemented milk (Janer et al., 2004). 5. Modulation of immune system response: Splenocyte (spleen lymphocyte) proliferation is a step in the inflammatory response. Inhibition of splenocyte proliferation can be used to demonstrate suppression of an immune response such as an allergic reaction. Research by Otani et al. (1992) demonstrated that casein inhibits mouse splenocyte proliferation induced by the mitogen Salmonella typhimurium lipopolysaccharide (LPS). Inhibitory activity was due to Оє-casein, which upon rennet hydrolysis, results in inhibitory activity being found in the GMP fraction. Para- Оє-casein had no inhibitory activity. Upon sialidase digestion, GMP lost its inhibitory activity, indicating that sialic acid is critical to the phenomenon (Otani and Monnai, 1993). Inhibitory activity was reduced after GMP digestion with chymotrypsin but inhibitory activity increased after GMP digestion with trypsin or pronase so the peptide chain must also participate. 6. Regulation of blood circulation through antihypertensive and antithrombotic activity: Bovine, ovine, and caprine GMP can inhibit platelet aggregation and, therefore, the formation of thrombi, because the region 106вЂ“116 of Оє-casein (casoplatelin) is analogous to the fragment 400вЂ“411 of fibrinogen Оі-chain (Jolles et al., 1986). Peptides with in vitro angiotensin I converting enzyme (ACE)-inhibitory activity were liberated from bovine, ovine and caprine GMP either by proteolysis with trypsin or simulation of the GMP digestion under gastrointestinal conditions (Manso and Lopez-Fandino, 2003). This suggests that intact GMP and its tryptic peptides may play a role in the physiological regulation of blood pressure, although tryptic hydrolysates exhibited higher levels of ACE inhibitory activity than did intact GMP during subsequent digestion, which justifies their use as food components. Along with the above mentioned physiological effects GMP has been found to be beneficial for overall growth and development. GMP is rich in branched-chain amino acids and low in Met, which makes it a useful ingredient in diets for patients suffering from hepatic diseases (Abd El-Salam et al., 1996). Additionally, the fact that GMP has no Phe in its amino acid composition makes it suitable for nutrition in cases of phenylketonuria. Nevertheless, because of its high content of Thr, GMP can cause hyperthreoninemia (Fanaro and Vigi, 2002; Rigo et al., 2001). GMP supplementation has also been found to increas zinc absorption (Kelleher et al., 2003). The sialic acid content of GMP is also interesting in terms of bioactivity. Large amounts of this carbohydrate are found in the brain and in the central nervous system in the form of gangliosides and glycoproteins, which contribute to the functioning of 51 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance cell membranes and membrane receptors and to normal brain development. An in vivo experiment with laboratory animals has shown that the exogenous administration of sialic acid increased the production of ganglioside sialic acid in the brain, improving learning ability (Wang et al., 2001). This effect could also be achieved with dietary GMP (Wang et al., 2004). Functional and technological properties/applications of GMP GMP can also be taken up as a functional ingredient in various speciality products like infant formulas, nutrition bars, medical foods (PKU), diet foods, oral care products and dietary supplements because the development of innovative foods with an additional health benefit is a goal for the food industry. The characteristics of GMP not only permit medicinal and dietary applications, but also give the molecule a great potential as a structural agent for food, since its glycosidic structure suggests emulsifying and foaming properties (Kulozik and Guilmineau, 2003). GMP showed to be stable in the pH range of 1 to 10, with minimal solubility (88%) between pH 1-5 and maximum (98%) between pH 5-10. The emulsifying activity was stronger at acid pH rather than alkaline. After letting the emulsion stand for 24 hours and heating a decrease in the emulsifying activity (22-60%) at pH below 4 (Chobert et al., 1989) was observed. Wong et al. (2006) determined the functionality, foaming capacity and emulsifying activity of GMP after conjugation to fatty acids. The authors observed that the foaming capacity was lost, whereas the emulsifying activity enhanced. The addition of GMP to fermented goat milk favored gel formation in a more orderly and structured manner compared to the addition of whey protein concentrate (MartГn-Diana et al., 2003). However, Veith and Reynolds (2004) verified in their work that the presence of GMP had a negative impact on gel strength and water retention capacity. On the other hand, MartГn-Diana et al. (2005) studied GMP of cow, ewe and goat cheese whey, concluding that GMP had an emulsifying activity, more stable to pH variation, compared to whey protein concentrate. This suggests the possibility to use GMP as an emulsifier in foods that undergo great pH variation during processing, such as fermented dairy products. GMP obtained from goat milk was modified with lactose through Maillard reaction under relative humidity 44% and temperature of 40В°C for periods of 0 to 11 days, thus obtaining different forms of lactosylated GMP. At these conditions, the most abundant form of lactosylated GMP was the Monolactosylated (55-60%), followed by the di-, tri- and tetralactosylated species. Solubility, heat stability and emulsifying capacity of native and modified GMP were investigated. Lactosylation enhanced emulsifying capacity but did not improve the outstanding solubility and heat stability of native GMP (Moreno et al., 2002). References Abd El-Salam, M.H.; El-Shibini, S. and Buchheim, W. (1996). Characteristics and potential uses of the casein macropeptide. Int. Dairy J. 6:327вЂ“341. Beucher, S.; Levenez, F.; Yvon, M. and Corring, T. (1994b) Effect of caseinomacropeptide (CMP) on cholecystokinin (CCK) release in rat. Reproduction Nutrition Development. 34: 613-614. Chobert, J.; Touati, A.; Bertrandharb, C.; Dalgalarrondo, M. and Nicolas, M. (1989) Solubility and emulsifying properties of kappa-casein and its caseinomacropeptide. J. Food Biochem. 13:457-473. Eigel, W.N.; Butler, J.E.; Ernstrom, C.A.; Farrel, H.M.Jr.; Harwalkar, V.R.; Jennes, R. and Whitney, R.M. (1984) Nomenclature of proteins of cowвЂ™s milk: Fifth Revision. J. Dairy Sci. 67:1599-1631. Fanaro, S. and Vigi, V. (2002). Protein quality and quantity in infant formulas: A critical look. Minerva Pediatrica. 54:203вЂ“ 209. Farias, M.E.; Martinez, M.J. and Pilosof, A.M.R. (2010) Casein Glycomacropeptide pH-dependent self assembly and cold gelation. Int. Dairy J. 20:79-88. Fukuda, S.P.; Roig, S.M. and Prata, L.F. (2004) Correlation between acidic ninhydrin and HPLC methods to evaluate fraudulent addition of whey in milk. Le Lait. 84:502-512. Guilloteau, P.; Le Huerou-Luron, I.; Chayviaille, J.A.; Toullec, R.; Legeas, M.; Bernard, C.; Roger, L. and Mendy, F. (1994) Effect of caseinomacropeptide (CMP) on gastric secretion and plasma gut regulatory peptides in preruminant calves. Reproduction Nutrition Development. 34:612-613. Janer, C.; Pelaez, C. and Requena, T. (2004) Caseinomacropeptide and whey protein concentrate enhance Bifidobacterium lactis growth in milk. Food Chem. 86: 263-267. Jolles, P.; Levy-Toledano, S.; Fiat, A. M.; Soria, C.; Gillensen, D.; Thomaidis, A.; Dunn, F.W.; Caen, J.P. (1986). Analogy between fibrinogen and casein: Effect of an undecapeptide isolated from k-casein on platelet function. European J. Biochem. 158:379вЂ“382. 52 Glycomacropeptide вЂ“ Biological Properties and its Application Kawasaki, Y., Isoda, H., Tanimoto, M.; Dosako, S. Idota, T. and Ahiko, K. (1992) Inhibition by lactoferrin and kappacasein glycomacropeptide of binding of cholera toxin to its receptor. Biosci. Biotech. Biochem. 56: 195-198. Kawasaki, Y.; Kawakami, H.; Tanimoto, M.; Dosako, S.; Tomizawa, A.; Kotake, M. and Nakajima, I. (1993a) pH independent molecular weight changes of k-casein glycomacropeptide and its preparation by ultrafiltration. Milchwissenschaft. 48:191-195. Kelleher, S.L.; Chatterton, D.; Nielsen, K. and Lonnerdal, B. (2003) Glycomacropeptide and О±-lactalbumin supplementation of infant formula affects growth and nutritional status in infantis rhesus monkeys. Am. J. Clin. Nutr. 77:1261-1268. Kulozik, U. and Guilmineau, F. (2003) Food process engineering and dairy technology at the Technical University of Munich. Int. J. Dairy Tech. 56:191-198. Manso, M. A. and Lopez-Fandino, R. (2003). Angiotensin I converting enzyme-inhibitory activity of bovine, ovine and caprine k-casein macropeptides and their tryptic hydrolyzates. J. Food Protection. 66:1686вЂ“1692. Martin-Diana, A. B.; Frias J. and Fontecha J. (2005) Emulsifying properties of whey protein concentrate and aseinomacropeptide of cow, ewe and goat. Milchwissenschaft. 60:363-366. MartГn-Diana, A.B.; Gomez-GuillГ©n, M.C.; Montero, P. and Fontecha, J. (2006) Viscoelastic properties of caseinmacropeptide isolated from cow, ewe and goat cheese whey. J. Sci. Food Agric. 86:1340-1349. MartГn-Diana, A.B.; Pelaez, C. and Requena, T. (2003) Rheological and structural properties of fermented goatвЂ™s milk supplemented with caseinomacropeptide and whey protein concentrate. J. Dairy Sci. 86:1535-1540. Moreno, F.J.; LГіpez-FandiГ±o, R. and Olano, A. (2002) Characterization and functional properties of lactosyl caseinomacropeptide conjugates. J. Agric. Food Chem. 50:5179-5184. Nakajima, K.; Tamura, N.; Kobayashi-Hattori, K.; Yoshida, T.; Hara-Kudo, Y.; Ikedo, M.; Sugita-Konishi, Y. and Hattori, M. (2005) Prevention of intestinal infection by Glycomacropeptide. Biosci. Biotechnol. Biochem. 69:2294-2301. Nakano, T. and Ozimek, L. (1998) Gel chromatography of glycomacropeptide (GMP) from sweet whey on Sephacryl S-200 at different pHвЂ™s and on Sephadex G-75 in 6M guanidine hydrochloride. Milchwissenschaft. 53:629-632. Nakano, T. and Ozimek, L. (1999) Purification of glycomacropeptide from non-dialyzable fraction of sweet whey by anion exchange chromatography. J. Biotech. Tech. 13:739-742. Nakano, T. and Ozimek, L. (2000) Purification of glycomacropeptide from caseinate hydrolysate by gel chromatography and treatment with acidic solution. J. Food Sci. 65:588-590. Neeser, J.R.; Chambaz, A.; Vedovo, S.D.; Prigent, M.J. and Guggenheim, B. (1988a) Specific and nonspecific inhibition of adhesion of oral actinomyces and streptococci to erythrocytes and polystrene by caseinoglycopeptide derivatives. Infection and Immunity. 56:3201-3208. Oliva, Y., Escobar, A. and Ponce, P. (2002) CaseinomacropГ©ptido bovino: una alternative para la salud. Rev. Salud Anim. 24:73-81. Oh, S.; Worobo, R.D.; Kim, B.C.; Rheem, S. and Kim, S. (2000) Detection of cholera toxin binding activity of Оє-casein macropeptide and optimization of its production by the response surface methodology. Biosci. Biotechnol. Biochem. 64:516-522. Otani, H. and Monnai, M. (1993) Inhibition of proliferative responses of mouse spleen lymphocytes by bovine milk k-casein digests. Food and Agricultural Immunology. 5:219-229. Otani, H.; Monnai, M. and Hosono, A. (1992) Bovine Оє-casein as inhibitor of the proliferation of mouse splenocytes induced by lipopolysaccharide stimulation. Milchwissenschaft. 47:512-515. Rigo, J.; Boehm, G.; Georgi, G.; Jelinek, J.; Nyambugabo, K.; Sawatzki, G. and Studzinski, F. (2001). An infant formula free of glycomacropeptide prevents hyperthreoninemia in formula-fed preterm infants. J. Pediatr. Gastroenterol Nutr. 32:127вЂ“130. Saito, T.; Yamaji, A. and Itoh, T. (1991) A new isolation method of caseinoglycopeptide from sweet cheese whey. J. Dairy Sci. 74: 2831-2837. Simon, P.M. (1996) Pharmaceutical oligosaccharides. Drug Discovery Today. 1:522-528. ThomГ¤-Worringer, C.; Sorensen, J. and LГіpez-FandinГµ, R. (2006) Health effects and technological features of caseinomacropeptide. Int. Dairy J. 16: 1324-1333. Tolkach, A. and Kulozik, U. (2005) Fractionation of whey proteins and caseinomacropeptide by means of enzymatic crosslinking and membrane separation techniques. J. Food Eng. 67: 13-20. Tullio, L. T.; Karkle, E. N. L. and Candido, L.M.B. (2007) Review: Isolation and Purification of Milk Whey Glycomacropeptide. B. CEPPA. 25:121-132. Wang, B.; Brand-Miller, J.; McVeagh, P. and Petocz, P. (2001). Concentration and distribution of sialic acid in human milk and infant formulas. Am. J. Clin. Nutr. 74:510-515. Wang, B.; Staples, A.; Sun, Y.; Karim, M. and Brand-Miller, J. (2004). Effect of dietary sialic acid supplementation on saliva content in piglets. Asia and Pacific J. Clin. Nutr. 13:75. Wong, P.Y.Y.; Nakamura, S. and Kitts, D.D. (2006) Functional and biological activities of casein glycomacropeptide as influenced by lipophilization with medium and long chain fatty acid. Food Chem. 97:310-317. Xu, Y.; Sleigh, R.; Hourigan, J. and Johnson, R. (2000) Separation of bovine immunoglobulin G and glycomacropeptide from dairy whey. Process Biochem. 36:393-399. Yvon, M.; Beucher, S.; Guilloteau, P.; Huerou-Luron, I.L. and Corring, T. (1994) Effects of caseinomacropeptide (CMP) on digestion regulation. Reprod. Nutr. Dev. 34:527-537. 53 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance New Approaches to Detect the Adulteration of Ghee with Animal Body Fats and Vegetable Oils/ Fats Vivek Sharma, Darshan Lal, Arun Kumar and Amit Kumar Dairy Chemistry Division, NDRI, Karnal Introduction Ghee is the most widely used milk product in the Indian sub- continent. It is a valuable source of fat-soluble vitamins and essential fatty acids, apart from having rich and pleasant sensory attributes. Due to its increased demand, cost and variable chemical composition, the unscrupulous people get tempted to adulterate it with cheaper foreign fats like vegetable oils вЃ„ fats and animal body fats, etc., which is an unethical practice. Earlier, ghee used to be adulterated with foreign oils and fats, and accordingly several methods were developed for detection of adulteration in ghee. These methods were based on differences in the nature and contents of major/minor components of ghee and adulterant fats/oils. Methods presently used for detecting foreign fats in milk fat are mainly based on the physico-chemical constants, fatty acid profile, sterol analysis, and partial solidification behavior. However, all these methods fail when milk fat is adulterated with a mixture of body fats and vegetable oils. In addition to this, now a days tailored vegetable oils with R.M/ P.V and B.R close to that of milk fat are available to the unscrupulous people in the unspecified market for adulteration purposes. To counter this approach some new methods have been developed, though these methods are also not fool proof, but can be handy in the testing laboratories. Methodology There are two approaches for the detection of adulteration of milk fat. First approach is based on the classical methods like B.R reading, R.M- value, P.V вЂ“ value, Phytosterol acetate test, Gas вЂ“ liquid chromatographic analysis. Second approach is based on some innovative and rapid methods like furfural test for vanaspati, Opacity test, crystallization test, Number of carbons by GLC of triglycerides , color based test for vegetable oil detection, apparent solidification time test and complete liquification time test. In all the cases, tests are applied on the extracted fat, accept the modified Gerber test, where aspecially designed dual purpose Gerber butyrometer is used and B.R reading of the fat is measured. Hence, the first step is to isolate the fat and then apply the test (Kumar et al, 2002). In this article the following methods have been discussed. 1. Detection of animal body fats and vegetable oils/fats by the Opacity Test Melt the sample of fat (5 gm) isolated by heat clarification method at 50 +1ВєC in a test tube and maintain for 3 min to equilibrate. Then transfer the test tube at 23 + 0.2ВєC water bath and record the opacity time (Time taken by fat sample to acquire either O.D. at 570 nm between 0.14-0.16 or Klett reading using red filter between 58-62 after adjusting the instrument to 100% transmittance). The opacity time of pure buffalo ghee is 14-15 min, cow ghee is 18-19 min and that of ghee from cotton tract area is 11-12 min. The opacity time of buffalo ghee adulterated at 10% level with vanaspati is 10-11 min, with pig body fat is 8-9 min, with buffalo body fat is 2-3 min, with cow body fat is 3-4 min and with refined oils is 20-25 min (Singhal, 1980). 2. Detection of vanaspati in ghee Isolate the fat from milk by heat clarification method. Take about 5 g of the melted fat in a test tube. Add 5 ml of concentrated HCl. Add 0.4 ml furfural solution (2% in alcohol) and shake the tube thoroughly for 2 min. Allow the mixture to separate. The development of pink or red colour in the acid layer indicates presence of vanaspati. Confirm by adding 5 ml distilled water and shaking again. If the colour in acid layer persists, vanaspati is present. If the colour disappears, it is absent [SP:18 (1987)]. 3. Detection of vegetable oils by B.R. Reading Clean the prisms of the Butyro-refractometer with petroleum ether. Allow the ether to evaporate 54 New Approaches to Detect the Adulteration of Ghee with Animal Body Fats and Vegetable Oils/ Fats to dryness. Maintain temperature of the prisms at 40ВєC by circulating water. Calibrate the B.R. apparatus by applying a drop of fluid of known B.R. and adjusting B.R. by moving the adjustment screw. Clean the prisms. Apply a drop of sample of clear fat obtained by any of the three methods between the prisms. Wait for 2 min before taking the reading so that sample should attain the constant temperature of about 40ВєC. B.R. reading decreases and increases with the rise and fall of temperature, respectively. Normally, the temperature of observation should not deviate by more than 2ВєC. A correction of 0.55 is added to the observed B.R. reading for each degree above 40ВєC or subtracted for each degree below 40ВєC to get corrected B.R. reading of the sample. If fat is isolated by the Gerber method, B.R. is depressed due to hydrolytic effect of H2SO4 on the fat. Therefore, observed B.R. reading is corrected as follows: Corrected B.R. = 1.08 x observed B.R. B.R. reading of milk fat isolated by one of the above mentioned methods should be consistent with the values given for ghee as per PFA requirement. Any deviation from the standard value indicates adulteration of milk with vegetable oils. However, this method has limitation of detection of adulteration with two oils i.e. coconut oil and palm oil whose values are close to that of milk fat (Arora et al, 1996). 4. Detection of animal body fats and vegetable oils by crystallization test Take 0.8 ml of melted fat in a stoppered test tube (10 x 1.0 cm internal diameter). Add 2.5 ml of solvent mixture consisting of acetone and benzene (3.5:1.0). Mix the contents slowly. Place the test tube in a water bath maintained at 20ВєC for 3 min to equilibrate the temperature. Then transfer the tube in another water bath maintained at 17 + 0.2ВєC till the onset of crystallization. Note the time for occurrence of crystallization. The crystallization time of pure buffalo ghee is 18-20 min and that of cotton tract ghee is 10.5-12.5 min, whereas that of buffalo ghee adulterated at 10% level with pig body fat is 11.5-12.5 min, with cow body fat 4.5-5.5 min and buffalo body fat 3.0-4.0 min, and with vegetable oils is 26 to 36 min (Panda, 1996). 5. Detection of adulteration of vegetable oils in ghee by iodine value Iodine value, which is a measure of extent of unsaturation of fat, can be determined by the WijвЂ™s method as described in SP:18 (Part XI)1981. This property is particularly useful for detection of adulteration in ghee with vegetable oils, as these oils have higher iodine values than milk fat and body fats. It can be measured, as follows: Accurately 0.4 g of sample is weighed in a clean and dry iodine flask and is dissolved in 15 ml of carbon tetrachloride. Then 25 ml of the WijвЂ™s reagent are added and the flask is stoppered. The contents are then mixed and kept in dark for one hour. After one hour, 20 ml of 10 per cent potassium iodide solution and about 150 ml of distilled water are added to the iodine flask and mixed. The contents are titrated against 0.1 N sodium thiosulphate solution using starch solution as an indicator. A blank test is also carried out using the same quantities of the reagents. From this, the iodine value is calculated as follows: Iodine Value = 12.69 (B вЂ“ S) N / W Where; B = Vol. (in ml) of standard sodium thiosulphate solution required for the blank S = Volume (in ml) of standard sodium thiosulphate solution required for the sample N = Normality of the standard sodium thiosulphate solution, and W = Weight (in g) of the sample taken for the test The iodine values for cow and buffalo pure ghee ranges between 30.12 to 40.26. Any deviation from these values indicates adulteration (Kumar, 2008). 55 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 6. Detection of adulteration by apparent solidification time (AST) test. The apparent solidification time (AST) of the fat sample is defined as the time taken by the melted fat sample to get solidified apparently at a particular temperature. The test can be carried out as: Take 3.0 gm of completely melted fat sample in a test tube (10 Г— 1.0 cm ID) and maintain at 60В°C for 5 min. Transfer the test tube in a refrigerated water bath maintained at 18 В± 0.2В°C and simultaneously start the stop watch. Observe the test tube constantly till the apparent solidification of the fat sample takes place which is confirmed by non- movement of fat sample on tilting the test tube. At this stage stop the stopwatch and record the time taken for the apparent solidification of the fat. Pure ghee sample of both cow and buffalo shows AST in the range of 2 min 31 sec to 3 min 25 sec. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2009) 7. Detection of adulteration using dry fractionation technique coupled with AST By employing dry fractionation technique, the different fractions enriched with body fats or vegetable oils are obtained and subsequently used to estimate AST. The aim is to enrich the solid fraction with animal body fats and liquid fraction with vegetable oils. Vanaspati, if added, will also be fractionated along with animal body fats. Take 100 gm of clarified melted fat and keep it in a BOD incubator maintained at 20 В± 0.1В°C. After about 1.50 to 1.75 h of incubation, approximately one third of the whole fat gets solidified. Separate the solid fraction (S20) from the remaining liquid portion by filtration inside a BOD incubator maintained at 20 В± 0.1В°C. Further fractionate the liquid portion thus obtained in another BOD incubator maintained at 18 В± 0.1В°C. for 2 hr so as to obtain another solid (S18) and liquid (L18) fraction by filtering inside a BOD incubator maintained at 18 В± 0.1В°C. Analyze S20, S18 and L18 fractions of ghee for AST as described above. S20, S18 and L18 fractions of pure ghee of both cow and buffalo show AST values of 1 min 40 sec to 2 min 50 sec; 2 min 30 sec to 3 min 40 sec and 2 min 50 sec to 3 min 50 sec, respectively. Any deviation from these values gives an indication of adulteration (Kumar, 2003). 8. Detection of adulteration by complete liquification time (CLT) test The complete liquification time (CLT) test of the fat sample is defined as the time taken by the solidified fat sample to get melted completely at a particular temperature. The test can be performed, as follows: Take 3.0 gm of completely melted fat sample in a test tube (10 Г— 1.2 cm) and maintain at 60В°C for 5 min. Keep the test tube containing fat sample in a refrigerator (6- 8ВєC) for 45 min for solidification of the melted fat sample. Transfer the test tube in a water bath maintained at 44 В± 0.1ВєC and simultaneously start the stop watch. Observe the test tube constantly till the fat sample is completely liquefied. At this stage stop the stopwatch and record the time taken for complete liquification of the fat. Pure ghee sample of both cow and buffalo shows CLT in the range of 2 min 12 sec to 3 min 15 sec. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2008). 9. Detection of adulteration using solvent fractionation technique coupled with CLT and Iodine value Using solvent fractionation technique, the different fractions enriched with body fats or vegetable oils can be obtained and used subsequently to estimate CLT. Here also, the aim is to concentrate animal body fats in to solid fraction and vegetable oils into liquid fraction. Vanaspati, if added, will also be concentrated in solid fraction along with animal body fats. Take 30 gm of melted ghee sample in a 100 ml graduated glass tube, and then add 60 ml acetone and mix well to dissolve the fat. After mixing, keep the sample at 40В°C for equilibration for 5 min. Then subject the sample in a refrigerated water bath to three temperatures/time combinations, viz., 16 В± 0.1В°C/25 min, 8 В± 0.1В°C/25 min and 4 В± 0.1В°C/60 min, successively, after filtration at each stage of time/ temperature combination. After about 25 min at 16 В± 0.1В°C, approximately one-fourth of the whole fat gets solidified. This first solid fraction (S16) obtained at 16 В± 0.1В°C is separated from the remaining liquid portion (L16) of the whole fat by filtration through ordinary filter paper. The remaining liquid portion (L16) thus obtained after filtration is further fractionated at 8 В± 0.1В°C. in refrigerated water bath. 56 New Approaches to Detect the Adulteration of Ghee with Animal Body Fats and Vegetable Oils/ Fats After about 25 min, it gets partitioned into two fractions, one solid (S8) and one liquid (L8), which can be separated by filtration through ordinary filter paper. At last, L8 fraction is further fractionated at 4 В± 0.1В°C for 60 min and filtered to get two fractions, one solid (S4) and one liquid (L4). Finally at the end of fractionation, three solid fractions (S16, S8 and S4) and one liquid fraction (L4) are obtained from ghee sample containing a mixture of adulterants. Solvent from liquid fraction is removed by using rotary evaporator at about 40ВєC, followed by nitrogen flushing to evaporate solvent completely from the liquid fraction. To get rid of entrapped acetone, respective solid fractions are heated to 110ВєC for about 2 hr in an oven. (a) Analysis of first fraction (S16) for CLT at 46ВєC Analyse S16 fraction for CLT at 46 В± 0.1ВєC (instead of 44В± 0.1ВєC used for CLT of whole fat) as described above. CLT values of S16 fraction at 46ВєC range between 4 min 5 sec to 9 min for both cow and buffalo pure ghee. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2008). (b) Analysis of last fraction (L4) for Iodine value Analyse L4 fraction for iodine value as described above. The iodine values for L4 fraction of pure cow and buffalo ghee are found to vary between 37.85- 46. 48. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2008). 10. Detection of liquid paraffin in milk fat Isolate the fat from milk by heat clarification method as described above. Saponify 1 g of fat taken in a test tube with 5 ml of 0.5 N ethanolic KOH solutions by heating on direct flame, using wire gauge for 5 min. Add about 5 ml of distilled water to the hot saponified solution. Appearance of turbidity indicates the presence of mineral oil (Kumar, 2005) 11. Rapid color based test for detection of vegetable oils One ml of clear molten fat was dissolved with 1.5 ml of hexane in a tightly capped test tube. To this was added 1.0 ml of color developing reagent (distilled water, Sulphuric acid - Sp.gr.1.835 and Nitric acid - Sp. gr. 1.42 in the ratio of 20:6:14), shaken vigorously and kept undisturbed till it is separated into two layers. The appearance of a distinct orange tinge in the upper layer indicates the presence of vegetable oils / fats including vanaspati (Sharma et al., 2007). 12. Detection of adulteration of rice bran oil in ghee Rice bran oil contains gamma oryzanol, which can be used as a marker for the detection of its addition to ghee. It can be done by thin layer chromatographic method as well as colorimetric method. a) Thin layer chromatographic method A simple thin layer chromatographic method can be employed to detect the adulteration of ghee with rice bran oil, as follows: Gamma oryzanol is extracted from 10.0 gm of molten fat using 20.0 ml of a solvent system consisting of methanol: water (9:1). The contents are vortexed for 2 min and centrifuged at 2000 rpm. / 10 min. The alcohol layer is drawn. Extraction protocol is repeated thrice and all the alcoholic extracts are combined and evaporated at 60 вЂ“ 70В°C in a rotary evaporator. The residue is finally dried. The dried residue is redissolved in 0.5 ml of developing solvent (toluene: ethyl acetate: methanol 90:8:2; v/v) and 5-10 Вµl were applied on silica gel TLC plate and plates are developed in the developing solvent. Properly developed plates are removed from the chamber and air dried followed by spraying with color developing reagent (50% sulfuric acid) and heating at 120В°C/ 10 - 15 min. Presence of the gamma oryzanol band confirms the adulteration of rice bran oil in milk fat. Addition of rice bran oil in ghee at 5% level is easily detected by this method. (Kumar, et al., 2008). b) Colorimetric method Take 1ml of melted ghee sample in a dry test tube. Add 1.5 ml of hexane to dissolve the fat. Then, in sequence, add 0.5 ml of dilute (25%) hydrochloric acid and 0.5 ml of 5% sodium nitrite solution 57 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance and mix, followed by the addition of 1 ml of 10% sodium hydroxide solution. Rice bran oil produces orange-red color while other vegetable oils produce no color. Hence, this method is specific for the detection of rice bran oil in ghee. As low as 2% rice bran oil added in ghee, can be detected by this method. 13. Detection of beef body fat and margarine in butterfat by differential scanning calorimetry: In this case melting and crystallization curves of different fats are studied by cooling fats from 70В°C to - 40В°C ( Aktas and Kaya, 2001). Based on new endothermic peak, more than 10 percent goat body fat in ghee could be detected qualitatively with the help of melting diagram and determined quantitatively from crystallization diagram. The method, however, failed to detect coconut oil, cotton tract ghee and other animal body fats. 14. Temperature controlled attenuated total reflectance- mid- infrared (ATR-MIR) spectroscopy: This is a spectroscopic technique used for the rapid estimation of butter adulteration. The methodology is typically based on the infra red spectroscopic technique ( Koca et al., 2010). These workers collected the Fourier transform infrared spectra of the samples between 4000 and 650 cm-1 on a FTIR spectrophotometer. Here the temperature was controlled, which allowed the stabilization of analysis temperature at 65В± 2В°C. The data was analyzed by using statistical tool namely Multivariate data analysis and calibration models were developed covering all possible adulteration ratios. In this case adulteration of butter with margarine @ 2.5% could be predicted. 15. Tryacyl glycerol analysis by evaporative light scattering detection (ELSD): This method is an HPLC method where major and minor triglyceride species could be sparated in 33 min using reverse phase C18 column, ELSD and mbile pahse ( Dichloromethane: Acetonitrile) in a gradient mode. 16. Analysis of triglycerides by GLC: This method is based on the principle of specific distribution of fatty acid moieties on the glycerol backbone. Tryglycerides of 28 - 54 carbons are identified and quantified. The data generated is analysed by using multi variant analysis. The detection limit varied according to the source of fat added and found to be < 10% ( Gutierrez et al., 2009). References: Aktas.N and Kaya.M ( 2001) Detection of beef body fat and margarine in butter fat by differential scanning calorimetry. Journal of Thermal Analysis and calorimetry. 66. 795- 801. Arora, K.L.; Lal. D, Seth. R and Ram, J. (1996). Platform Test for detection of refined mustard oil adulteration in milk. Indian Journal of Dairy Sci., 49(10): 721-723. Gutierrez.R; Vega.S; Daiz. G; Sanchez.J; Coronado.M; Ramirez.A; Perez.J; Gonzalez.M and Schettino.B ( 2009) Detection of non milk fat by gas chromatography and linear discriminate analysis. J. Dairy Sci. 92: 1846- 1855. ISI (1981). Handbook of Food Analysis. IS: SP:18, Part XI. Dairy Products. Bureau of Indian Standards, New Delhi. Koca.N; Kocaogulu-Vurma.N.A; Harper.W.J; Rodriguez-Saona. L.E ( 2010) Application of temperature controlled attenuated total reflectance вЂ“ mid- infrared (ATR-MIR) spectroscopy for rapid estimation of dutter adulteration. Food Chemistry. 121: 778- 782. Kumar.A; Lal.D; Seth.R and Sharma.R (2002) Recent trends in detection of adulteration in milk fat вЂ“ A Review. Indian J Dairy Sci., 55 (6): 319 - 330. Kumar. A, Lal, D, Seth, R and Sharma. V (2005) Turbidity test for detection of liquid paraffin in ghee. Indian J Dairy Sci., 58 (4): 298. Kumar. A; Sharma. V and Lal.D (2008) Development of a thin layer chromatography based method for the detection of rice bran oil as an adulterant in ghee. Ind. Journal . Dairy Sci. 61,2: 113 вЂ“ 115. Kumar. Amit; (2008) Detection of adulterants in ghee. Ph. D thesis submitted to NDRI, Karnal (Deemed University). Kumar. A; Ghai, D. L; Seth, R and Sharma, V (2009) Apparent solidification time test for detection of foreign oils and fats adulterated in clarified milk fat, as affected by season and storage. International J . Dairy Tech. 62: 33 вЂ“38. Lal, D.; Seth, R.; Arora, K.L. and Ram, J. (1998) Detection of vegetable oils in milk. Indian Dairyman., 50(7): 17-18. Panda, D.K. (1996). Detection of adulteration of foreign fats in milk fat. M.Sc. thesis, submitted to N.D.R.I. Deemed University, Karnal. Sharma. V; Lal, D and Sharma. R. (2007) Color based platform test for the detection of vegetable oils/fats in ghee. Ind. Journal . Dairy Sci. 60,1: 16 вЂ“ 18. Singhal, O.P. (1980). Adulteration & Methods for detection. Indian Dairyman, 32: 771-774. SP:18 (1987). Handbook of Food Analysis Part XI, Dairy Products. Bureau of Indian Standards, Manak Bhawan, New Delhi. 58 Colostrum Powder and its Health Benefits Colostrum Powder and its Health Benefits Raman Seth and Anamika Das Dairy Chemistry Division, NDRI, Karnal Introduction Since the time immemorial, man has sought some alternative methods to enhance and improve the immune system of human body in order to fight against diseases. Historically, Ayurvedic physicians have used bovine colostrum for therapeutical application in Asia, particularly in India for thousands of years. Increased awareness of the diet - health relationship in many countries has stimulated a trend in nutrition science whereby more attention is given to the health effects of individual foods. Colostrum is the first lacteal secretion from the mammary glands after parturition during the first 24-72 hours. Colostrum is a complex fluid rich in nutrients and is also characterized by its high level of bioactive components e.g. immunoglobulins (Igs), particularly IgG1, growth factors, i.e. insulin like growth factors-1, transforming growth factor ОІ2 and growth hormone in addition to lactoferrin, lysozyme and lactoperoxidase. Because of its poor heat stability, colostrum is an under utilized product in the dairy industry. Heat processing may affect the functionality of bioactive components present in colostrum. Knowledge concerning the influence of processing and isolation procedures on bioactive compounds in colostrum based products is, however, limited. Due to less heat stability of colostrum, its addition in raw milk affects further processing. Colostrum addition to milk causes elevated protein and mineral content which might render milk unsuitable for certain dairy processing operations such as UHT or milk powder production. But, during the past three decades, there has been increased interest in human consumption of bovine colostrum or its supplemented products based on the prophylactic and immuno-therapeutic benefits of absorbed immunoglobulin especially IgG Thus, colostrum has been processed into products designed for pharmaceutical and nutraceutical purposes which provide the consumer with an identified health benefit over basic nutritional value. Internationally, colostrumderived products have become valuable niche products and are currently being sold into highly competitive markets with current focus on protein components because of their physiological effects and hence their commercial value. Processes involved in drying of colostrum powder Low-heat pasteurization The high-heat pasteurization and drying processes used by many producers of colostrum powders can denature the sensitive PRPs and IgG proteins in colostrum. Only low-heat flash pasteurization and low-heat indirect drying can be used to preserve the efficacy and bioactivity of colostrum. Using flash pasteurization (161ВєF or 72ВєC for 15 seconds) all potentially harmful pathogens are removed, while immunoglobulins and other biologically important proteins retain their bioactivity. Low-pressure processing Similar to high-heat processing, high-pressure processing of colostrum will denature proteins and reduce the bioactivity of the finished product. So low pressure processing is applied to manufacture colostrum powder. Indirect steam drying Colostrum is spray dried using indirect steam and with low pressure and temperatures (less than 145В°F or 63ВєC) to produce a high quality powder while protecting the colostral proteins. Toxic nitrogen oxides components produced in direct fired dryers used by other manufacturers are not produced in indirect steam dryer. Freeze drying (lyophilization) Freeze-drying (lyophilization) has been one of the most useful methods for producing high quality colostrum powder from colostrum. However, lyophilization has high capital and process costs. Freeze59 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance drying works by freezing colostrum and then reducing the surrounding pressure and adding enough heat to allow the frozen water in the material to sublime directly from the solid phase to the gas phase. Composition of colostrum powder Often colostrum powder is priced on the basis of IgG content. Standardized colostrum powders are available having 10 and 40 percent IgG levels and from 45 to 80 percent minimum protein levels. Typical composition of colostrum powder is as depicted below Immune factors Immunoglobulins Immunoglobulins (Igs) are a family of globular proteins with antimicrobial and other protective bioactivities. They exist at different concentrations in milk and colostrum. Qualitative and quantitative Chemical Composition 4-5% differences are dependent on species, and are Moisture 0.5-1.5% found in various isotypes, with immunological Fat activities that are dependent on the Ig class. The Protein 55-80% Igs are the principal agents that protect the gut Lactose 15-23% mucosa against pathogenic microorganisms. IgG Ash 5-7% antibodies express multifunctional activities, IgG 14-55% including complement activation, bacterial Physical properties opsonisation and agglutination, and act by Colour Creamy, yellow binding to specific sites on the surfaces of most Free flowing spray dried infectious agents or products, either inactivating Appearance powder them or reducing infection. In bovine colostrum Bulk Density 0.4 вЂ“ 0.5 g/ml (when packed) and milk, immunoglobulin G (IgG; subclasses (25 g)A Disc IgG1 and IgG2) is the major immune component, Sediment although low levels of IgA and IgM are also Microbiological properties <50 present IgG1 constitutes approximately 80% Standard Plate Count (1 g) of the total Ig content of bovine milk. IgG is a Not detected monomeric glycoprotein consisting of two heavy Coliforms (1 g) Not detected (long) polypeptide chain of 53 KDa and two Coagulase +ve S. aureus (1 g) light (short) polypeptide chains of 23 KDa that Absent are linked by disulfide bonds. The polypeptide Salmonella (25 g) chains contain both constant (Fc) and variable Yeast and moulds (1 g) <50 (Fab) regions of amino acid sequence, with E. coli (1 g) Not detected the antigen-binding sites located in the Fab Listeria Species (25 g) Absent N-terminal region. The concentration of immunoglobulins in colostrum and normal milk Lactoferrin Lactoferrin is an 80 kDa iron-binding Immunoglobulin Colostrum (g/L) Normal milk(g/L) glycoprotein present in colostrum and shows IgG1 52. 0 вЂ“ 87.0 0. 31 вЂ“ 0 .40 antiviral, antibacterial, anti-inflammatory IgG2 1.6 вЂ“ 2 .1 0. 03 вЂ“ 0 .08 properties. The concentration of lactoferrin in 3.7 вЂ“ 6 .1 0.03 вЂ“ 0 .06 bovine colostrum and mature milk is about 1.5-5 IgM 3. 2 вЂ“ 6 . 2 0.04 вЂ“ 0 .06 mg/mL and 0.1 mg/mL respectively. Lactoferrin IgA has been implicated in the treatment of diseases like cancer, HIV, herpes, chronic fatigue, Candida albicans and other infections. LactoferrinвЂ™s affinity for iron is very high (about 260 times that of blood serum transferrin). The cDNA for bovine lactoferrin has been isolated. and the deduced amino acid sequence (708 amino acids) is homologous with human 60 Colostrum Powder and its Health Benefits lactoferrin (68%) and human transferrin (60%) another iron-binding protein predominantly present in serum. Lactoferrin has been shown to inhibit the growth of several microbes, including E.coli, Salmonella typhimurium, Shigella dysenteria, Listeria monocytogenes ,Streptococcus mutans, Bacillus stearothermophilus and Bacillus subtilis. In a recent study it was shown that human and bovine lactoferrin and their N-terminal peptides were germicidal against Giardia lamblia in vitro. It has been proposed that the antimicrobial effect of lactoferrin is based on its capacity to bind iron, which is essential for the growth of bacteria.. Lactoferrin exerts its antimicrobial activity by modifying bacterial cell membranes. In addition to its antibacterial activity, lactoferrin has antiviral effects against herpes simples virus type-l (HSV-1) human immunodeficiency virus-l (HIV-l) and human cytomegalovirus in vitro. Lactoferrin plays a role in iron uptake in the intestine. and the activation of phacocytes and immune responses. Receptors for lactoferrin are found on intestinal tissues, monocytes, macrophages, neutrophils, lymphocytes, platelets and on some bacteria .Studies have shown that lactoferrin can bind DNA and activate transcription, which might explain the molecular basis of growth regulation. Lysozyme Lysozyme is a well-known antibacterial and lytic enzyme present in many mammalian body fluids, including colostrum. The concentration of lysozyme in colostrum and in normal milk is about 0.14-0.7 and 0.07-0.6 mg/L, respectively. The natural substrate of the enzyme is the peptidoglycan layer of the bacterial cell wall and its degradation results in lysis of the bacteria. Some recent results suggest that the antibacterial activity of lysozyme is not only due to its enzymatic activity, but also to its cationic and hydrophobic properties The presence of lactoferrin enhances the antibacterial activity of lysozyme against E.coli, which also supports the hypothesis that lactoferrin damages the outer membrane of Gram-negative bacteria. Lactoperoxidase Lactoperoxidase is a major antibacterial enzyme in colostrum. Bovine colostrum and milk contain about 1l-45 mg/L and 13-30 mg/ L lactoperoxidase, respectively.It is a basic glycoprotein containing a heme-group with Fe3+ and catalyzes the oxidation of thiocyanate (SCN-) in the presence of hydrogen peroxide (H2O2), producing a toxic intermediary oxidation product. This product inhibits bacterial metabolism via the oxidation of essential sulphydryl groups in proteins. The lactoperoxidase system is also toxic to other Gram-positive and Gram negative bacteria such as Pseudomonas aeruginosa,Salmonella typhimurium,Listeria monocytogenes, Streptococcus mutans, Staphylococcus aureus and psychrotrophic bacteria in milk. Lactoperoxidase system inactivates polio virus and human immunodeficiency virus type 1 in vitro. The single peptide chain (612 amino acids) includes 15 half-cystines and 4- 5 potential N-glycosylation sites and the heme group is suggested to bind to the peptide chain via a disulphide linkage. Bovine lactoperoxidase also contains a site with high affinity for calcium. The lactoperoxidase is partly activated by forming a complex with lysozyme and this interaction appears to be quite specific. The lactoperoxidase system and lactoferrin have been shown to have an additive but not a synergistic, antibacterial effect against Streptococcus mutans. Proline-Rich Polypeptides (PRP) A hormone that regulates the thymus gland, stimulating an underactive immune system or down-regulating an overactive immune system as seen in autoimmune disease(Multiple sclerosis, rheumatoid arthritis, lupus, scleroderma, chronic fatigue syndrome, allergies, etc.). PRP stimulates immature thymocytes to turn into functionally active T-cells. Studies revealed that the addition of PRP isolated from colostrum led to the inhibition of vesicular stomatitis virus (VSV) replication in resident peritoneal cells. Furthermore, PRP acts as an immuno regulator by changing surface markers and functions of cells .It is a mixture of peptides(polypeptide-clostrinin) derived from colostrum which could help to slow the progression of AlzheimerвЂ™s disease by reducing the build-up of beta amyloid, a toxic protein that accumulates in the brains of AlzheimerвЂ™s sufferers. 61 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Growth factors Growth factors are so called because historically they have been identified by their ability to stimulate the growth of various cell lines in vitro but, in reality, the functions of these peptide based molecules are considerably more diverse. Concentration ranges in growth factors reported for bovine colostrum and milk Epidermal growth factor EGF is a 53вЂ“amino acid peptide produced by Concentration the salivary glands and the Brunners glands of the (ng/ml) Growth factors duodenum in adults. In vitro experiments using Colostrum milk gastric juice from preterm infants indicate that milk4 вЂ“ 325 1- 150 borne EGF is not deactivated under typical gastric Epidermal growth factor Betacellulin < 5 <5 proteolytic conditions. In contrast, we showed 100 - 2000 5-100 that adult gastric juice digests EGF to an EGF form Insulin like growth вЂ“I that has only 25% of the biological activity of the Insulin like growth factor-II 150 вЂ“ 600 5-100 intact EGF molecule. Once EGF enters the small Transforming growth factor-ОІ1 10 вЂ“ 50 <5 intestine, it is susceptible to proteolytic digestion Transforming growth factor- ОІ2 150 -1150 10-70 under fasting conditions but is preserved in Fibroblast growth factor NAb <1 the presence of ingested food proteins . There Platelet-derived growth factor NA NA is controversy over the physiologic function of EGF in the gastrointestinal lumen under normal (nondamaged) conditions. EGF acts as a вЂњluminal surveillance peptideвЂќ in the adult gut, readily available to stimulate the repair process at sites of injury. The EGF in colostrum and milk may therefore play a role in preventing bacterial translocation and stimulating gut growth in suckling neonates. Transforming growth factor О± In contrast with EGF, TGF- О± is produced within the mucosa throughout the gastrointestinal tract. Systemic administration of TGF- О± stimulates gastrointestinal growth and repair, inhibits acid secretion, stimulates mucosal restitution after injury, and Increases gastric mucin concentrations. Within the small intestine and colon, TGF- О± expression occurs mainly in the upper (nonproliferative) zones, which suggests that its physiologic role may be to influence differentiation and cell migration rather than cell proliferation. TGF-a may therefore play a complementary role to that of TGF-ОІ in controlling the balance between Proliferation and differentiation in the intestinal epithelium. Up-regulation of TGF-О± expression has been shown to occur in the gastrointestinal mucosa at sites of injury as well as in the liver after partial hepatectomy, supporting a role for TGF-О± in mucosal growth and repair. Other findings support the role of TGF- О± in maintaining epithelial continuity but suggest that the relative importance of peptides such as this might vary from one region of the gut to another. Taken together, most studies suggest that the major physiologic role of TGF- О± is to act as a mucosal-integrity peptide, maintaining normal epithelial function in the undamaged mucosa. Transforming growth factor ОІ This family of molecules is structurally distinct from TGF- О± and, in most systems, actually inhibits proliferation. There are 5 different isoforms of TGF- ОІ and their major site of expression in the normal gastrointestinal tract is in the superficial zones, where they may inhibit proliferation once the cells have left the crypt region. TGF- ОІ has many diverse functions; it is a potent chemoattractant for neutrophils and stimulates epithelial cell migration at wound sites. It is therefore likely to be a key player in stimulating restitution, the early phase of the repair process during which surviving cells from the edge of a wound migrate over the denuded area to reestablish epithelial continuity. TGF- ОІ and TGF- ОІ -like molecules are present in high concentrations in both bovine milk (1вЂ“2 mg/L) and colostrum (20вЂ“ 40 mg/L). These concentrations are sufficient to prevent indomethacin-induced gastric injury in rats, suggesting that the TGF- ОІ in colostrum may be a key component in mediating its ability to maintain gastrointestinal integrity in suckling neonates. 62 Colostrum Powder and its Health Benefits Platelet-derived growth factor Platelet-derived growth factor (PDGF) is an acid-stable molecule that was originally identified from platelets but is also synthesized and secreted by macrophages. It consists of 2 disulfide linked polypeptides: chain A (14 kDa) and chain B (17 kDa). The dimer, therefore, exists in 3 isoforms (AA, AB, and BB) that bind to tyrosine kinaseвЂ“type receptors. PDGF is a potent mitogen for fibroblasts and arterial smooth muscle cells and administration of exogenous PDGF has been shown to facilitate ulcer healing when administered orally to animals. Although PDGF is present in bovine milk and colostrum, most of the PDGF-like mitogenic activity in bovine milk is actually derived from bovine colostral growth factor, which shares sequence homology with PDGF. Insulin-like growth factors (somatomedins) and their binding proteins IGF-I and IGF-II promote cell proliferation and differentiation and are similar in structure to proinsulin and it is possible that they also exert insulin-like effects at high concentrations. Bovine colostrum contains much higher concentrations of IGF-I whereas lowered concentrations is found in mature bovine milk (10 mg/L). These growth factors are relatively stable to both heat and acidic conditions. They therefore survive the harsh conditions of both commercial milk processing and gastric acid to maintain their biological activity. IGF-I is known to promote protein accretion, ie, it is an anabolic agent (50) and is at least partly responsible for mediating the growth-promoting activity of growth hormone (GH). IGF-II is present in bovine milk and colostrum at much lower concentrations than is IGF-I, but like IGF-I, it has anabolic activity and has been shown to reduce the catabolic state in starved animals. IGFs in bovine colostrum and milk are present in both free and bound forms. The amount of free IGF varies during the perinatal period, with most of the IGF-I in bovine colostrums being present in the free form (ie, not associated with its binding protein), whereas the reverse is true in the antepartum period and in mature milk. It was initially thought that the main function of IGFBPs was to act as carrier proteins, reducing the proteolytic digestion of IGF and limiting its biological activity because only the free forms of IGF are thought to have any major proliferative activity. Additional roles for IGFBPs have been suggested because it has been shown that different IGFBPs have distinct patterns of distribution in different tissues and their concentrations are altered in response to hormonal or nutrient status. The detailed functions of IGFBPs are unclear, although it is probable that one of the roles of secreted or soluble IGFBP is to inhibit IGF-mediated proliferation or amino acid uptake by limiting the availability of free IGF to bind to its receptors. Conversely, cell surface and cell matrixвЂ“associated IGFBPs may potentiate the actions of IGF by increasing local concentrations of IGF-I and IGF-II next to their receptors. Clinical applications of colostrum Gut related infections Short-bowel syndrome Some patients have an insufficient length of bowel to digest and absorb food adequately, usually as a result of massive intestinal resection for vascular insufficiency or after repeated operations for inflammatory bowel disease. Current therapeutic options are unpleasant and associated with a high risk of morbidity or mortality, eg, long-term parenteral (intravenous) feeding and small-bowel transplantation. Strategies to optimize the function of residual bowel and ultimately wean patients off total parenteral nutrition would therefore be of great benefit. There is evidence that growth factors could be instrumental in achieving this goal; e.g systemic administration of individual growth factors such as EGF have been shown to stimulate bowel growth in rats receiving total parenteral nutrition. In addition, oral administration of EGF helped restore glucose transport and phlorizin binding in rabbit intestines after jejunal resection, and colostrum supplementation of piglet feeding regimens resulted in a significant increase in intestinal proliferation. Colostrum supplementation may be of particular value in young children who have undergone intestinal resection because gut adaptation is more likely during early childhood than it is in adulthood. 63 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Nonsteroidal antiinflammatory drugвЂ“induced gut injury Nonsteroidal antiinflammatory drugs (NSAIDs) are widely prescribed and are effective in the treatment of musculoskeletal injury and chronic arthritic conditions. Nevertheless, <2% of subjects taking NSAIDs for 1y suffer from gastrointestinal adverse effects, including bleeding, perforation, and stricture formation of the stomach and intestine. Acid suppressants and prostaglandin analogues have been shown to be effective in reducing gastric injury induced by NSAIDs but are less effective in preventing small intestinal injury. EGF and TGF-О± and TGF-ОІ have all been shown to reduce NSAID induced gastric injury. It was shown recently that a defatted colostrum preparation, which is rich in the growth factors discussed earlier, reduced NSAID-induced gastric and intestinal injury in rats and mice. This material was also shown to effectively reduce gastric erosions in human volunteers taking NSAIDs. Further support for this approach comes from our recent finding that this defatted colostrum preparation reduced small intestinal permeability, which was used as a marker of intestinal damage in human volunteers taking clinically relevant doses of the drug indomethacin. Clinical trials involving patients taking NSAIDs long term are under way. Chemotherapy-induced mucositis Current regimens for the treatment of cancers require patients to take much higher doses of chemotherapeutic agents than were used previously. As a result of these higher doses, toxic adverse effects on the bone marrow and gastrointestinal tract can be the factor limiting the dose or duration of treatment. Strategies to protect these tissues and encourage their recovery may facilitate the use of higher doses of chemotherapy, with greater potential for cure. For example, EGF enhances the repair of rat intestinal mucosa damaged by methotrexate , TGF-b ameliorates chemotherapy-induced mucositis , and administration of a cheese wheyвЂ“derived preparation reduces methotrexate-induced gut injury in mice . Not all studies have shown favorable results, however, because EGF had only a minor beneficial effect in reducing mouth ulceration in a phase I clinical study of patients undergoing chemotherapy . If peptides with growth stimulatory or inhibitory effects are to be used, the timing of administration is likely to be critical; growth-arresting factors might protect bone marrow or gut from the damaging effects of chemotherapy, which tend to affect areas with the highest cell turnover, if given before chemotherapy. In contrast, growth-stimulating factors might вЂњrescueвЂќ recovery of injured areas if administered after chemotherapy. This latter approach is already being used clinically, eg, colonystimulating growth factor is being used to stimulate bone marrow recovery after chemotherapy. Inflammatory bowel disease The etiology of ulcerative colitis and Crohn disease is unknown and, therefore, current treatment of these severe, incapacitating conditions has to be on an empiric basis. Studies examining the effect of administration of EGF, PDGF, TGF-b or IGF-I in animal models of colitis have had encouraging results and a cheese whey growth factor extract containing several of these growth factors had positive results in a similar model . Other peptides, not present in milk or colostrum in significant concentrations, under study as potential therapeutic agents for these conditions include keratinocyte growth factor and trefoil peptides. These studies are in the very early (animal model) stages and the agents are unlikely to be in standard clinical use for many years. Milk-derived products are already in clinical use for the treatment of inflammatory bowel disease; casein-based enteral feeds are used for the treatment of Crohn disease and their efficacy might be due, in part, to the presence of MDGFs in the preparation, which are preserved during the processing of the milk protein (see above). In addition, clinical trials of the use of colostrum enemas for the treatment of ulcerative colitis and resistant proctitis are under way and the results are awaited with interest. Necrotizing enterocolitis Necrotizing enterocolitis (NEC) is a severe life-threatening illness of young children that causes severe ulceration of the small and large bowel. Its etiology is unclear, although there are many possible risk factors, including prematurity, enteric infections, intestinal ischemia, and abnormal immune responses. Although many proinflammatory molecules are likely to be involved in the etiology of NEC, there is currently interest in the role of the phospholipid-mediator platelet activating factor 64 Colostrum Powder and its Health Benefits (PAF), which is produced by intestinal flora and inflammatory cells during the development of NEC. The finding that human colostrum contains the enzyme PAF acetylhydrolase, which degrades PAF, might therefore be relevant in explaining why human milk feeds protect against the development of NEC. These areas are discussed further by others (91вЂ“93). Although the molecular mechanisms underlying the development of NEC are unclear, there is no doubt that once it is established, it is associated with a very high mortality rate. Current treatment consists of general supportive measures consisting of fluid-replacement and antibiotic therapy, although intestinal resection is often required. There is therefore a need for novel therapeutic approaches, e.g. the use of peptides to stimulate the repair process. Support for this idea comes from a recent case study in which a continuous infusion of EGF resulted in a remarkable restorative effect on gut histology in a child with NEC. Infective diarrhea Hyperimmune milk or colostrum preparations have been shown to be of benefit in the prevention and treatment of infection and to increase weight gain in both clinical and veterinary practice, eg, vaccination of cows with specific viruses or bacteria to produce hyperimmune milk has been shown to be beneficial in the prevention and treatment of enteropathic infections due to Escherichia coli and rotavirus. The use of whole hyperimmune colostrum rather than specific antibodies purified from milk or other sources has the added value of potentially stimulating the repair process (due to the presence of growth factors) as well as facilitating the eradication of the infection by mechanisms involving nonspecific antibacterial factors in colostrum and milk. The ultimate antioxidant Colostrum is rich in Glutathione, a powerful antioxidant which is often described as вЂ�the ultimate antioxidantвЂ™. Antioxidants play an important part in overall good health and the prevention of disease, by scavenging for free radicals which cause disease, muscle damage, and inflammation. It has been shown that glutathione enhances athletic performance by increasing muscle strength, and increasing the capacity to exercise before fatigue sets in. Oxidative stress in the form of training and exercise contributes to muscle fatigue. Glutathione and its precursors present in colostrum, have been shown to increase the capacity of exercise prior to the onset of fatigue. Anti-inflammatory Inflammation is associated with strenuous exercise and anti-inflammatories are the most commonly prescribed class of drug to athletes. Inflammation is typically centered in the joints and in the digestive tract. Inflammation is a protective response to an injury, invading foreign substance, or an internally produced substance (e.g. in auto-immune disorders like rheumatoid arthritis). Colostrum reduces the need for damaging medication, and because it is a natural food, unlike NSAIDS, it has absolutely no negative side-effects and has a multitude of benefits. Increased Brain Function Phospholipids, components of alpha lipid, help in increasing brain function and have been associated with improved memory. They have also shown to elevate moods and reduce the symptoms of depression. Viral illnesses About 75% of the antibodies in the body are produced by the GI component of the immune system. The ability of AIDS/HIV patients to fight infectious disease is severely compromised due to damage to the gut from chronic inflammation and diarrhea. Recent studies report colostrumвЂ™s role in the reversal of this chronic problem stemming from opportunistic infections like Candida albicans, Cryptosporidia, rotavirus, Herpes simplex, Pathogenic Strains of E. Coli and intestinal flu infections. All gut pathogens are handled well by colostrum without side effects. Allergies and autoimmune diseases PRP from colostrum can work as a regulatory substance of the thymus gland. It has been demonstrated to improve or eliminate symptomatology of both allergies and autoimmune diseases 65 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance (Multiple Sclerosis, rheumatoid arthritis, lupus, and myasthenia gravis). PRP inhibits the overproduction of lymphocytes and T-cells and reduces the major symptoms of allergies and autoimmune disease: pain, swelling and inflammation. Heart Disease Colostrum PRP have a role in reversing heart disease very much like it does with allergies and autoimmune diseases. Additionally, IgF-1 and GH in colostrum can lower LDL-cholesterol while increasing HDL-cholesterol concentrations. Colostrum growth factors promote the repair and regeneration of heart muscle and the regeneration of new blood vessels for collateral coronary circulation. Cancer The cytokines like Interleukins 1, 6, 10, Interferon G and Lymphokines found in colostrum are involved in the treatment of cancer. Colostrum lactalbumin has been found to be able to cause the selective death (apoptosis) of cancer cells, leaving the surrounding non-cancerous tissues unaffected. Lactoferrin has similarly been reported to possess anti-cancer activity. The mix of immune and growth factors in colostrum can inhibit the spread of cancer cells. Diabetes Juvenile diabetes (TypeI, insulin dependent) is thought to be brought about through an autoimmune mechanism, possibly initiated by an allergic reaction to the protein GAD found in cowвЂ™s milk. Colostrum contains several factors, which can offset this and other allergies. Human trials reported that IgF-1 stimulates glucose utilization, effectively treating acute hyperglycemia and lessening a Type II diabetic dependence on insulin. Helps in weight loss IgF-1 is required by the body to metabolize fat for energy through the Krebs cycle. With aging, less IgF-1 is produced in the body. Inadequate levels are associated with an increased incidence of Type II diabetes and difficulty in losing weight despite a proper nutritional intake and adequate exercise. Colostrum provides a good source of IgF-1 as a complementary therapy for successful weight loss. Athletic stress Exhaustive workouts and athletic competition can temporarily depress the immune system, decreasing the number of T-lymphocytes and NK cells. Athletes are therefore, more prone to develop infections, including Chronic Fatigue Syndrome. Many of colostrumвЂ™s immune factors can help significantly reduce the number and severity of infections caused by both physical and emotional stress. Leaky Gut Syndrome One of the major benefits of colostrum supplementation is enhanced gut efficiency due to the many immune enhancers that control clinical and subclinical GI infections. Colostral growth factors also play a role by keeping the intestinal mucosa sealed and impermeable to toxins. Healing leaky gut syndrome reduces toxic load and helps in the reversal of many allergic and autoimmune conditions. For the healthy individual or athlete in training, colostrum supplementation enhances the efficiency of amino acid and carbohydrate fuel uptake by the intestine. One of the reasons for the energy boost seen in most healthy individuals who use colostrum as a food supplement is this ability of colostrum to improve nutrient availability and the correction of subclinical leaky gut syndrome. Wound healing Several colostrum components stimulate wound-healing. Nucleotides, EGF, TGF and IGF-1 stimulate skin growth, cellular growth and repair by direct action on DNA and RNA. These growth factors facilitate the healing of tissues damaged by ulcers, trauma, burns, surgery or inflammatory disease. The tissues affected beneficially by colostrums wound healing properties are skin, muscle, cartilage, bone and nerve cells. Powdered colostrum can be applied topically to gingivitis, sensitive teeth, aphthous ulcers, cuts, abrasions and burns after they have been cleaned and disinfected. 66 Colostrum Powder and its Health Benefits Conclusion The world-wide trend towards the development of health-promoting foods offers interesting opportunities for applications which contain specific antibody ingredients derived from immunised cows. It is anticipated that colostrums based preparations may have remarkable potential to contribute to human health care as part of health promoting diet and as an alternative or a supplement to the medical treatment of specified human diseases. Bovine colostrum virtually contain all compounds of human cellular and humoral immune defence. They are ideal sources of these defence molecules for industrial production because of their ready availability and safety as compared with blood derived analogues. The ongoing success of colostrums based products speaks for itself. However, the challenge for manufacturers still remains as how to process colostrums in a cost effective way. References Blum, J. W., and Hammon, H. 2000. Colostrum effects on the gastrointestinal tract, and on nutritional, endocrine and metabolic parameters in neonatal calves. Livest. Prod. Sci., 66: 151. Chen, C.C., Tu, Y.Y., and Chang, H.M. 2000. Thermal stability of bovine milk immunoglobulin G(IgG) and the effect of added thermal protectants on the stability. J. Food Sci., 65: 188. Donovan, S. M. and Odle, J. 1994. Growth factors in milk as mediators of infant development. Ann. Rev of Nutr., 14: 147. Elfstrand, L., Lindmark-Mansson, H., Paulsson, M., Nyberg, L. and Akesson, B. 2002. Immunoglobulins, growth factors and growth hormone in bovine colostrum and the effects of processing. Int. Dairy J., 12: 879. Gapper, L., Copestake D., Otter, D., Indyk, H., 2007. Analysis of bovine immunoglobulin G in milk, colostrum and dietary supplements: a review Anal Bioanal Chem.,389:93. Godden, S. M., Smith, S., Feirtag, J. M., Green, L. R., Wells, S. J., and Fetrow, J. P. 2003. Effect of on-farm commercial batch pasteurization of colostrum on colostrum and serum immunoglobulin concentrations in dairy calves. J. Dairy Sci., 86: 1503. Korhonen, H., Marnila, P. and Gill, H. S. 2000. Bovine milk antibodies for health. Br J Nutr., 84: S135. Kurokowa, M., Lynch, K. and Podolsky, D. K. 1987. Effects of growth factors on an intestinal epithelial cell line: transforming growth factor beta inhibits proliferation and stimulates differentiation. Biochemical and Biophysical Research Communications 142:775-182. 67 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Cow Ghee Protects from Mammary Carcinogenesis: Mechanism Vinod K. Kansal, Rita Rani and Ekta Bhatia Animal Biochemistry Division, NDRI, Karnal During the past several years, epidemiological studies have indicated the influence of environment and life-styles on the development of certain forms of cancer. About 35 % of all cancer mortality in US may be attributable to dietary factors. The association between dietary fat and cancer has been consistently supported by experimental evidence. Limiting the intake of fats and oils reduces the risk of cancer. This has now been expanded to limit saturated fat intake through reduction of animal fat intake. Epidemiological associations between dietary fat intake and cancer in humans are highly controversial. Some of this controversy stems from the limited ability to accurately assess total energy and fat consumption, and the difficulty in assessing the effects of dietary fat independent of total energy or micronutrient intake and other environmental factors such as physical activity. A chorus of establishment voices, including the American Cancer Society, the National Cancer Institute and the Senate Committee on Nutrition and Human Needs, claim that animal fat is linked not only with heart disease, but also with cancers of various types. However, when researchers from the University of Maryland analyzed the data, they found that vegetable fat consumption was correlated with cancer, not the animal fat (Enig et al., 1978). The mechanisms supporting a relationship between dietary fat and cancer can be classified as either direct or indirect. Potential direct mechanisms include: 1) peroxidation of double bond in PUFAs, leading to persistant oxidative stress and generation of reactive lipid peroxidation products (malondialdehyde, 4-hydroxyalkenals), which induce DNA damage; 2) conversion of essential fatty acids to eicosanoids (short lived hormone synthesized from n-6 unsaturated fatty acids); and 3) interaction between fatty acids with signal transduction pathways leading to altered gene expression. Potential indirect mechanisms include: 1) effect on membrane bound enzymes such as cytochrome P450 (CYP) that regulate xenobiotic and estrogen metabolism; 2) structural and functional changes in cell membranes that can alter the hormone activity and growth factor receptors; and 3) effects on immune function. Dietary fat and breast cancer Breast cancer is the most commonly diagnosed cancer in women and is the leading cause of cancer mortality in females in the world. There is strong positive correlation between fat intake and mortality from breast cancer. It is likely that sex hormones especially estrogen, play a promotional role in breast carcinogenesis, stimulating mitotic division of initiated cells and proliferation. An increased amount of both vegetable and animal fat accelerates mammary tumor growth. Different types of fat also have different effects on mammary tumorigenesis. Meta-analysis of 97 reports that studied the effects of dietary fatty acids on mammary tumor incidence and found: 1) n-6 polyunsaturated fatty acids have a strong tumor-enhancing effect; 2) saturated fats have weaker tumor enhancing effects; 3) n-3 polyunsaturated fatty acids have a small non-significant protective effect; 4) the effects of n-6 polyunsaturated fats are stronger than that of saturated fats even at low levels; and 5) there is no effect of monounsaturated fats on mammary carcinogenesis (Fay et al., 1997). A high fat diet rich in n-6 polyunsaturated fatty acid in animal models could enhance metastasis of human breast cancer cells (Rose et al., 1991). Dairy products and breast cancer The major hypotheses suggesting an increased risk of breast cancer risk associated with the consumption of dairy product include: 1) a high consumption of dairy products results high dietary 68 Cow Ghee Protects from Mammary Carcinogenesis: Mechanism fat intake particularly saturated fat which in turn has been associated with breast cancer risk; 2) milk product may contain contaminants, such as pesticide that are potentially carcinogenic; and 3) milk may contain growth factors, such insulin like growth factor 1 (IGF-1), which have been shown to promote breast cancer cell growth. The hypotheses suggesting inverse relation between dairy product consumption and breast cancer risk have focused on the anticarcinogenic effects of vitamin D and calcium, conjugated linoleic acid and butyric acid. Dairy products have high calcium content and are also a major dietary source of vitamin D in countries where milk and other dairy products are fortified, such as the United States. In breast cancer cell lines, vitamin D exerts antiproliferative effects by causing arrest in phase G0 / G1 of the cell cycle (Colston and Hansen, 2002). The cellular functions of vitamin D are closely linked to calcium. Calcium is a pivotal regulator of a wide variety of cellular functions, including cellular proliferation and differentiation. Several investigations have shown that animals fed diet deficient in calcium and vitamin D develops mammary hyperplasia and hyperproliferation (Lipkin and Newmark, 1999). Furthermore, animal studies have shown that supplementation with calcium and vitamin D reduces the risk of mammary tumors in animals fed a high fat diet and prevents the development of mammary tumors in animals induced with the carcinogen 7,12-dimethylbenz (a)anthracene (DMBA) (Mehta et al., 2000). A third potential mechanism to suggest that dairy products may reduce breast cancer risk involves CLA. Animal studies suggest that CLA confers protection against the development of mammary tumors (Ip et al., 1996). It is interesting to note that tumor formation was inhibited in animals fed CLA, regardless of the type or amount of fat in their diets. Another compound found in dairy products, known to have protective effect against mammary carcinogenesis is butyric acid. Epidemiological studies Most of the epidemiological studies showed no consistent pattern of increased or decreased breast cancer risk with a high consumption of dairy products (Moorman and Terry, 2004). Two of the cohort studies and 10 of the case-control studies investigated the association between breast cancer and butter consumption and no consistent pattern was observed with reported butter intake. In a cohort study conducted in Finland (Knekt et al., 1996), an inverse association that was not statistically significant was reported; whereas a slight positive association was reported in a cohort study in the Netherlands (Voorrips et al., 2002). In the case-control studies, odds ratios both > and < 1.0 were reported, but generally differences between cases and controls were not statistically significant. Persons with a high consumption of butter, cheese and other high-fat dairy products may also be more likely to consume large amounts of meat or other high fat-foods that could also contribute to an increased risk of breast cancer. Further, milk fat is rarely used in isolation from other dietary items, and other milk components (milk protein, calcium, lactic acid bacteria) also have anticarcinogenic properties; hence it is not possible to separate the effect of milk fat as such. Animal studies There are a few studies in which milk fat or butter was compared with vegetable oils or margarines in animal models of carcinogenesis. The vegetable oils (soybean oil, sunflowers oil, corn oil, cotton oil) were reported to enhance DMBA induced mammary adenocarcinomas more than butter and some saturated fats (coconut oil, tallow, lard) in rodents (Carroll and Khor, 1971; Yanagi et al., 1989; Cope and Reeve 1994). The milk fat was more effective when introduced in the diet at weaning (Klurfeld et al., 1983). The work done in this laboratory (Bhatia and Kansal, in press) showed that ghee (clarified butter fat) opposed to soybean oil attenuated the gastrointestinal and mammary carcinogenesis. Gastrointestinal carcinogenesis was induced by DMH in weanling male rats fed diet containing at 10% level of soybean oil or buffalo ghee or cow ghee. The incidence was considerably higher in animal on soybean oil (73.30%) than on cow ghee (55%) or buffalo ghee (40%). Tumor multiplicity and tumor volume were less on ghee diets than on soybean oil, and cow ghee was more efficacious than buffalo ghee in reducing 69 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance tumor volume. Increased accumulation of CLA and decreased lipid peroxidation (measured by the level of TARS) in liver and colorectal tissue on ghee opposed to soybean oil correlated with decreased tumor incidence, tumor multiplicity and tumor volume on ghee diets. Similar dietary treatment was given to weanling female rats and mammary carcinogenesis was induced by DMBA. Considerable number of animal died in all dietary groups due to acute DMBA toxicity and mortality incidence was greater on soybean oil than on ghee groups. Cow ghee opposed to soybean oil decreased the tumor multiplicity, tumor volume and non-neoplastic disorders. In recent studies (Rani and Kansal, 2010) we evaluated the mechanism of protective effect of cow ghee versus soybean oil in DMBA induced mammary carcinogenesis rat model. Four groups of female rats were fed for 44 weeks diet containing cow ghee or soybean oil. Mammary carcinogenesis was induced with 7,12-dimethylbenz(a)anthracene (DMBA) given through oral intubation. The two groups, which were not given DMBA but fed similarly, served as controls. The animals challenged with DMBA developed tumors in both cow ghee fed and soybean oil fed rats. The tumor latency period was greater on cow ghee (27 weeks) than on soybean oil diet (23 weeks). The tumor incidence was considerably higher in animals on soybean oil (65.4%) than on cow ghee diet (26.6%). The tumor volume and tumor weight were significantly less on cow ghee (1925 mm3, 1.67 g) than on soybean oil diet (6285 mm3, 6.18 g). The progression of carcinogenesis was more rapid on soybean oil than on cow ghee diet. While no adenocarcinoma was observed in cow ghee group, 8% of tumors in soybean oil group were adenocarcinoma. Cyclooxygenase-2 (COX-2) is a rate-limiting step in synthesis of prostaglandin E2, and the excessive production of the latter promotes mammary carcinogenesis. The expression of COX-2 was observed in DMBA treated rats, but not in untreated rats. The expression of COX-2 was significantly greater on soybean oil than on cow ghee diet in tumor tissue as well as in uninvolved tissue of tumor bearing animals (Rani and Kansal, 2010). The cyclin A and D up regulate cell proliferation and promote tumerogenesis in carcinogen treated animals. The expression of cyclin A in carcinogen treated rats was significantly greater in soybean oilfed rats than in cow ghee-fed rats, both in tumor bearing and no tumor bearing rats, and in tumor tissue and in uninvolved tissue of tumor bearing rats. The expression of cyclin D was also significantly greater on soybean oil diet than on cow ghee diet, both in control and carcinogen treated rats (Rani et al., 2010) The peroxisome proliferators activated receptor-Оі (PPAR-Оі) down regulates cell proliferation and up regulates apoptosis, and thus prevents tumorogenesis. The expression of PPAR-Оі was significantly greater on cow ghee diet than on soybean oil diet, both in control and carcinogen treated rats. Further, its expression was greater on cow ghee than on soybean oil both in tumor bearing and no tumor bearing rats of treated animals (Rani and Kansal, 2010). The Bax up regulates apoptosis and thus prevents progression of tumorogenesis. Its expression was decreased in tumor tissue and uninvolved tissue of tumor bearing rats. However, the dietary treatment with cow ghee or soybean oil has no effect on expression of Bax (Rani et al., 2010) The expression of both bcl2 and PKC genes was not effected by dietary treatments with cow ghee or soybean oil in control as well as in no tumor bearing treated animals. However, their expression was significantly less on cow ghee than on soybean oil in tumor tissue as well as in uninvolved tissue of tumor bearing rats (Rani et al., 2010) Apoptotic signal decreased in tumor bearing animals. In uninvolved tissue of tumor bearing animals the decrease was significantly more on soybean oil than on cow ghee, while in tumor tissue the decline in apoptotic signal was similar on cow ghee and soybean oil. In control animals and no tumor bearing animals, the apoptotic signal was not affected by dietary treatment with cow ghee or soybean oil. Hence, cow ghee feeding decreases expression of genes involved in cell proliferation, and increases apoptotic signal (Rani et al., 2010) Most of carcinogens in nature occur in inactive form, and these are activated by cytochrome 70 Cow Ghee Protects from Mammary Carcinogenesis: Mechanism P450 activities present in liver. Several enzymes present in liver and the target tissue detoxify the active carcinogen. The balance of these two activities determines the active carcinogen present in the body at a given moment. Feeding cow ghee opposed to soybean oil decreased carcinogen activating cytochrome P4501A1, CYP1A2, CYP1B1 and CYP2B1 activities in liver. Further, feeding cow ghee opposed to soybean oil also increased carcinogen-detoxifying activities, Оі-glutamyltranspeptidase, uridinediphospho-glucuronosyl transferase and quinone reductase in liver and mammary gland tissue of control as well as DMBA treated rats (Rani and Kansal, 2011) . The present study shows that compared to vegetable oil, cow ghee confers protection against mammary gland carcinogenesis. The mechanism involves modulation of xenobiotic metabolism and expression genes involved in cell proliferation and apoptosis. Nutraceutical importance of cow ghee over vegetable oils in conferring protection against mammary cancer has been validated. This counters the propaganda against dairy ghee and indiscriminate promotion of vegetable oil as health food. References Bhatia, E. 2005. Effects of dairy Ghee versus soybean oil on 1,2-dimethylhydrazinedihydrochloride induced gastrointestinal tract carcinogenesis and lipid peroxidation in rats. Ind. J. Med. Res (in press) Bhatia, E. and Kansal, V. K. (2010) Dairy Ghee opposed to soybean oil attenuates diet-induced hypercholesterolemia in rats. Milchwissenschaft (Germany), in press Carroll, K.K. and Khor, H.T. 1971. Effects of level and type of dietary fat on incidence of mammary tumors induced in female Sprague-Dawley rats by 7,12-dimethylbenz[a] anthracene. Lipids, 6: 415-420. Colston, K.W. and Hansen, C.M. 2002. Mechanisms implicated in the growth regulatory effects of vitamin D in breast cancer. Endocr. Relat. Cancer, 9: 45-49. Cope, R.B. and Reeve, V.E. 1994. Modification of 7,12-dimethylbenzanthra-cene (DMBA) / ultraviolet radiation (UVR) co-carcinogenesis, UVR carcinogenesis and immune suppression due to UVR and cis urocanic acid by dietary fats. Photochem. Photobiol., 59: 24S. Enig, M.G., Munn, R.J. and Keeney, M. 1978. Dietary fat and cancer trends - a critique. Fed. Proc., 37(9): 2215-2220 Fay, M.P., Freedman, L.S., Clifford, C.K. and Midthune, D.N. 1997. Effect of different types and amounts of fat on the development of mammary tumors in rodents : A review. Cancer Res., 57: 3979-3988. Ip, C., Briggs, S.P., Haegele, A.D., Thompson, H.J., Storkson, J. and Scimeca, J.A. 1996. The efficacy of conjugated linoleic acid in mammary cancer prevention is independent of the level or type of fat in the diet. Carcinogenesis., 17: 1045-1050. Klurfeld, D.M., Weber, M.M. and Kritchevsky, D. 1983. Comparison of semi-purified and skim milk protein containing diets on DMBA-induced breast cancer in rats. Kiel. Milchwirtschaft. Forschun., 35: 421-422. Knekt, P., Jarvinen, R., Seppanen, R., Pukkala, E. and Aromaa, A. 1996. Intake of dairy products and the risk of breast cancer. Br. J. Cancer, 73: 687-691. Lipkin, M. and Newmark, H.L. 1999. Vitamin D, calcium and prevention of breast cancer : A review. J. Am. Coll. Nutr., 18: 392S-397S. Mehta, R., Hawthorne, M., Uselding, L., Albinescu, D., Moriarty, R., Christov, K. and Mehta, R. 2000. Prevention of N-methyl-N-nitrosourea-induced mammary carcinogenesis in rats by Оі-hydroxy vitamin D5. J. Natl. Cancer Inst., 92(22): 1836-1840. Moorman, P.G. and Terry, P.D. 2004. Consumption of dairy products and the risk of breast cancer: A review of the literature. Am. J. Clin. Nutr., 80: 5-14. Rani, R and Kansal, V. K. (2010) Dietary intervention of cow Ghee versus soybean oil on 7,12dimethylbenz(a)anthracene induced mammary carcinogenesis and expression of cyclooxygenase-2 and peroxisome proliferators activated receptor- Оі in rats. Indan. Journal of Medical Research (in press) Rani, R., Kansal, V. K., Kaushal, D and De, D. (2010) Dietary intervention of cow Ghee and soybean oil on expression of cell cycle and apoptosis related genes in normal and carcinogen treated rat mammary gland. Molecular Biology Reports (Netharlands) DOI: 10.1007/S11033-010-0435-1 Rani, R and Kansal, V. K. (2010) Dietary intervention of cow Ghee versus soybean oil on 7,12-dimethylbenz(a)anthracene induced mammary carcinogenesis and expression of cyclooxygenase-2 and peroxisome proliferators activated receptor- Оі in rats. Indan. Journal of Medical Research (in press) Rose, D.P., Connolly, J.M. and Meschter, C.L. 1991. Effect of dietary fat on human breast cancer growth and lung metastasis in nude mice. J. Natl. Cancer Inst., 83: 1491-1495. Voorrips, L.E., Brants, H.A.M., Kardinaal, A.F.M., Hiddink, G.J., van den Brandt, P.A. and Goldbohm, R.A. 2002. Intake of conjugated linoleic acid, fat, and other fatty acids in relation to postmenopausal breast cancer : The Netherlands Cohort Study on Diet and Cancer. Am. J. Clin. Nutr., 76: 873-882. Yanagi, S., Yamashita, M., Sakamoto, M., Kumazawa, K. and Imai, S. 1989. Comparative effects of butter, margarine, safflower oil and dextrin on mammary tumorigenesis in mice and rats. In: The Pharmacological Effects of Lipids. III. The role of Lipids in Cancer Research (J.J. Kabara, ed.). Lauricidin Inc., Galena, IL, pp.159-169. 71 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Lateral Flow Assay- Principle and its Application in Analytical Food Science Rajan Sharma and Priyanka Singh Rao Dairy Chemistry Division, NDRI, Karnal Introduction The lateral flow assay (LFA), also called the immunochromatographic assay or the strip assay is a simple device intended to detect the presence (or absence) of a target analyte in sample (matrix). This technique is based on an immunochromatographic procedure that utilizes antigenвЂ“antibody properties and enables rapid detection of the analyte. It includes several benefits, such as a user-friendly format, rapid results, long-term stability over a wide range of weather conditions, and relatively low manufacturing costs. These characteristics render it ideally suited for on site testing by untrained personnel. The main application of Figure 1. Typical configuration of a lateral flow this technology had been the human pregnancy immunoassay test strip test which came in picture in the 1970s. However, to fully develop the lateral flow test platform, a variety of other enabling technologies were also required. These include technologies as diverse as nitrocellulose membrane manufacturing, antibody generation, fluid dispensing and processing equipment, as well as the evolution of a bank of knowledge in development and manufacturing methodologies. Many of these facilitative technologies had evolved throughout the early 1990s, the first lateral flow products were introduced to the market in the late 1980s. Since then, as of 2010, over 200 companies worldwide are producing a range of testing formats. The world market for LF-based tests (Rosen, 2009) is estimated at $2,270 million in 2005 and, with a compounded annual growth rate (CAGR) of 10%, it will reach $3,652 million in 2012. This estimate includes LF-based tests used in human and veterinary medicine, food and beverage manufacturing, pharmaceutical, medical biologics and personal care product production, environmental remediation, and water utilities. Architecture and working of a lateral flow immunoassay Figure 1 shows the typical configuration of a LFA which is composed of a variety of materials, each serving one or more purposes. The parts overlap onto one another and are mounted on a backing card using a pressure-sensitive adhesive. The assay consists of several zones, typically constituted by segments made of different materials. When a test is run, sample is added to the proximal end of the strip, the sample pad. Here, the sample is treated to make it compatible with the rest of the test. The treated sample migrates through this region to the conjugate pad, where a particulate conjugate has been immobilized. The particle can typically be colloidal gold, or a colored, fluorescent, or paramagnetic monodisperse latex particle. This particle has been conjugated to one of the specific biological components of the assay, either antigen or antibody depending on the assay format. The sample re-mobilizes the dried conjugate, and the analyte in the sample interacts with the conjugate as both migrate into the next section of the strip, which is the reaction matrix. This reaction matrix is a porous membrane, onto which the other specific biological component of the assay has been immobilized. These are typically proteins, either antibody or antigen, which have been laid down in bands in specific areas of the membrane where they serve to capture the analyte and the conjugate as 72 Lateral Flow Assay- Principle and its Application in Analytical Food Science they migrate by the capture lines. Excess reagents move past the capture lines and are entrapped in the wick or absorbent pad. Results are interpreted on the reaction matrix as the presence or absence of lines of captured conjugate, read either by eye or using a reader. Lateral flow assay formats This test can be performed on two platforms, either direct (sandwich) or competitive (inhibition) and also can be used to accommodate qualitative, semi quantitative and in limited cases, fully quantitative determination. Direct assay format: Direct assays (Figure 2) are typically used when testing for larger analyte with multiple antigenic sites i.e. analyte presenting several epitopes. This system (equivalent to sandwich ELISA) employs two different antibodies (polyclonal and monoclonal) that bound distinct epitopes of the analyte: a labelled polyclonal antibody is placed in a dehydrated state onto a glass-fiber membrane (conjugate pad) to serve as detector reagent and a monoclonal antibody specific to the analyte is sprayed at the test line of the nitrocellulose membrane to serve as capture reagent. An additional antibody specific to the detection antibody (species specific) could be used to produce a control signal at control line. Figure 2. Direct Lateral Flow Assay Figure 3. Competitive Lateral Flow Assay When a sample extract is applied to sample pad, the liquid migrates up by capillary force and the detector reagent is then released. Some of the analyte bind to the detection antibody and some remain free in the solution. Subsequently, the mixture passes through the capture zone (test line) and both unbound analyte and bound analyte bind to the capture antibody. The response in the capture zone (test line) is directly proportional to the amount of analyte in the sample. Competitive assay: Competitive assay formats (Figure 2) are typically used when testing for small molecules with single antigenic determinants, which cannot bind to two antibodies simultaneously. In this format, an analyte-protein conjugate coated on the test zone of a nitrocellulose membrane captures a labelled anti-analyte monoclonal antibody complex, allowing colour particle (e.g. colloidal gold) to concentrate and form a visible line on the test zone. Another specific antibody coated on the control line allows the capture of the excess antibody complex. One band colour will therefore be visible in the control zone regardless of the presence of target analytes, confirming correct test development. Conversely, a negative sample will result to the formation of two band colours visible (test line and control line) Materials and processes in lateral flow immunoassay development and construction A typical test strip consists of the following components: Membrane/Analytical Region: The purpose of the analytical region in a lateral flow immunoassay is to bind proteins at the test and control areas and to maintain their stability and activity over the 73 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance shelf-life of the product. The membrane material is typically a hydrophobic nitrocellulose or cellulose acetate membrane onto which anti-target analyte antibodies are immobilised in a line across the membrane as a capture zone or test line. A control zone may also be present, containing antibodies specific for the conjugated antibodies. Nitrocellulose, while extremely functional, the only material that has been successfully and widely applied for LIFA because of itвЂ™s relatively low cost, true capillary flow characteristics, high protein-binding capacity, relative ease of handling. Conjugate Pad or reagent pad: This contains antibodies specific to the target analyte conjugated to coloured particles (usually colloidal gold particles, or latex microspheres). The role of the conjugate pad in a lateral flow immunoassay is to accept the conjugate, hold it stable over its entire shelf life, and release it efficiently and reproducibly when the assay is run. The materials of choice are glass fibers, polyesters, or rayons. Sample Pad: Sample pad is an absorbent pad onto which the test sample is applied. One of the major advantages of the lateral flow concept is that these assays can be run in a single step with many different sample types in a variety of application areas. The role of the sample pad is to accept the sample, treat it such that it is compatible with the assay, and release the analyte with high efficiency. The materials used for the sample pad depend on the requirements of the application. Examples of such materials are cellulose, glass fiber, rayon, and other filtration media. Wick or waste reservoir: The wick is the engine of the strip. It is designed to pull all of the fluid added to the strip into this region and to hold it for the duration of the assay. It should not release this fluid back into the assay or false positives can occur. The material is typically a high-density cellulose. Backing Materials: All components of the lateral flow assay are laminated to the backing material to provide rigidity and easy handling of the strip. The backing material is coated with a pressuresensitive adhesive to hold the various components in place. The backing materials are typically polystyrene or other plastic materials coated with a medium to high tack adhesive. Labels for Detection: The most commonly used particulate detector reagents in lateral flow systems are colloidal gold and monodisperse latex. Latex particles coupled with a variety of detector reagents, such as colored dyes, fluorescent dyes, and magnetic or paramagnetic components, are available commercially. Applications of lateral flow assays in food quality assurance In the past 3вЂ“5 years, food safety issues and concerns for public health have led to more stringent legislation in food safety requirements. Legislation has produced increased demand for pathogen and toxin tests in just about every segment of the food production industry вЂ“ processed food, meats, poultry, beverages, and dairy; and by all major food producers worldwide. For monitoring residue contaminants such as veterinary, pesticide and antibiotic residues, an analytical strategy has been recommended using two different methods. This strategy comprises: (i) screening with a first method optimized to prevent false negative results, with a high sample throughput (e.g. ELISA), an acceptable percentage of false positive results and low cost, and (ii) confirmation with an independent second method optimized to prevent false positive results. Confirmatory methods are generally separative techniques coupled with various detectors such as HPLC and GCвЂ“MS. Chromatography methods are sensitive and specific, but suffer from being time consuming, laborious and multi-complex. In addition, these technologies are unaffordable to the farmers and some laboratories in the developing countries. Therefore there have been emergent needs for developing highly accurate, rapid and cheap analytical tools. Lateral flow tests provide advantages in simplicity and rapidity when compared to the conventional detection methods. LFT has also been confirmed to be a rapid and sensitive method in the detection of food borne pathogens such as Salmonella, Listeria, Campylobacter, Clostridium and Escheriachia coli. Apart form these pathogens, LFA also has been employed for the detection of bacterial toxins and zoonotic viruses such as Avian Influenza (AIV). LFA have also been used for the detection of potentially allergenic peanut and hazelnut in raw cookie dough and chocolate. The 74 Lateral Flow Assay- Principle and its Application in Analytical Food Science Table :- applications of lateral flow assays in food analysis Analyte Assay format Labels Sample Sensitivities Reference Detection of pathogen bacteria and related toxins Staphylococcus aureus Sandwich Colloidal gold Pork, Beef, Fried Chicken <25 CFU/g (93.0вЂ“100%) [4] Escherichia coli Sandwich Colloidal gold Milk Powder, Flour, Starch, Etc 105CFU/ml [18] Listeria monocytogenes Sandwich Carbon black Dairy Products 10 CFU/25 mL [1] Salmonella enteritidis Sandwich Colloidal gold Raw Eggs 107CFU/ mL [15] Staphylococcus aureus enterotoxin B Sandwich Fluorescent immunoliposomes Water, Apple Juice, Ham , Milk, Cheese 0.02вЂ“0.6 pg/ ml [5] Detection of veterinary drug residues mycotoxins and pesticides Veterinary Drug Residue Progesterone Competitive Colloidal gold Bovine Milk 0.6вЂ“1.2 Ојg/L [3] Deoxynivanelol and Zearalenone Competitive Colloidal gold Wheat 100вЂ“1500 Ојg/kg [6] Deoxynivanelol Competitive Colloidal gold Wheat and Maize 50 ng./mL [22] Aflatoxin B1 Competitive Colloidal gold Rice, Corn ,Wheat 0.05вЂ“2.5 ng/ ml [23] Aflatoxin B2 Competitive Magnetic nanogold microsphere Peanut, Hazelnut, Pistacia, Almond 0.9 ng/ ml [17] Total B fumonisins (B1, B2 and B3) Competitive Colloidal gold Maize 4,000 Ојg/ kg [8] Ochratoxin Competitive Colloidal gold Coffee 5 ng/ml [21] Ochratoxin Competitive Colloidal gold Barley, Wheat, Oat, Corn, Rice etc 1 ng/ mL [19] Methamidophos Competitive Colloidal gold Green Vegetables 1.0 Ојg/ mL [2] Thiabendazole and Methiocarb Competitive Carbon black Fruit Juices 0.005вЂ“0.5 mg/kg [16] Carbaryl Competitive Colloidal gold Rice And Barley 50вЂ“10 Ојg/L [20] Hazelnut Protein Competitive Unknown Chocolates 3.5 mg/kg [13] Doughs 2.6 mg/kg Allergenic Peanut Protein Ara H1 Competitive Unknown Chocolates 0.8 mg/kg Doughs 0.6 mg/kg Milk and milk powder 15 ng/ml [7] 0.50 (%, w/w) [12] Mycotoxins Pesticides Detection of Allergens Detection of Adulteration Rennet whey in milk& Sandwich milk powder Latex beads Raw Beef in chicken Cooked Sterilized Thermal-stable ruminant-specific muscle protein, troponin I Competitive Coloured particles Lamb-inpork Beef-inturkey Raw Cooked 0.05 (%, w/w) Sterilized Raw 0.10 (%, w/w) Cooked Sterilized 75 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Table summarizes the published reports on LFT applications in this field. A driver in the demand for rapid and LF tests in food production is the adoption of Hazard Analysis and Critical Control Points (HAACP) regulations that prescribe test procedures throughout the manufacturing process. A number of manufacturers have come with LF type tests. No one company dominates the market for LF food tests. The leaders are Strategic Diagnostics, Inc. (Newark, DE), Neogen, Idexx Labs and Biocontrol Systems (Brownsville, CA). Other companies include Celsis International PLC (Chicago, IL), Medical Wire & Equipment Co. (Wiltshire, United Kingdom), Merck KgaA (Dermstadt, Germany), and M-Tech Diagnostics Ltd. (Cheshire, United Kingdom). Conclusions A variety of analytical methods available for detecting pathogen organisms or hazardous chemicals related to food safety, human health and environment suffers from being time-consuming, too expensive and too complicated to use. Major advantages found on LFT are low-cost, speed, portable, do not require complicated equipment and technical expertise, which are critical components during testing in the field. Since its initial development in the 1980s, the technology of Lateral Flow Immunoassay has gained wide acceptance. The main reason for its popularity is the simplicity of the test design. The lateral flow immunoassay devices are compact and easily portable. Most of them do not require external reagent for results. Results are quick and easy to interpret, usually without the help of an instrument. The technology is also powerful. Multiple analytes can be tested simultaneously with a single device. It can also be easily combined with other technology to provide a comprehensive analysis like simultaneous drug and alcohol determinations by the police force in a roadside testing situation. Manufacturing of the test is relatively easy and inexpensive. Advancement in the detection moieties, improvement in material components, availability of better processing equipment, and increased attention to quality manufacturing all these factors contribute to increase in the reliability, accuracy, and applications of the technology. However, the continuing demand for quantitative result and sensitivity has presented great challenge for assay developer. References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 76 Blaskoza M, Koet M, Rauch P, Amerogen AV (2009) Eur Food Res Technol 229:867вЂ“874 Chenggang S, Suqing Z, Kun Z, Guobao H, Zhenyu Z (2008) J Environ Sci 20:1392вЂ“1397 Geertruida A, Posthuma T, Jakob K, Amerogen AV (2008) Anal Bioanal Chem 392:1215-1223 Huang S-H, Wei H-C, Lee Y-C (2007) Food Control 18:893вЂ“897 Khreich N, Lamourette P, Boutal H, Deveilliers K, Creminon C, Vollad H (2008) Anal Biochem 377:182вЂ“188 Kolosova AY, De Saeger S, Sibanda L, Verheijen R, Peteghem CV (2007) Anal Bioanal Chem 389:2103вЂ“2107 MartД±Вґn-HernaВґndez, C.; MunЛњoz, M.; Daury, C.; Weymuth, H.; Kemmers-Voncken, A.E.M,; CorbatoВґn, T.; Toribio, T. and Bremer, M.G.E.G. (2009). Int Dairy J. 19:205вЂ“208. Molinelli A, Grossalber K, Krska R (2009) Anal Bioanal Chem 395:1309вЂ“1316 Ngom, B., Guo, Y. Wang, X and Bi, D. (2010) Anal. Bioanal. Chem. 397: 1113-1135. OвЂ™Farrell, B. (2009) Evolution in lateral flow-based systems. In: Lateral flow immunoassay. (Ed. R.C. Wong and H.Y. Tse). Springer, NY, USA. Ponti, J.S. (2009)Material platform for the assembly of lateral flow immunoassay test strips. In: Lateral flow immunoassay. (Ed. R.C. Wong and H.Y. Tse). Springer, NY, USA. Q. Rao, Y.-H. Peggy Hsieh. (2007) Meat Science. 76: 489вЂ“494 RГ¶der M , Vieths S, Holzhauser T (2009) Anal Bioanal Chem 395:103вЂ“109 Rosen, S. (2009) Market Trends in Lateral Flow Immunoassays. In: Lateral flow immunoassay. (Ed. R.C. Wong and H.Y. Tse). Springer, NY, USA. Seo K-H, Holt PS, Gast RK, Stone HD (2003) Int J Food Microbiol 87:139вЂ“144 Smidova Z, Blazkova M, Fukal L, Rauch P (2009) Czech J Food Sci 27:S414вЂ“S416 Tang D, Sauceda JC, Lin Z, Basova SOE, Goryacheva I, Biselli S, Lin J, Niessner R, Knopp D (2009) Biosens Bioelectron 25:514 Wang J, Chen WN, Hu KX, Li W (2006) Chinese J 35:439вЂ“441 Wang XH, Liu T, Xu N, Zhang Y, Wang S (2007) Anal Bioanal Chem 389:903вЂ“911 Wang S, Zhang C, Wang J, Zhang Y (2005) Anal Chim Acta 546:161вЂ“166 Wang J, Yu F-Y (2008) Anal Chem 80:7029вЂ“7035 Xu Y, Huang Z-B, He QH, Deng SZ, Li LS, Li YP (2010) J Food Chem 119:834вЂ“839 Xiulan S, Xiaolian Z, Jian T, Xiaohong G, Jun Z, Chu FS (2006) Food Control 17:256вЂ“262 Separation Strategies for Bioactive Milk Proteins Separation Strategies for Bioactive Milk Proteins Rajesh Kumar Dairy Chemistry Division, NDRI, Karnal Introduction: Over the past three decades, the dairy industry globally has moved from being based solely on commodity food production to earning a significant income from specialty proteins. The introduction of large scale membrane processing in the early 1970вЂ™s made it possible not only to reduce waste but to produce new products such as lactose and whey protein concentrate. A logical extension of the latter product is whey protein isolate (WPI), produced by single-stage batch capture of proteins on anion exchange resins. WPI is a crude mixture of acidic whey proteins, containing mainly О±-lactalbumin, ОІ-lactoglobulin, bovine serum albumin and immunoglobulins. Two whey proteins not captured during WPI production by anion exchange chromatography because of their high isoelectric points are lactoferrin (LF) and lactoperoxidase (LP). These basic proteins are instead captured from whey or skim milk by cation exchange chromatography and sold as specialty ingredients. Although production of high-value whey proteins is a commercial reality, two aspects of dairy processing may not be optimal for their production. First, the proteins are subjected to a series of processing steps prior to being extracted. It is a generally accepted principle of bioseparation process design that proteins should be separated from a source material as fast and in as few steps as possible to avoid loss of activity and yield. Currently, high-value dairy proteins are viewed as a by-product, with the major income of the industry coming from commodity dairy foods such as milk powder, cheese and butter. Economies of scale for production of commodity dairy products mean that centralized processing is the industry norm. Separation technologies provide the basis for adding value to milk through the production of bioactive components that provide the food industry with nutraceuticals to develop functional foods. The global functional food and nutraceutical market is currently worth about US$50 billion and is growing at some 8 вЂ“ 10 % annually. This huge and rapidly growing market, driven by consumer demands for healthpromoting foods, is creating an almost insatiable desire on the part of food manufacturers for new and novel ingredients with which to formulate these foods. Dairy constituents, notably the proteins and peptides, provide the food technologist with a rich selection of potential ingredients for functional foods. Dairy proteins and peptides are truly multi-functional components, providing desirable features such as physical functional traits, nutritional qualities and an increasing array of substantiated bioactivities. Their promise is clear. The challenge for science and technology is to isolate these ingredients in a costeffective manner while maintaining their inherent bio functional traits. Protein bioseparation: Protein bioseparation refers to the recovery and purification of protein products from various biological feed streams is an important unit operation in the food pharmaceutical and biotechnological industry. Protein bioseparation is at present more important than at any time before due to phenomenonal developments in recent years in the frontiers of separation technology. Novel separation techniques: Separation technologies used to produce protein ingredients derived from milk include screening based on size differences: centrifugation based on density differences; membrane processes based on size differences, such as ultrafiltration, diafiltration, nanofiltration, and reverse osmosis; ion exchange based primarily on charge differences; and affinity chromatography based on specific binding to a matrix. Owing to unique functional and biological properties of many of the whey proteins, a number of pilot and industrial scale technological methods have been developed for their isolation in a purified form. Improved separation technologies and emerging markets have resulted 77 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance in fractionation of milk proteins into ingredients that are enriched in specific proteins, or peptides, or both to fill those new opportunities. This is especially true for milk protein fractions that are in very low concentrations in the native state that require further concentration. These ingredients may be especially useful in the developing market of physiologically functional foods, or nutraceuticals. Separation technologies are available to prepare fractions that are enriched in the following milk components: alpha-CN, beta-CN, beta-LG, alpha-LA, casein phosphopeptides, lactoferrin, lactoperoxidase and immunoglobulins and other minor proteins with special functional properties. Many of these products are commercially available in limited quantities. Bioactive peptides derived from food proteins are often intermediates and are isolated from a very complex peptidic hydrolysates in which their concentration are very low. The preparation of such peptides generally requires time consuming steps. Accordingly commercial production of bioactive peptide from milk proteins has been limited by lack of suitable large scale techniques. Until now membrane based separation tech. has provided best technique for enrichment of peptides. Chromatographic techniques: Chromatographic techniques have been widely used for the isolation of milk proteins, and high performance methodology now forms the basis for several accurate methods of analysis. Different types of separation chemistries are used for chromatographic separation of milk proteins. In its simplest form, a chromatographic separation system consists of a column filled with separation adsorbent beads. Chromatography has been known since the turn of the century, but its primary use has been in the analytical sector, where the excellent separation capability has been a valuable investigative tool. The industrial use of this technology has however, been fairly limited and mainly used for high value added products in the pharmaceutical industry. Low processing rates and difficulties in scaling up chromatographic separation from laboratory to production scales has hampered the broader use and acceptance of the technology. However, now with the advancement in chromatography based separation technology, it has greatly improved the profitability of dairy industry through the best possible utilization of raw material especially whey in a cost effective manner. Chromatographic systems: The chromatographic systems are in many ways similar to ion-exchange systems. The variety in adsorbent types and the range of applications are however far beyond what is known for ion exchange, and this has created a need for more sophisticated systems such as membrane adsorber based chromatography, stirred tank batch process and expanded bed chromatography. Ion-exchange Chromatography Ion-exchange chromatography is the most popular method for protein purification. The theory of it is to use the difference of charges on proteins at a given pH. The solid adsorbents are charged, positive or negative. Then the charged protein will be adsorbed by the charged adsorbents. According to the difference of the interaction forces between the protein and adsorbent, different protein is bounded differently by the adsorbent. Then, when we use some other buffer to replace the protein, they (the proteins) will be washed out of the adsorbents in different velocity: the less the interaction between the adsorbent and the proteins, the faster they will be washed out. Then, proteins can be separated according to the sequence of their elution. There are two kinds of ion exchangers: anion exchangers, which have positively charged matrix, and will adsorb the proteins with negative charge; cation exchanger, which have negative charged matrix, and will adsorb the proteins with positive charge. The most common anion exchangers are DEAE- ,TEAE- and QAE-, and the cation exchangers often being used are CM- , S-. Membrane Chromatography: In order to overcome the limitations of traditional beads column, synthetic microporous or macroporous membranes have been used as chromatography media. This method is called membrane chromatography. Membrane chromatography can overcome the limitations associated with packed 78 Separation Strategies for Bioactive Milk Proteins beds based chromatography. In membrane chromatographic processes, the transport of solutes to their binding sites take place predominantly by convection and the pore diffusion is very small comparing with the beads column, thereby the mass transfer resistance is tremendously reduced. The result of this advantage is to reduce process time including adsorption, washing, elution and regeneration time, which save time and improve efficiency. Most importantly, fast process can avoid the inactivity of biomolecules. As we all know, all the biomolecules have activities. The faster is the process, the less possibility for the biomolecules lose activity. The id ea of membrane chromatography is especially suited for large scaleprocess since the column volume of membrane can be made from less than 0.1 ml and larger than thousands of liters. Due to the macroporous structure of the membrane support, membrane chromatography has a lower pressure drop, higher flow rate and higher productivity. There are many advantages of using membrane chromatography over column chromatography. The rate of association between target proteins and functional groups in ion exchange membranes is very rapid, unlike the slow rate of diffusion through packed columns. The fast convective flow combined with negligible pressure drop lim itations exhibited by the thin membranes mean that processing times are dramatically reduced compared with packed columns. A distinct advantage of pressure driven ion exchange processes is that there are no heat-treatments, extremes of pH, or chemical pretreatment that could compromise protein structure and functionality. Hence, development of ion exchange membranes would be most desirable in terms of purifying individual whey proteins for use in functional foods and pharmaceutical products (Goodall et al., 2008). Application of membrane chromatography for protein purification Usually, the membranes used for membrane chromatography have functional ligands attached to their inner pore surface as adsorbents. There are many types of adsorptive membranes including ionexchange membranes, affinity membranes, reverse-phase membranes and hydrophobic interaction membranes. All these membranes have been developed for the purification of proteins, enzymes, and antibodies from various sources. The stirred tank system: In the stirred tank system for protein fractionation, the liquid to be treated is slurried with the chromatographic adsorbent material, in this case an ion-exchange resin, - until adsorption has occurred. The deproteinised solution is then draining from the stirred tank. The adsorbent is then washed with water, prior to desorption of the proteins using an acid, alkali and/ or mineral salt solution. Compared to the column system, the disadvantage of the stirred tank system is the fact that all the target proteins are not removed, due to the equilibrium conditions. This problem can be partly solved by refeeding the deproteinised solu tion to the adsorbent material, before the next batch of whey is treated. The stirred tank system allows the use of larger adsorbent particles, since the contact time between adsorbent and liquid can be increased. This facilitates the removal of the process solu tion, and makes the process less sensitive to fat and suspended solids. Also less overall changes in pH are required during the complete adsorption / desorption cycle, which reduces the risk of protein denaturation, improving the final p roduct quality. Expanded bed chromatography: In expanded bed chromatography, viscous and particu late-containing feeds that would foul a traditional packed column are accommodated by introducing the feed upward through a column packed with media designed to be suspended and dispersed in the upward flow. The bed expansion creates an increased void space between adsorbent particles allowing passage of particulate contaminants in the feed and preventing unacceptable pressure buildup within the column. Once the feed is loaded and the target product is bound to the adsorbent, a wash step is performed, also in expanded bed upward flow mode, to remove particulates and unbound contaminants. Elution of the target product is then performed via downward flow in traditional packed bed mode. Some studies relate elution performed with an expanded bed upward flow mode. This tends to increase the elution volume. A clean-in-place procedure is normally required after elution to prepare the column for another loading 79 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance step. An expanded bed is essentially a cross between a packed bed, with stationary p articles and low flu id dispersion, and a fluidized bed, with randomly mixing particles and high flu id dispersion. Process design variables for optimizing expanded bed chromatographic separations include chemical and physical properties of the packing media and of the feed solutions. Chromatographic media with the appropriate density, particle size distribution, and mechanical stability required for expanded bed operation are commercially available with several different chemistries including anion and cation exchange. The chemical properties of the feed such as pH, ionic strength, and buffer type that affect selectivity and capacity of the process have essentially the same effect in expanded bed mode as they do in traditional packed bed chromatography. High Gradient Magnetic Fishing (HGMS): Heeboll-Nielsen et al., (2004) described the process for separation of lactoferrin and lactoperoxidase from whey using superparamagnetic ion exchangers. HGMS is employed to simply remove product or contaminants from process or waste streams in mineral processing. The term HGMF covers the integrated process from product adsorption to magnetic separation and finally recovery of the product in a clarified and partly purified form, in contrast to merely the collection of particles in HGMS. The objectives of the individual steps in HGMF are similar to those of any chromatographic purification process, and the process generally consists of: (i) mixing of the feedstock with the superparamagnetic adsorbents to bind the target protein; (ii) separation of the protein laden supports from the spent feedstock supernatant using high gradient magnetic separation technology; (iii) washing of the adsorbents and elu tion of bound protein from the adsorbents using multip le cycles of support capture and release and finally (iv) a procedure for cleaning and regeneration of the supports. In contrast to chromatography all steps are operated in a batchwise manner, and each operation contains a step to capture the supports in high gradient magnetic field s. For such operation the HGMF system may be +designed with stirred reactor tanks and closed recycled loops. Conclusion: Dairy manufacturing technology has expanded tremendously in recent years and the emphasis on identifying, recovering, and/ or supplementing bioactive proteins and peptides as functional ingredients will remain at forefront of future. Ultimately these approaches will improve the quality of food products containing such constituents. References: Bajaj, R.K. and Sangwan, R.B. (2002) Health enhancing potential of whey proteins вЂ“ a review. Indian J. Dairy Sci., 55(5): 253-260. Bargemana,G., Koopsb, G.-H. , Houwinga , J. , Breebaartb, I. , van der Horsta, H.C. and Wessling, M. (2002). The development of electro-membrane filtration for the isolation of bioactive peptid es: the effect of membrane selection and operating parameters on the transport rate. Desalination. 149: 369вЂ“374. Clare, D.A. , Catignani, G.L. and Swaisgood, H.E. (2003) Biodefense properties of milk: The role of antimicrobial p roteins and p eptid es. Current Pharmaceutical Design, 9: 1239- 1255. Expanded bed adsorption; princip les and methods, Amersham Pharmacia Biotech, (1997). Goodall, S., Grandison, A. S., Jauregi, P. J. and Price J. (2008). Selective separation of the major whey proteins u sing ion exchange membranes. J. Dairy Sci. 91: 1-10 Hauffman, L.M. and Harper, W.J (1999). Maximizing the value of milk through separation technologies. J. Dairy Sci., 82(10): 2238-2244 HeebГёll-Nielsen,A., Justesen,S.F.L, Hobley,T.J. and Thomas, O.R.T. (2004). High Gradient Magnetic Fishing recovery of basic whey proteins using superparamagnetic cation-exchangers. J. Biotech. 113: 247-262. Korhonen, H. (1998) Colostrum immunoglobulins and the complement system- potential ingredients of functional foods. IDF bulletin, 336: 36-40. Nielsen, W.K., Morten, A.O. and Lihme, A. Expanding the fronteiers in separation technology in Scandinavian dairy Information 2 / 02. Olander, M.A., Jakobsen, U.L., Hansen M.B. and Lihme, A. Fractionation of high value whey Proteins. in Scandinavian dairy Information 2 / 01. Roper, D.K. and Lightfoot, E.N. (1995) Separation of biomolecules using adsorptive membranes. J. of Chromatography A 702: 3 80 SDS-PAGE вЂ“ Principle and Applications SDS-PAGE вЂ“ Principle and Applications Y. S. Rajput1 and Rajan Sharma2 1 Animal Biochemistry Division, 2Dairy Chemistry Division, NDRI, Karnal Introduction and Principle The purpose of sodium dodecyl sulphate вЂ“ polyacrylamide gel electrophoresis (SDS-PAGE) is to separate proteins according to their size. SDS-PAGE is the most widely used method for analyzing protein mixture qualitatively. It is particularly useful for monitoring protein purification and, because the method is based on the separation of proteins according to size, it can be used to determine the relative molecular mass of proteins. SDS (CH3-(CH2)10-CH2OSO3-Na+) is an anionic detergent and when proteins are treated with SDS in presence of a reducing agent like ОІ-mercaptoethanol or dithiothreitol, SDS binds to hydrophobic regions of protein molecule and provides net negative charge on protein molecule. The binding of SDS to per-unit-length of protein molecules is almost constant for large number of different proteins and this brings charge-toвЂ“mass ratio almost constant for most proteins. The electrophoretic movement of protein in acrylamide gel is determined by molecular weight of proteins. Lower molecular weight proteins move faster than high molecular weight proteins. The method described by Laemmli (1970) is widely used. In this method, discontinuous buffer system is employed. A continuous buffer system has only single separating gel and uses same buffer in the tanks and gel. In discontinuous buffer system, large pore gel (stacking gel) is layered over small pore gel (separating or running gel). For preparation of stacking gel and separating gel, different buffers are used and also tank buffers are different from gel buffers. When electrophoresis is started, ions from stacking gel (leading ion), ions from buffer tank (trailing ion) and proteins start moving into stacking gel. In stacking gel, protein moves between leading ion and trailing ion and this leads to concentration of protein in a thin zone referred as stack. The protein molecules continue to move in the stack until they reach the separating gel. Formation of Polyacrylamide Gels: Crosslinked polyacrylamide gels are formed from the polymerization of acrylamide monomer in the presence of smaller amounts of N,NвЂ™-methylene-bisacrylamide (normally referred to as вЂњbis-acrylamideвЂќ) (Fig. 1). Note that bis-acrylamide is essentially two acrylamide molecules linked by a methylene group and is used as a crosslinking agent. Acrylamide monomer is polymerized in a head-to-tail fashion into long chains, and occasionally a bisacrylamide molecule is built into the growing chain, thus introducing a second site for chain extension. Proceeding in this way, a crosslinked matrix of fairly well-defined structure is formed (Figure 1). The polymerization of acrylamide is an example of free-radical catalysis, and is initiated by the addition of ammonium persulfate and the base N,N,NвЂ™,NвЂ™tetramethylenediamine (TEMED). TEMED catalyzes the decomposition of the persulfate ion to give a free radical (i.e., a molecule with an unpaired electron): S2O82- + e- ------ в†’ S2O82- + SO4-. (1) If this free radical is represented as R. (where the dot represents an unpaired electron) and M as an acrylamide monomer molecule, then the polymerization can be represented as follows: R. + M в†’ RM. RM. + M в†’ RMM. RMM. + M в†’ RMMM. and so forth (2) In this way, long chains of acrylamide are built up, being crosslinked by the introduction of the occasional bis-acrylamide molecule into the growing chain. Oxygen вЂњmops upвЂќ free radicals, and therefore the gel mixture is normally degassed (the solutions are briefly placed under vacuum to remove loosely dissolved oxygen) prior to addition of the catalyst. Use of Stacking Gels: For both SDS-PAGE and native-PAGE, samples may be applied directly to the top of the gel in which protein separation is to occur (the separating gel). However, in these cases, 81 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance the sharpness of the protein bands produced in the gel is limited by the size (volume) of the sample applied to the gel. Basically the separated bands will be as broad (or broader, owing to diffusion) as the sample band applied to the gel. For some work, this may be acceptable, but most workers require better resolution than this. This can be achieved by polymerizing a short stacking gel on top of the separating gel. The purpose of this stacking gel is to concentrate the protein sample into a sharp band before it enters the main separating gel, thus giving sharper protein bands in the separating gel. This modification allows relatively large sample volumes to be applied to the gel without any loss of resolution. The stacking gel has a very large pore size (4% acrylamide) which Figure 1. Polymerization of acrylamide allows the proteins to move freely and concentrate, or stack under the effect of the electric field. Sample concentration is produced by isotachophoresis of the sample in the stacking gel. The band-sharpening effect (isotachophoresis) relies on the fact that the negatively charged glycinate ions (in the reservoir buffer) have a lower electrophoretic mobility than the protein-SDS complexes, which in turn, have lower mobility than the C1- ions if they are in a region of higher field strength. Field strength is inversely proportional to conductivity, which is proportional to concentration. The result is that the three species of interest adjust their concentrations so that [C1-] > [protein-SDS] > [glycinate]. There are only a small quantity of protein--SDS complexes, so they concentrate in a very tight band between the glycinate and C1- ion boundaries. Once the glycinate reaches the separating gel, it becomes more fully ionized in the higher pH environment and its mobility increases. (The pH of the stacking gel is 6.8 and that of the separating gel is 8.8.) Thus, the interface between glycinate and the C1- ions leaves behind the protein-SDS complexes, which are left to electrophorese at their own rates. Procedure: The below mentioned procedure is for the separation of proteins using glycine-SDSPAGE. For the separation of low molecular weight proteins, Tricine-SDS-PAGE is used and procedure is mentioned in the compendium. Equipments and Chemicals Mini-vertical gel electrophoresis dual model with glass plates, spacer, comb and power-supply; orbital shaker; 1 ml glass syringe with 2вЂќ22G needle; acrylamide, N,N1 methylene bisacrylamide; ammonium persulfate; ОІ-mercaptoethanol; sodium dodecyl sulfate; molecular weight markers; coomassie brilliant blue R-250; TEMED; tris; glycine; dithiothreitol. Stock Solutions Acrylamide / Bisacrylamide (30%): 29.2 g acrylamide and 0.8 g bisacrylamide are dissolved in distilled water and total volume was made to 100 ml. The solution is filtered and filtered solution can be stored at 4ВєC in dark bottle up to 3 months. 4x Running Gel Buffer (1.5 M Tris-HCl, pH 8.8): 18.15 g Tris is dissolved in about 80 ml distilled water. pH is adjusted to 8.8 with 1 N HCl and total volume is made to 100 ml with distilled water. Prepared buffer can be stored up to 3 months at 4ВєC in dark bottle. 4x Stacking Gel Buffer (0.5M Tris-HCl, pH 6.8): 3.0 g Tris is dissolved in about 40 ml distilled water. pH is adjusted to 6.8 with 1 N HCl and total volume is made to 50 ml with distilled water. Prepared buffer can be stored up to 3 months at 4ВєC in dark bottle. 10% SDS: 10 g sodium dodecyl (lauryl) sulfate is dissolved in distilled water and total volume is made to 100 ml with distilled water. Prepared solution can be stored at room temperature. 5 x Electrode Buffer (125 mM Tris, 960 mM Glycine, 0.5 % SDS, pH 8.3: 15 g Tris, 72 g glycine and 5 g SDS are dissolved in distilled water and total volume is made to 1 litre with distilled water. The pH of buffer should be 8.3 В± 0.2. Stock electrode buffer is diluted five times with distilled water before use. 82 SDS-PAGE вЂ“ Principle and Applications The stock buffer can be stored at room temperature up to 1 month. The diluted stock buffer is 25 mM tris, 192 mM glycine, and 0.1% SDS. 10% Ammonium Persulfate: 100 mg ammonium persulfate is dissolved in 1.0 ml distilled water. The solution is always prepared fresh. 2 x Sample Buffer (0.125 M Tris, 4% SDS, 20% glycenol 0.2 M DTT, 0.02% bromophenol blue, pH 6.8: 2 x sample buffer is prepared by mixing following solutions/chemical. 4 x stacking gel buffer - 2.5 ml glycerol - 2.0 ml 10% SDS - 4.0 ml Bromophenol blue - 2.0 mg Dithiothreitol (DTT) - 0.31 g Distilled water - 1.5 ml 2 x sample buffer can be stored in small aliquots at - 200C up to 6 months. Instead of DTT, 1.0 ml of ОІ-mercaptoethanol can be used but the volume of water is reduced to 0.5 ml. Overlay Buffer (0.375 M Tris, 0.1%, SDS, pH 8.8): Overlay buffer is prepared by mixing 25 ml running gel buffer, 1 ml 10% SDS and 74 ml distilled water. This buffer can be stored up to 3 months at 4ВєC in the dark bottle. Procedure Glass Sandwich: One notched glass plate is placed on a flat surface. One spacer (1.0 mm) each is then placed along the each of two edges so that spacer aligns with the notch. Subsequently, rectangular glass-plate is placed over it. The sandwich is held firmly between thumb and fingers. Side-ways of both spacers were sealed with appropriate tape to overcome any possible gel-leak during gel plate preparation. There is always the possibility of leakage at the bottom of the plate. This is taken care by placing molted agar (1% in water) up to 5 mm height in trough of gel-casting unit. The plate in standing position is then quickly placed in casting unit and screws are finger tightened. Preparation of Running Gel: Running gel of desired concentration is prepared by mixing appropriate volumes of solutions as shown below Acrylamide / bisacrylamide, running gel buffer, SDS and distilled water are added to conical flask and degassed. Then ammonium persulfate and TEMED are added and contents mixed gently. With the help of glass pipette, the running gel solution is delivered to sandwich to a level about 3 cm below the top of rectangular plate. Air should not be trapped while filling sandwich with running gel solution. A small volume of water or overlay-buffer (~ 200 Вµl) is layered over gel solution with the help of glass syringe with 22 G needle. This prevents exposure to oxygen. Solutions Final Gel Concentrations 7.5% 10% 12.5% 15% Acrylamide / bisacrylamide (30%) 5.0 ml 6.7 ml 8.3 ml 10.0 ml 4 x Running gel buffer 5.0 ml 5.0 ml 5.0 ml 5.0 ml 10% SDS 0.2 ml 0.2 ml 0.2 ml 0.2 ml Distilled water 9.7 ml 8.0 ml 6.4 ml 4.7 ml 10% Ammonium persulfate 0.1 ml 0.1 ml 0.1 ml 0.1 ml TEMED 6.7 Вµl 6.7 Вµl 6.7 Вµl 6.7 Вµl Preparation of Stacking Gel: Stacking gel of 4% concentration is prepared by mixing appropriate volumes of solutions as shown below The preparation of stacking-gel solution is similar to preparation of running-gel solution. After removal of water or overlay buffer, stacking-gel solution is layered over running gel. Appropriate comb is inserted into the stacking gel to make wells for sample application. Comb is removed after polymerization of gel. 83 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Sample Preparation: Protein samples (1 mg/ml) are Solutions Volume centrifuged (10,000 g, 5 min.) to remove any insoluble material Acrylamide / bisacrylamide (30%) 1.3 ml and are mixed with equal volume of 2 X sample buffer. The 4 x Stacking gel buffer 2.5 ml resultant solution is boiled for 3 to 5 min. Molecular weight 10% SDS 0.1 ml markers are also prepared in a similar way. Distilled water 6.1 ml Electrophoresis: Gel plates are then tightly attached 10% Ammonium persulfate 50 Вµl to electrophoresis unit. Stock electrode buffer is five times TEMED 10 Вµl diluted with cold water. Anode and cathode chambers are filled with buffer. 5 to 20 Вµl of sample is applied to each well. Electrophoresis is carried out at constant voltage of 50V till sample crosses stacking gel. When sample enters running gel, voltage is increased to 100V. Complete electrophoretic run takes around 2.5 to 3.0 h. During electrophoresis, temperature is kept low by circulating water in electrophoretic assembly. After electrophoretic run, stacking gel is removed. Small cut on top left side in running gel is made to remember the orientation of the gel. Staining of proteins in gel: The gel is placed in glass tray containing coomassie brilliant blue solution (0.25%) prepared in methanol : acetic acid : water (40:7:53) mixture. Glass tray is then placed on orbital shaker for 4 h at room temperature. After staining for 4 h, the gel is transferred to the destaining solution I (methanol, acetic acid and water mixture in ratio of (40:7:53) for 30 min. Subsequently gel is placed in destaining solution II (methanol, acetic acid and water mixture in ratio of 7:5:88) till bands become visible against light background. During staining and destaining, gel should float free in glass tray. Helpful-hints вЂў A particular concentration of acrylamide gel is used for separating proteins of particular range of molecular weights. Whereas low acrylamide gel concentration is used for separating high molecular weight proteins, low molecular weight proteins are resolved in high gel concentration. Use following table in deciding gel concentration in separating gel. Per Cent gel Molecular weight of proteins to be separated (KD) 7.5 24 вЂ“ 205 10.0 14 вЂ“ 205 12.5 14 вЂ“ 66 15.0 14 вЂ“ 45 вЂў Spacers can absorb heat and thus lowers the temperature of gel at edges. If the gel is hotter in the middle than at the edges, the mobility of dye front at edges will be lower as compared to mobility in the middle. This can be avoided by (i) using cooled electrode buffer and (ii) not allowing buffer to warm up during run. Thus, during electrophoretic run either use cooling device or use low current. вЂў If gel is not polymerized properly at edges, current can leak down the edges resulting in more mobility at edges. Air- bubbles at the bottom of glass plates can block current flow resulting abnormal dye front. вЂў While placing comb in stacking gel, care should be taken not to allow air-trap. Air inhibits polymerization and sample wells will be distorted. вЂў All stock solutions required for gel preparation are stored at refrigerated temperature and these should be brought to room temperature. At low temperature, polymerization is inhibited. Oxygen also inhibits polymerization of acrylamide and these solutions should be degassed before use. вЂў Sometimes boiling of sample in sample buffer may lead to irreversible precipitation and such samples remain at the top of separating gel. For such samples one can try incubating sample in sample buffer at 70ВєC instead of 100ВєC. Reference: Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227L 680-685. Walker, J.M. (2006) Electrophoretic techniques. In Principles and Techniques of Biochemistry and Molecular biology (K. Wilson & J. Walker Eds). Cambridge University Press, New York. 84 Western Blot: Theoretical Aspects Western Blot: Theoretical Aspects Y. S. Rajput1 and Rajan Sharma2 1 Animal Biochemistry Division, 2Dairy Chemistry Division, NDRI, Karnal Western blotting is the transfer of proteins from the SDS-PAGE gel to a solid supporting membrane. For analysis based on antibody reactivity or nucleic acid hybridization, the separated molecules are made free of electrohoretic matrix. This can be simply achieved by slicing the gel followed by elution in buffer. But, this process is slow and resolution is also poor. An alternative efficient method is вЂ�blottingвЂ™ technique in which molecules are separated on a slab gel and separated molecules are eluted through the broad face of the gel onto a membrane that binds the molecules as they emerge. Proteins and nucleic acids stay on the surface and can be detected. The membrane materials frequently employed in blotting are nitrocellulose, nylon and polyvinylidene difluoride (PVDF). The choice of membrane depends on the type of analysis and characteristics of detection system. Nitrocellulose is the most widely used since it works well with both protein and nucleic acids. Some nylons do not bind protein reliably. PVDF, is often used when bound proteins are analysed for sequencing. The transfer of the proteins or nucleic acids from the gel to the membrane can be achieved by capillary flow of buffer or by transverseвЂ™ electrophoresis. The use of capillary flow to transfer DNA from agarose gels to nitrocellulose membrane was first described by Southern (1975) and thus referred as Southern blotting. Using the same method for transfer of RNA is referred as Northern blotting. Western blot refers to transfer of protein from gel to membrane and this technique was described in 1979-80 by many workers but the method described by Towbin et al. (1979) is most cited. Western blotting essentially comprises of three techniques which are applied in sequence. The first one is referred as SDS-PAGE through which proteins are separated based on the molecular size of molecules in acrylamide gel. Sodium dodecyl sulphate (SDS) is an anionic detergent that denatures proteins by wrapping around the polypeptide backbone. This results in net negative charge to polypeptide in proportion to its length. Laemmli system (Laemmli, 1970) employing discontinuous buffer is most widely used electrophoretic system. The resolution in LaemmliвЂ™s method is excellent because treated peptides are concentrated in stacking gel before entering the separating gel. The technique, which follows SDS-PAGE, is transfer of protein/from gel to membrane. There are two types of equipments for electrophoretic transfer of proteins: the semi-dry blotting apparatus and вЂ�tankвЂ™ buffer apparatus. The third technique used in sequence is for identification of protein (antigen) by performingвЂќ antigen-antibody (first antibody) reactions on the membrane itself. Second antibody enzyme conjugates were then allowed to interact with immobilized first antibody and, then using appropriate substrate, protein bands are detected. Although, antigen-antibody interactions are widely employed in Western blot, other kind of interactions such as glycoprotein-lectin and biotin-avidin have allowed research workers to employ this technique for other applications including carbohydrate staining of glycoprotein, protein sequencing etc. Semi-dry electrophoretic transfer In semi-dry electrophoretic transfer, a stack of wetted filter papers surrounding the gel and the blotting membrane is used as a buffer reservoir, instead of tank as in conventional electrophoretic transfer. The electrodes, consist of conductive plates made of graphite or stainless steel or a conducting polymer. The size of the plates is at least the same size as that of gel to provide homogeneous electric field. The main advantages with semiВ¬dry transfer are the ease of handling, the short time (30 min, to 1 h) required for the transfer and low buffer consumption. Another important feature is that different buffers can be used at the anodic and cathodic sides to improve the transfer. The short electrode distance gives a high voltage gradient despite low power. Cooling is not normally required since heat production is negligible. Transfer can be performed from several gels at a time, either by placing them 85 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance beside each other if the electrodes are large enough or by placing several transfer units on top of each other. Because of the short electrode distance, voltage applied is most often 10-20V. On the other hand, because of large cross-sectional area, the current passing through the transfer sandwich is fairly high, in the range 0.1-1A. Tank-buffer electrophoretic transfer In tank-buffer electrophoretic transfer, transfer cassette is submerged in a вЂ�tankвЂ™ of buffer. Gel, membrane, filter paper, porous foam sheet are arranged in cassette as per instructions of manufacturer. The details have been provided in write-up for practicals. Blot membranes Numerous types of papers and membranes have been utilized for protein blotting. Nitrocellulose paper (film of nitric acid esterified cellulose) has been the most frequently used membrane.The binding of proteins to nitrocellulose is probably hydrophobic. For electrophoretic transfer of small proteins, membranes with 0.1or 0.2 Вµm pore size are selected. If membranes stick to low concentration gels after transfer, membranes with pore size of 0.45 Вµm are selected. A drawback with nitrocellulose membrane is, however, that they are very brittle when dry. The other membrane, which is in use, is polyvinylidene fluoride (PVDF). PVDF membrane is a teflon-type polymer composed of the basic repeating unit (- +ОґCH2--ОґCF2-)n and has good mechanical strength. Proteins interact with the polymer non-covalently through dipolar and hydrophobic interactions. PVDF is chemically compatible with the aqueous buffer systems. Since PVDF is resistant to most organic solvents, it can withstand harsh chemical conditions in which nitrocellulose membranes dissolve or decompose. These membranes are expensive. Some PVDF membranes have additional components. Western consists of PVDF cast on a polyester web. The web does not interfere with electroblotting or alter the characteristics of the PVDF. Immobilon-CD is PVDF membrane in which surface is chemically modified to have a cationic charge. Although hydrophobic and dipolar interactions with the Immobilon-CD may contribute to protein binding, the primary binding interaction is ionic. The membranes with high internal surface area (>2000 cm2 per cm2 of frontal area) bind substantially more protein (400 Вµg BSA/cm2) as compared to membrane with low internal surface area (~400 cm2 per cm2 of frontal area) that binds to around 130 Вµg BSA/cm2. Low internal surface area membranes usually function better in immunodetection. They are comparatively easy to block and antibodies are better able to penetrate the more open pore structure. Membranes with high internal surface structure are more difficult to block effectively and less open pore structure often limits antibody accessibility. Besides immunodetection, PVDF membranes are used for amino acid sequencing, amino acid analysis and peptide mapping. For these applications, blocking is not required and there is no steric hindrance encountered by antibodies. Higher internal surface membranes and Immobilon-CD are suitable for amino acid sequencing and amino acid analysis. Peptide mapping is more effective on low internal surface area membranes. PVDF membrane is compatible with protein staining and immune-chemical protocols. Positively charged nylon membranes arc mechanically strong and have a high binding capacity. A disadvantage is their high non-specific binding which results in a high background after immunodetection. Most general protein stains are anionic dyes and can not be used with nylon membranes since they bind to these membranes. Transfer buffer A major concern in transferring proteins onto nitrocellulose membrane is the composition of the transfer buffer. The original protocol of Towbin et al. (1979) uses a transfer buffer containing methanol, which was added to, counteract swelling of the gel. Methanol also decreases gel pore size, removes SDS from proteins. Methanol may precipitate the proteins within the gel, however, it increases the capacity and the affinity of nitrocellulose membrane for proteins. PVDF membrane is activated by placing it in 100% methanol for 1-2 sec. This allows the hydrophobic surface of PVDF to wet with aqueous 86 Western Blot: Theoretical Aspects solvent. Addition of 20% methanol to transfer buffer is recommended for low molecular weight proteins. Methanol is not required for transfer to charged nylon membranes. Methanol facilitates the dissociation of SDS-Protein complexes and increases the hydrophobic interaction between protein and membrane. On the other hand, for high molecular weight proteins, methanol can decrease the elution efficiency by denaturing the proteins or retarding the elution from the gel. In contrast to low molecular weight proteins, high molecular weight proteins do not require methanol for adequate binding to the membrane. The presence of SDS in transfer buffer increases the mobility of protein from gel to membrane. This is especially useful for transfer of protein after isoelectric focussing, when proteins have no net charge. However, SDS decreases the binding of the protein to both nitrocellulose and PVDF membrane. It is sometimes necessary to add SDS (0.01-0.02%) to aid transfer of high molecular weight proteins. Transfer buffer generally used is 25 mM Tris, 192 mM glycine, pH 8.3 and 20% methanol. If membrane is to be used for protein sequencing or amino acid, analysis, CAPS buffer (10 mM 3-(cyclohexylamino)-1В¬ propanesulfonic acid, 10% methanol, pH 11.0 is recommended. Application of protein blotting for characterization of antigens will require antigen specific antiserum. By simultaneously running molecular weight markers and proteins (extracted from biological materials) in SDS-PAGE and subsequent detection after electrophoretic transfer provides information about molecular weight of antigen. Antibodies should be specific otherwise cross-reaction is observed and interpretation is more difficult. Affinity purified antibodies or monoclonal antibodies provide good result. Through these reactions, one can detect presence or absence of such antigens in related and unrelated biological materials. Now tools are available for ascertaining carbohydrate moiety in proteins on membrane. These proteins can be oxidized by periodate resulting in generation of free aldehyde groups (Figure 1). The generated groups are reacted with biocytin hydrazide leading to biotinylation of glycoproteins. Using appropriate probe such as avidin-peroxidase and substrate, glycoproteins are detected. Alternately lactins specific for carbohydrate residues can be employed. In this Figure 1. Detection of Biotin Labeled Glycoproteins on Western blots approach antibody (against lectins) enzyme conjugates or lactin - enzyme conjugates can be used for staining glycoproteins. Asn-linked oligosaccharides can be cleared from protein onto membrane by hydrazinolysis. The released oligosaccharides can be characterized by using biochemical techniques. Proteins onto membrane can be hydrolyzed for determining amino acid composition. Peptide mapping and protein sequencing are other useful applications where proteins on membrane are the starting material for subsequent steps. References: Kurien, B.T and ScoWeld, R. H. (2006) Western blotting. Methods: 38 (2006) 283вЂ“293. Towbin, H.; Stachelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Nat. Acad. Sci. USA. 76: 4350-4354. 87 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Enzyme Linked Immunosorbent Assay - Theory Rajeev Kapila and Suman Kapila Animal Biochemistry Division, NDRI, Karnal Enzyme immunoassay (EIA) and enzyme-linked immunosorbent assay (ELISA) have become household names for medical laboratories, manufacturers of in vitro diagnostic products, regulatory bodies, and external quality assessment and proficiency-testing organizations. Analytes such as peptides, proteins, antibodies and hormones can be detected selectively and quantified in low concentrations by ELISA. ELISAs are rapid, sensitive, cost effective and can be performed in a highthroughput manner. In contrast, techniques like immunofluorescence and RIA are tedious, time consuming, having short shelf-life of the reagents, requiring sophisticated expensive equipments and the strict regulatory controls on the use of isotope. Though, this technique is relatively less sensitive as compared to radio-immuno-assay (RIA) but efforts are continuing to increase its sensitivity. An ELISA is used in a vast variety of different types of assays (e.g. direct ELISA, indirect ELISA, sandwich ELISA, competitive ELISA). Nevertheless, all ELISA variants are based on the same principle, the binding of one assay component вЂ“ antigen or specific antibody вЂ“ to a solid surface and the selective interaction between both assay components. Molecules not specifically interacting with the assay component are washed away during the assay. For the detection of the interaction, the antibody or antigen is labeled or linked to an enzyme (direct ELISA). Alternatively, a secondary antibody conjugate can be used (indirect ELISA). The assay is developed by adding an enzymatic substrate to produce a measurable signal (colorimetric, fluorescent or luminescent). Such a substrate is called a chromogenic or luxogenic substrate. The strength of the signal indicates the quantity of analytes in the sample. A number of enzymes have been employed for ELISA, including alkaline phosphatase, horseradish peroxidase and ОІ-galactosidase. These assays approach the sensitivity of Radioimmunoassay (RIA) and have the advantage of being safer and less costly. Direct ELISA The direct ELISA uses the method of directly labeling the antibody itself. Microwell plates are coated with a sample containing the target antigen, and the binding of labeled antibody is quantitated by a colorimetric, chemiluminescent, or fluorescent end-point. This technique has advantages of direct detection, quick methodology since only one antibody is used. Cross-reactivity of secondary antibody is eliminated. Major disadvantages of direct detection is reduced Immunoreactivity of the primary antibody as the result of labeling. Labeling of every primary antibody is time-consuming and expensive. No flexibility in choice of primary antibody label from one experiment to another. Little signal amplification Indirect ELISA The indirect ELISA utilizes an unlabeled primary antibody in conjunction with a labeled secondary antibody. Since the labeled secondary antibody is directed against all antibodies of a given species (e.g. anti-mouse), it can be used with a wide variety of primary antibodies (e.g. all mouse monoclonal antibodies). Indirect detection method of ELISA is versatile, since many primary antibodies can be made in one species and the same labeled secondary antibody can be used for detection. Moreover, wide variety of labeled secondary antibodies are available commercially. Immunoreactivity of the primary antibody is not affected by labeling. Sensitivity is increased because each primary antibody contains several epitopes that can be bound by the labeled secondary antibody, allowing for signal amplification. Cross-reactivity may occur with the secondary antibody, resulting in nonspecific signal. 88 Enzyme Linked Immunosorbent Assay - Theory Sandwich ELISA The sandwich ELISA measures the amount of antigen between two layers of antibodies. The antigens to be measured must contain at least two antigenic sites, capable of binding to antibody, since at least two antibodies act in the sandwich. So sandwich assays are restricted to the quantitation of multivalent antigens such as proteins or polysaccharides. Sandwich ELISAs for quantitation of antigens are especially valuable when the concentration of antigens is low and/or they are contained in high concentrations of contaminating protein. Competitive ELISA In this unlabeled antibody is incubated in the presence of its antigen. These bound antibody/ antigen complexes are then added to an antigen coated well. The plate is washed and unbound antibody is removed. The secondary antibody, specific to the primary antibody is added. This second antibody is coupled to the enzyme. A substrate is added, and remaining enzymes elicit a chromogenic or fluorescent signal. For competitive ELISA, the higher the original antigen concentration, the weaker the eventual signal. Selection of enzymes for labelling Antigen-antibody interaction is basis on which Elisa works and extent of interaction is measured by measuring the activities of enzyme linked to antigen or antibody. In ELISA, a soluble substrate that is converted to soluble coloured product is used. Absorbance of colour is read in ELISA plate reader, which can read samples in 96-well microtitre plates. Enzymes are selected on the basis of availability of purified enzyme at cheaper rate, turn over number and availability of cheaper chromogenic substrates. The most common enzymes used are horseradish peroxidase and alkaline phosphate. Applications in dairy Since the advent of pasteurization, the dairy industry has been a leader in food safety and aggressively proactive in its commitment to ensure the safety of dairy products. Few areas of attention are pathogens, toxins, adulterants and, more recently, allergens. Thanks to new technological advances in convenient-to-use, rapid screening tests, these safety issues can now be addressed as part of a total dairy quality control program. Detection of pathogens Bacterial pathogen contamination of dairy products is usually monitored via agar plate counting techniques, which generally take from one to five daysвЂ”too long to be an effective pathogen screening tool. One of the most popular immunoassay techniques for screening milk for pathogens and toxins is the enzyme-linked immunosorbent assay (ELISA) method. Highly automated and sensitive bench-top instruments based on immunoassay methods are now available and have significantly reduced the time and labor required to obtain results. According to Vasavada (2001), the rapidity and sensitivity of immunoassay-based test kits and systems have come a long way in the past few years due to development in immunoprecipitation devices, lateral flow devices and immunomagnetic separation (IMS) techniques. Immunoassay tests offer three important advantages: speed of analysis, sensitivity and high specificity for detecting the target pathogen. Detection of allergens Allergens are another area of food safety concern. Approximately 2 to 3% of adults and 5 to 8% of children are allergic to foods. Food allergies are caused by proteins that can trigger an immune response in sensitized individuals. As the number of different ingredients used in formulated foods continues to grow, it is becoming more common for dairy processing plants to handle a wider spectrum of ingredients than they did a few years ago. This has increased the likelihood of cross-contamination of products with inappropriate ingredientsвЂ”i.e., ingredients that can cause allergic reactions and are not indicated on product labels. Whether itвЂ™s peanuts, tree nuts, milk, eggs, wheat or soybeans, nearly every processed food has an identified allergen in it. Currently, 89 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance the most popular type of food allergen testing is based on sandwich enzyme-linked immunoassays (S-ELISAs). A target allergen protein is extracted from samples with a buffered salt solution. The extracted protein is sampled and added to antibody-coated microwells, where it binds to the antibody during an incubation period. After a wash step, enzyme-labeled antibody (conjugate) is added to the antibody wells and is allowed to attach to the bound allergen, forming an вЂњantibody sandwichвЂќ around the allergen. After another wash step, substrate is added which reacts with the conjugate to produce blue color. The intensity of color is proportional to the amount of allergen. It is important to realize some of the limitations inherent in this type of testing. Because high temperature may denature protein, test antibodies may not capture a sampleвЂ™s allergenic component. This is especially true with egg products, which denature at a relatively low time and temperature combination. Since denatured protein may remain allergenic, it is recommended that products be tested prior to baking or cooking. Another problem can occur when testing samples that have high oil content. Although low levels of protein may be present in edible oils, they may be difficult to extract with standard extraction solutions and may not be detected by the test. Also, it is important to note that using a test kit designed for testing the presence of peanut protein is not appropriate to use for screening samples for almonds, pecans or other tree nuts. Care must be exercised when testing for egg allergens. Some test kits only test for egg white proteins; egg yolk proteins can also cause allergic reaction in people sensitized to egg yolk proteins. Detection of of Aflatoxin M1 (AFM1) in milk and milk products Kim et al (2000) examined the occurrence of aflatoin M1 in pasteurized milk and dairy products like milk infant formula, milk powders and yoghurt. Recoveries of AFM1 from sample spiked at levels between 5 and 500pg/ml were 88-106% for pasteurized milk and 84-94% for yoghurt by ELISA. Limits of detection were 2pg/ml. The occurrence of Aflatoxin M1 (AFM1) contamination in Indian infant milk products and liquid milk samples was investigated by competitive ELISA technique. The range of contamination of AFM1 was comparatively higher in infant milk products (65вЂ“1012 ng/l) than liquid milk (28вЂ“164 ng/l). Almost 99% of the contaminated samples exceeded the European Communities/ Codex Alimentarius recommended limits (50 ng/l), while 9% samples exceeded the prescribed limit of US regulations (500 ng/l). The extrapolation of AFM1 data to estimate the Aflatoxin B1 (AFB1) contamination in dairy cattle feedstuffs indicate that the contamination may range from 1.4 to 63.3 Ојg/ kg with a mean of 18 Ојg/kg which is substantially higher than the directive of European Communities regulation (5 Ојg/kg). Detection of adulteration of goat, sheep and buffalo milk and cheese An indirect ELISA successfully developed for the detection of defined amounts of cowsвЂ™ milk (1-50%) in sheepsвЂ™ milk and cheese. The assay used polyclonal antibodies raised in rabbits against bovine caseins (BC). The antibodies were biotinylated and rendered cowsвЂ™ milk specific by mixing them with lyophilized ovine and caprine caseins. Extravidin- peroixidase used to detect the biotinylated anti-BC antibodies bound to BC immobilized on 96-well plates. Subsequent enzymic conversion of substrate gave clear absorbance differences when assaying mixtures of sheepsвЂ™milk and cheese containing variable amounts of cowsвЂ™ milk. The indirect competitive ELISA had a lower sensitivity when applied to cheese, compared with milk. A sandwich ELISA was developed utilising the monoclonal antibody in combination with a polyclonal goat anti-bovine IgG antibody. Once optimised, the ELISA was found to be highly specific. Detection limits in milk were 0.001% cowsвЂ™ milk adulteration of sheep or buffalo milk, and 0.01% cowsвЂ™ milk adulteration of goat milk. Detection limits in soft cheese were 0.001% in goat cheese and 0.01% in sheep or buffalo cheese. The ELISA performance makes it suitable for development as a kit for use in routine surveillance of milk and soft cheese. Detection of insecticide and pesticide in milk Polyclonal antibodies against an aldrin/dieldrin immunogen have been raised in rabbits and used as the basis of an enzyme-linked immunosorbent assay (ELISA). This assay can detect dieldrin in milk 90 Enzyme Linked Immunosorbent Assay - Theory in the range 5 Ојg/ml to 1ng/ml reliably. This range differs in skimmed and semi-skimmed milk, and in cream, reflecting the differences in fat content between these samples (Ibrahim et al, 1993). Detection of melamine Recent food safety scares, such as the discovery of melamine in milk, have sharpened the global awareness of the links between profit, the food chain and the global food supply. A cheap industrial chemical, melamine has been used to artificially increase the amount of protein content in diluted milk, thereby increasing the price for the milk. The combination of melamine and a degradation product, cyanuric acid, results in crystals that can create blockages in the kidneys. In March 2007, public awareness of melamine contamination was heightened when Figure: General principle of the competitive ELISA assay. Enzyme- the contaminant was found in pet food conjugated melamine competes with the melamine from the ingredients imported from China, sample for binding to melamine antibody. This enzyme activity and absorbance values decrease according to increasing amount of the causing the death of many animals. Following this scare, it was revealed that unlabeled melamine from the unknown sample. melamine-tainted fodder may have been used to feed animals, including chickens, swine and catfish intended for human consumption. As melamine is still being found in eggs, fish and a variety of processed foods imported from China, the scrutiny of products for melamine is intense. ELISA, is a high-throughput technique for screening food for melamine. The general principle of these competitive ELISA assays is shown in Figure . Detection of histamine in cheese Aygun et al. (1999) used a competitive direct ELISA for determining histamine in cheese. Cheese was homogenized with phosphate buffered saline, centrifuged and filtered and the supernatant was diluted with phosphate buffered saline. Detection limit and mean recoveries were 2 mg/kg and 93%. Quantification of immunoglobulins and cytokine in milk and colostrum A double sandwich enzyme-linked immunosorbent assay (ELISA) procedure for the quantification of IgG in bovine milk was developed for detecting the concentration of IgG in various homogenized HTST, UHT, evaporated and raw milk samples as well as skim milk powder. Using this procedure, homogenized, HTST pasteurized milk was found to contain from 65 to 79% of the IgG found in raw milk. Skim milk powder also retained a major portion of IgG, while evaporated and UHT pasteurized milk were virtually devoid of IgG (Kummer et al., 1992) Colostrum contains factors that are protective for the neonate and may be a source of immunomodulary molecules that positively influence the immune status of the neonate. To confirm that colostrum contains a variety of cytokines with immunomodulatory properties, a bovine cytokine specific ELISA and five cytokines (IL-1ОІ, IL-6, TNF-О±, INF-Оі or IL-1 receptor antagonist, IL-1ra) in the whey samples from cows at different stages of lactation were monitored. The concentrations of cytokines in colostrum were significantly higher concentrations than those in the mature milk. Colostrum contains high levels of cytokines that could be produced and secreted in the mammary gland and that may have an immunomodulatory activity and influence neonatal immunity (Hagiwara et al., 2000) Detection of antibiotics in milk ОІ-Lactam antibiotics, particularly penicillins are widely used in medicine and veterinary medicine, this being the reason why residual amounts of penicillins may be found in foodstuffs of animal origin. Antibiotics contained in milk may adversely affect the health of human consumers (e.g., by inducing 91 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance allergic reactions). Moreover, the presence in milk of antibiotics and other compounds suppressing the development of microorganisms disrupts technological processes of production of cheese (including soft cheese) and sour milk beverages by retarding or blocking lactic acid fermentation. Therefore, milk should be carefully controlled for the presence of residual amounts of penicillins, and such control requires reliable and readily available analytical methods. ELISAs are widely used abroad for determining penicillin in milk (Usleber et al., 1994; Rohner, et al., 1995) including as commercially available kits (Sternesjo and Johnsson, 1998). Determination of penicillin G, ampicillin, and isoxazolyl penicillins (cloxacillin and dicloxacillin) in milk has been described, with detection limits in the range 10вЂ“30 ng/ml A modification of an ELISA in which a fluorescent probe replaces conventional chromogens and capillaries are used for simultaneous determination of six penicillins in milk has been described (Huth, 2002). Conclusion The increase in food borne illnesses and specific types of pathogens is due to various consumer, manufacturing and regulatory trends that may set the stage for contamination or minimal screening methods. For example, there are changes in consumer consumption habits and preferences for minimally processed convenience foods, as well as an increase in certain risk groups who are most vulnerable to diseases. Also adding to the problem are changes in food production, distribution and globalization of supply that expands the potential for imports tainted with pathogens or pesticide residues. Compounding the problem are new types of pathogens, as well as new strains of recognized pathogens, and both are appearing in food products where they have never before been identified. It is likely that technologies based on immunoassays and PCR methods will emerge as the two favorite types of rapid pathogen screening tests for dairy products because of their enhanced specificity, sensitivity and efficiency compared to other methods. PCR tests that measure pathogen DNA or RNA are more sensitive but also are more expensive than immunoassay methods. To continue to deliver safe dairy products to the public, dairy processors will be increasingly dependent on new rapid, accurate, sensitive and specific screening tests for pathogens, toxins, adulterants and allergens. References: Aygun,o.,Schneider,E.,Suhener,R. and Usleber, E. and Martlbauer, E. J. agril. & food Chem.,1999, 47(5):1961-1964. Hagiwara, K.i Kataoka, S. ,Yamanaka, H.. Kirisawa, R. and Iwai, H. Veterinary Immunology & Immunopathology, 2000, 76(3-4):183-190 Huth, S.P., Warholic, P.S., Devou, J.M., Chaney, L.K.,and Clark, G.H., J. AOAC Int., 2002, 85 (2): 355вЂ“364. Ibrahim,A.M.A., Hewedi, M.M. and Smith, C.J. Food and Agril Immunol, 1993 5 (3): 145 - 154 Kim, E.K., Shon, D.A. Dyer, D., Park, J.W., Hwang, H.J. and Kim, Y.B.. Food additives and Contaminants, 2000, 17(1):5964. Kummer, A., Kitts, D.D.,Li-Chan, E., Losso, J.N., Skura, B.J.and Nakai, S. Food and Agricultural Immunology, 1992, 4 (2): 93 - 102 Rastogi, S., Dwivedi, P. D., Khanna, S. K., Das, M. Food control, 2004 15(4)287-290 Rohner, P., Schallibaum, M., and Nicolet, J., J. Food Prot., 1995, 48(1):59вЂ“62. Sternesjo, A. and Johnsson, G., J. Food Prot., 1998, 61 (7) :808вЂ“811. Usleber, E., Lorber, M., Straka, M., Terplan, G., and Martlbauer, E., Analyst, 1994, 119 (12): 2765вЂ“2768 Vasavada, P.C. Food Safety, 2001; 7(3):29-38 92 Experimental Determination of Thermal Stability of Proteins: A Theoretical Background Experimental Determination of Thermal Stability of Proteins: A Theoretical Background Jai K. Kaushik Animal Biotechnology Centre, NDRI, Karnal One of the most crucial aspects in protein science is the solution properties affecting the structure, stability and activity of proteins in solutions. Most of the enzymes and many structural proteins are globular while some structural proteins are fibrous in structure. The stability of proteins originates from their detailed three dimensional structures. The covalently linked amino acids in a linear fashion results in the primary structure that folds into a unique 3-D structure, which is responsible for the specific function and activity of a protein molecule. The 3-D structure of proteins is defined by weak intermolecular interactions and therefore the native state of proteins is only marginally stable by ca 5-15 kcal/mol. The small free energy is the difference of large changes, which can be several hundreds of kcal/mol, in enthalpy and entropy over folding. Therefore, determining these large changes in enthalpy and entropy accurately is the central problem in protein physical chemistry to evaluate the precise free energy (Gibbs energy) of stabilization of proteins. With the great advancement in generation and production of recombinant proteins, there has been a new interest in understanding the molecular basis of protein stability so that more rugged and stable proteins functional over a wide range of environmental conditions can be designed. Therefore it is critically important to evaluate the stability of proteins precisely and accurately to compare and relate the experimentally determined stability data to theoretically determined stability for a set of mutant proteins to understand the role of molecular interactions. There are two standard methods to determine the protein stability, viz. kinetic methods, which include chemical denaturant jump, pH jump and temperature jump to determine the rate of folding and unfolding, and equilibrium methods which include the solvent denaturation and thermal denaturation procedures. The easiest and the most widely used method is the thermal denaturation of proteins and determining the equilibrium thermodynamic parameters linked with the process. The obtained thermodynamic parameters like enthalpy, heat capacity and entropy evaluated at the midpoint of denaturation can be used to determine the stability profile (Free Energy versus temperature) for a given protein. There are several techniques to monitor the denaturation of proteins under varying external agents like increasing concentration of chemical denaturants or increasing temperature or changing the pH. To monitor the changes in thermodynamic parameters related to thermal denaturation, the most direct method is the calorimetry, which measures the enthalpy of denaturation as a function of temperature. Calorimetry can provide the precise enthalpy, entropy and heat capacity of denaturation. Figure 1 shows a typical thermal denaturation and renaturation scans as a function of temperature measured by (A) calorimetry and (B) spectrophotometry. In a calorimetrically measured phase transition (Native в†” Denatured) profile of a protein the peak of the endotherm indicates the midpoint of transition. The total area under the curve provides a direct measure of enthalpy of transition, whereas the differences in the baselines for pure native and pure denatured Figure 1: Typical thermal denaturation profiles of a protein determined by (A) species measured at the midpoint of differential scanning calorimetry (DSC) measuring the excess heat capacity transition provide the heat capacity of as a function of temperature, and (B) spectrophotometry measuring change in absorbance. denaturation. 93 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance For a two state transition N в†” D, where N is the native state and D the denatured state, the в€†H(T) - the enthalpy of transition at a temperature (T) can be directly evaluated using equation 1: в€†H(T) = в€†HВє + в€†Cp (T вЂ“ Tm) (1) where, в€†HВє is the enthalpy of transition at Tm; в€†Cp - the heat capacity of transition; and Tm, the midpoint of transition. This is the most direct method of evaluating the thermodynamic parameters like enthalpy, while the entropy can be evaluated using the relation: в€†S(T) = в€†SВє + в€†Cp ln (T/Tm) (2) where в€†SВє is the entropy at the midpoint of transition and can be derived using the relation: в€†SВє = в€†HВє/Tm (3) The Gibbs energy of protein folding (free energy of stabilization) therefore can be defined by the equation: в€†G(T) = в€†H(T) вЂ“ T в€†S(T) (4) Substituting the values of в€†H and в€†S from equations (1-3) in to (4) and rearranging we obtain: в€†G(T) = в€†HВє (1 вЂ“ T/Tm) вЂ“ в€†Cp (Tm вЂ“ T + T ln (T/Tm)) (5) which is a modified form of Gibbs Helmholtz equation and can be used to determine the protein stability at any given temperature. Similarly, using the indirect methods which can measure the change in conformation of the native state of protein, we can determine the thermodynamic parameters linked with a phase transition (Nв†”D). The change in conformation can be monitored by various spectroscopic methods; e.g. circular dichroism, spectrophotometry, fluorescence, IR, light scattering, hydrogen exchange or anything which are sensitive enough to record the phase transitions in proteins; even viscometric or volumetric methods which can measure the solution properties of proteins due to phase transitions can also be used. Figure 1B shows the typical change in tertiary interactions of RNase A over denaturation measured by change in absorbance in the aromatic region. For a two state reversible phase transition undergoing equilibrium conditions, the equilibrium constant can be defined as follows: K = [Unfolded] / [Native] = О±/ 1вЂ“ О± (6) or О± = K / 1+K (7) where О± is the fractional denatured state concentration and K is the equilibrium constant. Also we know, K = eвЂ“в€†GВє/RT (8) Substituting the values of в€†GВє, the standard free energy, and K from equation (5) and (8), respectively, in to equation (7), we obtain: О±(T) = e{вЂ“1/R[в€†HВє (1/T вЂ“ 1/Tm) вЂ“ DCp (Tm/T вЂ“ 1 + ln (T/Tm))]} 1 + e{вЂ“1/R[в€†HВє (1/T вЂ“ 1/Tm) вЂ“ в€†Cp (Tm/T вЂ“ 1 + ln (T/Tm))]} (9) Equation (9) can be used to fit the experimental data to directly evaluate the thermodynamic parameters like в€†HВє, в€†CP, and Tm to evaluate the Gibbs energy of protein denaturation. The enthalpy of denaturation (в€†HВє) is known as vanвЂ™t Hoff enthalpy (в€†HvH) distinct from the calorimetric enthalpy (в€†Hcal) determined by DSC. For a two state reversible denaturation process for a single domain and/or monomer protein the ratio of в€†HvH and в€†Hcal should be equal to unity. The solid lines shown in Figure 1B are the nonlinear least square fittings to the experimentally determined data points represented by solid and open symbols. It is important to use good quality of data to evaluate the free energy of stabilization. Even small differences in the free energy of stabilization due to single amino acid change in proteins can be reliably evaluated by using any of the methods mentioned above. These methods also require that phase transition must be reversible and undergoing equilibrium conditions. 94 Experimental Determination of Thermal Stability of Proteins: A Theoretical Background Apart from the above mentioned methods which depend upon the heat-denaturation, other isothermal methods employing the chemical denaturant to induce the phase transition of protein conformation can also be used to evaluate the Gibbs energy of protein folding. It has been known for years that proteins can be unfolded in aqueous solutions by high concentrations of urea or guanidine hydrochloride. Denaturation with these chemicals is one of the primary ways of measuring the conformational stability of proteins and comparing the stabilities of mutant proteins. Figure 2 shows the typical denaturation reaction mediated by guanidine hydrochloride. It has been observed that the free energy of denaturation, в€†GВє = вЂ“ RT ln K, depends upon the denaturant concentration as follows: d(в€†GВє)/d(GdnCl) = RTn/(GdnCl)ВЅ (10) where (GdnCl)ВЅ is the midpoint of transition and n the slope of the curve. Later linear extrapolation method (LEM) became popular as в€†GВє was found to vary linearly with denaturant concentration as follows: в€†GВє = в€†G(H2O) вЂ“ m[denaturant] (11) where в€†G(H2O) is an estimate of the conformational stability of a protein that assumes that the linear dependence continues to 0 M denaturant concentration, and m the slope of the line measures the dependence of в€†GВє on denaturant concentration. The values of K can be calculated from the curve plotted in Figure 2A to calculate the в€†GВє as a function of denaturant concentration followed by estimation of в€†G(H2O) using the LEM. However, an equation to directly fit the raw data can also be written by substituting the value of K and в€†GВє from equations 8 and 11, respectively, in to equation 7 to give: О±(T) = eвЂ“(в€†G(H2O) вЂ“ m[denaturant] )/RT 1 + eвЂ“(в€†G(H2O) вЂ“ m[denaturant] )/RT (12) Nonlinear least square fitting of the above equation to the raw data provide us the value of m and в€†G(H2O ). Figure 2A shows the typical equilibrium denaturation and renaturation curves of a protein as monitored by change in fluorescence, it is clear that the process is in equilibrium and highly reversible, while the Figure 2B shows the increase in the stability of wild type (WT) due to engineering (Mutants NuG1 and NuG2). Figure 2. Typical equilibrium transition curves for protein unfolding and refolding induced by guanidine hydrochloride. (A) The open triangles and solid circles are the unfolding curves while the open squares represent the refolding equilibrium curves. Panel (B) shows the increase in the midpoint of transition [GdnHCl]ВЅ due to protein engineering (mutants NuG1 and NuG2) of the wild type protein (WT). All the above methods are based on equilibrium conditions; however, it is also possible to evaluate the free energy of protein stability using the kinetic methods which can measure the rates of folding and unfolding, since equilibrium constant K is the ratio of rate of unfolding (ku) and rate of folding (kf): K = ku / kf (13) K can be used to calculate в€†GВє and various other thermodynamic parameters using the same procedure mentioned above. The value of rate constants can be known by unfolding and refolding reactions induced by jump studies using temperature, pH or denaturant concentrations (Figure 3). For a two state process Nв†”D, all these methods should provide the same value of Gibbs energy of protein folding within the experimental errors and therefore any of the technique available at ones disposal can be used reliably for analysis of protein stability. 95 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Figure 3: Temperature dependence of kinetic and thermodynamic parameters of Pyrrolidone carboxyl peptidase (a) Temperature dependence of ku and kf and relaxation (kr = ku + kf) rate constants. Dashed line represents kr values, (b) Solid circles represent the unfolding Gibbs energies obtained from the equilibrium constant (K = ku/kf). The solid line is the stability curve fitted to the data points using equation 5, whereas the dashed line is that generated from the thermodynamic parameters obtained by DSC, mk(c) log of rates of folding (circles) and unfolding (squares) as a function of urea conc. kf = 3600sec-1 and ku = 27 sec-1 were obtained by extrapolation to 0 M urea. In the inset, the dotted line shows the denaturation curve simulated by using the kinetic parameters and crosses indicate the experimentally obtained equilibrium data. Reference Hughues-Despointes, B. M. Scholtz, J. M. and Pace, C. N. (1999). Protein conformational stabilities can be determined from hydrogen exchange rates. Nat. Struct. Biol. 6: 910-912. Kaushik, J. K. and Bhat, R. (1998). Thermal stability of proteins in aqueous polyol solutions. J. Phys. Chem. Sect. B. 102: 7058-7066. Kaushik, J. K. and Bhat, R. (1999). A mechanistic analysis of the increase in the thermal stability of proteins in aqueous carboxylic acid salt solutions. Protein Science. 8: 222-233. Kaushik, J. K., Ogasahara, K. and Yutani, K. (2002). The unusually slow relaxation kinetics of the folding-unfolding of pyrrol.idone carboxyl peptidase from a hyperthermophile, Pyrococcus furiosus. J. Mol. Biol. 316: 989-1001. Kaushik, J. K. and Bhat, R. (2003). Why is trehalose an exceptional protein stabilizer?: An analysis of the thermal stability of proteins in the presence of compatible osmolyte trehalose. J Biol Chem, 278: 26458-26465. Kaushik et al. (2006) Completely-buried, Non-ion-paired glutamic acid contributes favorably to the conformational stability of pyrrolidone carboxylic peptidases from hyperthermophiles, Biochemistry. 45: 7100-7112. Nauli, S., Kuhlman, B. and Baker, D. (2001). Computer-based redesign of a protein folding pathway. Nat. Struct. Biol. 8: 602-605. Pace, C. N. (1986). Determination and analysis of urea and guanidine hydrochloride denaturation curves. Methed Enzymol. 131: 266-280. Pace, C. N. and Shaw, K. L. (2000). Linear extrapolation method of analyzing solvent denaturation curves. Proteins: Struct. Funct. Genet. (Suppl). 4: 1-7. Santoro, M. M. and Bolen, D. W. (1988). Unfolding free energy changes determined by the linear extrapolation method. 1. Unfolding of phenylmethanesulphonyl О±-chymotrypsin using different denaturants. Biochemistry. 27: 80638068. Tanford, C. (1970). Protein denaturation. C. Theoretical models for the mechanism of denaturation. Adv. Protein Chem. 24: 1-95. 96 Species-Specific Identification of Milk and Milk Products: A Molecular Approach Species-Specific Identification of Milk and Milk Products: A Molecular Approach Archana Verma Dairy Cattle Breeding Division, NDRI, Karnal Introduction Intermixing of milk from different species of origin is a common practice depending on the demand of the consumer for liquid milk or the manufacturing of milk products. Different methods based on protein analysis are currently used for milk species identification, including chromatographic, electrophoretic and immunological techniques. Among these, capillary electrophoresis, twodimensional electrophoresis, isoelectric focusing of milk caseins, HPLC, mass spectrometry and ELISA are widely reported. All techniques are based on strategies suited to evaluate the protein patterns originating from the major whey proteins or casein fraction. All these analytical methods are able to detect bovine milk proteins to the minimum level of 0.5вЂ“1 %. Still, the success of analytical tools that rely on protein detection for species identification may be in some cases is affected by proteolysis or denaturation of milk proteins as a result of heat treatment during processing. In the last years, full attention has been turning towards application of DNA-based approaches for the authentication of food. Particularly, the polymerase chain reaction (PCR) is increasingly used for the specific detection of the animal origin in milk and milk products. DNA from somatic milk cells, principally represented by leucocytes persists in milk products and may be analysed for species identification. Several PCR-based techniques (DNA hybridization assay; restriction enzyme analysis, RFLP; singlestranded conformation polymorphism analysis, SSCP; duplex polymerase chain reaction, duplex-PCR) have been reported to be performed to amplify nuclear genome obtained from milk and milk products. These methods currently represent valid complements to protein electrophoretic and immunochemical analyses. Their reliability and very low thresholds of detection make them promising as routine tools. The methods developed so far rely mostly on PCR-amplification of various regions of the mitochondrial genome. Only 2 of them assure protection from false negative results, as the mix contains primers for all the identified species in a single tube. Other published methods use primers for single species or apply restriction analysis of the obtained PCR-product. On the basis of various studies demonstrating that DNA is not degraded after thermal and enzymatic processes, this has come up as a new strategy for the detection of low amounts of interspecies milk. Present paper will focus on DNA based techniques. Basic methodology DNA Extraction from whole blood /milk is isolated using standard protocol of lysis, proteinase K digestion, phenol - chloroform extraction, ethanol-precipitation. Primers Designing of specific primer pairs for detection of cow and buffalo genomic/mitochondrial DNA is done taking care to avoid significant Tm differences between the primers, thereby preventing the generation of unspecific products. Some of the primer pairs from literature have been tabulated: Table: Some of the Primer Pairs with respective Annealing Temperatures and PCR Products * S.No Forward Primer 5вЂ™------------3вЂ™ Reverse Primer 5вЂ™--------------3вЂ™ TaВ°C PCR Product (bp) 1 GGTAAATCTCGTGCCAGCCA TCCAGTATGCTTACCTTGTTACGAC 56 300 2 GAACTCTGCTCGGAGACGAC AGCACCAATTATTAGGGGAAC 56 134 3 CAATAACTCAACACAGAATTTGC CGTGATCTAATGGTAAGGAATA 52 300 4 CCAACATGCGTATCCCGT AGCGGATGCATGATGAAATG 52 444 5 CTAGAGGAGCCTGTTCTATAATCGATAA TGGTTTCATAATAACTTTCGCGCT 63 223 LoВґ pez-Calleja, et al. (2004); .2. FELIGINI et al.(2005); 3-4: Kotowicz et al. (2007)l 5. DВґД±az et al., (2007) 97 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Figure 1: Comparison of Qualitative and Quantitative PCR based species Identification (Ballin et al., 2009) [Some workers used universal primer, cytochrome b (cytb; cytochrome b1 and cytochrome b2). to differentiate milk from animal species (cattle, buffalo, goat and sheep) each according to its mitochondrial DNA (mtDNA). The PCR product was digested by restriction endonuclease and yielded a species-specific restriction profile. The assay was more rapid than conventional methods and showed considerable sensitivity.] PCR amplification performed in a 50 L reaction mixture containing template DNA, 200 ВµM dNTPs, 10 mM Tris-HCl, pH=8.3, 50 mM KCl, 1.5 mM MgCl2, 100 nM primers, 1.5 U DNA polymerase with PCR conditions of initial denaturation step at 95 В°C for 10 min followed by 35 cycles of 95 В°C for 30 s, annealing temperatures indicated against each primer and 72 В°C for 30 s; final extension step at 72 В°C for 10 min. Agarose Gel Electrophoresis is carried out to check for the amplicons. Analysis is carried out based on nucleotide-nucleotide BLAST similarity search (http://www. ncbi.nlm.nih.gov/ BLAST) was conducted with the bovine and bubaline specific primer sequences. 98 Species-Specific Identification of Milk and Milk Products: A Molecular Approach Conclusion Modern molecular techniques based on DNA analysis have found good applicability in detecting adulteration and they represent valid complements to the methods relying on protein analysis for the identification of animal species. DNA-based techniques have become effective and reliable also for commercial dairy products. Possible applications in DNA analysis includes traditional and real time PCR. PCR amplified sequence can originate from either mitochondrial or genomic DNA, where both single copy and repetitive sequences can be used. The choice of analytical technique and especially the DNA sequence has a large influence on the limit of detection. However, quantitative methods based on genome/genome equivalents that rely on a fixed copy number and use of repetitive sequences is also an option. References Ballin N.Z., et al. (2009). Species determination вЂ“ Can we detect and quantify meat adulteration? Meat Science. 83:165вЂ“ 174. El-Rady, A. et al., (2006). Identification of milk source by polymerase chain reaction-restriction fragment length polymorphism analysis. Journal of Rapid Methods and Automation in Microbiology 14 (2) 146вЂ“155. Feligini M., et al. (2005). Detection of Adulteration in Mozzarella Cheese, Food Technol. Biotechnol. 43 (1) 91вЂ“95. Kotowicz M, et al. (2007). Application of a duplex-PCR for detection of cowsвЂ™ milk in goatsвЂ™ milk. Ann Agric Environ Med 2007, 14, 215-218. LoВґ pez-Calleja I., et al. (2004). Rapid Detection of CowsвЂ™ Milk in SheepsвЂ™ and GoatsвЂ™ Milk by a Species-Specific Polymerase Chain Reaction Technique. J. Dairy Sci. 87:2839вЂ“2845. LВґopez-Calleja I., et al., (2007). Application of a polymerase chain reaction to detect adulteration of ovine cheeses with caprine milk. Eur Food Res Technol. 225: 345вЂ“349. 99 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Proteomic Techniques for Application in Food Science Ashok K. Mohanty Animal Biotchnology Centre, NDRI, Karnal Introduction In recent years, a number of вЂ�вЂ�omicsвЂ™вЂ™ technologies (genomics, proteomics, metabolomics, and others) have become available that hold promise for increasing the understanding of the complexities of pathogen behavior at the molecular level and for the development of improved pathogen detection and typing systems. Genomics is the study of genes and their function, transcriptomics refers to global analyses of gene expression, and proteomics is the study of the complete set of proteins produced by a species and their modifications, expression, involvement in metabolic pathways, and interactions. Omics-based tools enable researchers to explore complex biological processes in a quantitative and integrative manner via a systems biology approach. These methods of analysis are facilitating the identification of genes that are responsible for survival and persistence in specific environments, and revealing genes that are potential targets for interventions and that play a role in pathogenesis, stress responses, and biofilm formation. Proteomics is the study of the proteome, the protein complement of the genome. Proteomics or, more appropriately functional proteomics refers to the branch of discovery of science focusing on proteins. The term вЂ�proteomeвЂ™ is used to describe the complete set of proteins that is expressed, and modified following expression, by the entire genome in the lifetime of a cell. The term вЂњproteomicsвЂќ and вЂњproteomeвЂќ were coined by Marc Wilkins and colleagues in the early 1990s and mirror the terms вЂњgenomicsвЂќ and вЂњgenomeвЂќ, which describe the entire collection of genes in an organism. Today, proteomics is a scientific discipline that promises to bridge the gap between our understanding of genome sequence and cellular behaviour. It can be viewed as more of a biological assay or tool for determining gene function. Initially the term was used to describe the study of the expressed proteins of a genome using twodimensional (2D) gel electrophoresis, and massspectrometry (MS) to separate and identify proteins and sophisticated informatics approaches for deconvoluting and interrogating data. This approach is now referred to as вЂњexpressionвЂќ or вЂњglobal profilingвЂќ proteomics. The scope of proteomics has now broadened to embrace the study of вЂњprotein-proteinвЂќ interactions (protein complexes), referred to as cell-mapping proteomics (Blackstock and Weir, 1999). The many faces of proteomics Proteomic analysis (or analytical protein chemistry). The large-scale identification and characterization of proteins, including their posttranslational modifications, such as phosphorylation and glycosylation. Analysis is done with the aid of mass spectrometry or Edman degradation. Expression proteomics (or differential display proteomics). Two-dimensional gels are used for global profiling of expressed proteins in cell lysates and tissues. This conventional approach is being challenged by non-2D gel methods, such as liquid-based isoelectric focusing (IEF) or ion-exchange chromatography / reversed-phage high-performance liquid chromatography (RP-HPLC). Proteins are typically identified by massspectrometry (MS). In many situations, these methods are complemented by DNA-based array methods. Cell-mapping proteomics (or cataloging of protein-protein interactions). Protein-protein interactions and intracellular signaling are determined by identification of protein complexes (obtained by affinity purification and protein identification by MS) or by direct DNA readout (e.g. yeast two-two hybrid, phage display, ribosome display, and RNA-peptide fusions). Proteomics vis-a vis Genomics Large-scale genome sequencing: One of the most biological achievements to emerge during the last 40 years has been the completion 100 Proteomic Techniques for Application in Food Science of draft DNA sequences of the human genome, published by the International Human Genome Sequencing Consortium (a publicly) funded project and by Celera Genomics (a commercial effort). This has provided a blue print of the information needed to create a human being and revealed for the first time the organization of a vertebrateвЂ™s DNA. The public project estimates that there are 31, 000 proteinencoding genes, where as Celera finds ~26,000, with many more still to be found (a current estimate suggests that the number of protein-encoding genes may be on the order of 60,000). Interestingly, the number of coding genes in the human sequence is not dramatically different from the numbers Biological context of Genomics and Proteomics reported for phylogenetically remote organisms: 6, 000 for a yeast cell, 13,000 for a fly, 18,000 for a worm, and 26,000 for a plant (Genomes Online Databases at http://wit.integratedgenomics.com/GOLD). The number of genes reported for multicellular organisms is not highly accurate because of limitations of existing abinitio gene prediction methods used to identify genes. The existence of an open reading frame (ORF) in genomic data does not necessarily imply the existence of functional gene. In human DNA, gene prediction by abinitio methods is difficult because of extensive alternative splicing, lower density exons, and high proportions of interspersed repetitive sequences. Given the unreliability of abinitio gene prediction software, all genes will need to be experimentally identified and annotated. Hence, verification of a gene product by proteomic analysis is an important first step in annotating the genome. Disparity between mRNA Profiling and protein profiling: There is no simple correlation between changes in mRNA expression levels (transcriptomics) and those in protein levels (proteomics). The link between transcript levels and protein levels in a given cell or tissue is difficult. It is also understood that array-based gene expression monitoring or other gene expression methods for measuring mRNA abundances, alone are insufficient for analyzing the cellвЂ™s protein complement. There is a marked disparity between the relative expression levels of mRNAs and those of their corresponding proteins. Differing stability of mRNAs and different efficiencies in translation can affect the generation of new proteins. Once formed, proteins differ significantly in stability and turnover rates. Many proteins involved in signal transduction, transcription factor regulation, and cell-cycle control are rapidly turned over as a means of regulating their activities. Also mRNA levels tell us nothing about the regulatory status of the corresponding proteins, whose activities and functions are subject to many endogenous posttranslational modifications and other modifications by environmental agents. Therefore, the complication arises when considering the complementarity of genomics and proteomics. Despite the notion that one gene gives rise to one protein, the situation in eukaryotic cells is more likely six to eight proteins per gene. Thus, there may be several hundred thousand human proteins after splice variants and essential posttranslational modifications are included. For example, 22 different forms of human О±-1-antitrypsin have been observed in human plasma. Such biological complexities can be unraveled using proteomic studies to understand how cells modulate and integrate signals. Identification and analysis of proteins Four key platform technologies are crucial to any proteomics strategy aimed at elucidating the function of an unknown gene. вЂў Sample preparation & handling вЂў Determination of partial amino acid sequence information вЂў Protein identification and quantification вЂў Cell mapping 101 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance SEC: size exclusion chromatography; IEX: ion-exchange chromatography; RP-HPLC: reversed вЂ“phase high-performance liquid chromatography; HIC: hydrophobic interaction chromatography; 2DE: two-dimensional gel electrophoresis; 1DE: one dimensional gel electrophoresis; FFE: free-flow electrophoresis; CZE: capillary zone electrophoresis; FRET: fluorescence resonanace energy transfer Protein separation strategies: One of the rate-limiting steps in any proteomic analysis study is obtaining, and then handling, sufficient quantities of target protein (s) from its original biological source. The classical method of quantitative and qualitative expression Technology platforms for Proteomics proteomics combines protein separation by high-resolution 2D gel electrophoresis with MS or MS/MS identification of selected protein spots. Because, even the best 2D gels can routinely separate no more than 1500 proteins, this technique is limited to the most abundant proteins if a crude protein mixture (whole-cell lysate) is used. 2D electrophoresis is limited by the amount of material that can be applied to the first-dimension immobilized pH gradient gel (~150 ug to low milligram quantities). Hence 2D gels have limited вЂ�scale upвЂ™ capability. For this reason, it is often desirable to вЂњtrace enrichвЂќ for a particular subclass of proteins. By analyzing proteins in a cellular compartment or organelle, it is possible to reduce the complexity and differences in abundance of a subset of proteins within a cell. Two-Dimesional SDSPAGE: This separation method has become synonymous with proteomics and remains the single best method for resolving highly complex protein mixtures. Twodimensional SDS-PAGE is Proteomics strategies for the identification and analysis of proteins actually a combination of two different types of separations. In the first, the proteins are resolved on the basis of isoelectric point by IEF. In the second, focused proteins are then are further resolved by electrophoresis on a polyacrylamide gel. Thus 2D-SDS-PAGE resolves proteins in the first dimension by isoelectric point and in the second dimension by molecular weight. Dedicated 2D-SDSPAGE systems are available that use immobilized pH gradient (IPG) strips and relatively foolproof hardware to facilitate the transfer of proteins from the IPG strip into the SDS-PAGE slab gel. The IPG strip is based on the use of immobilized pH gradients, in which polycarboxylic acid ampholytes are immobilized on supports to reproducibly create stable pH gradient. The use of narrow pH ranges facilitates the separation of proteins with highly similar isoelectric points. Proteins separated by 2D gels are visualized by conventional staining techniques, including silver, Coomassie, amido black stains and fluorescent staining. Silver-staining and newer fluorescent dyes are the most sensitive. Cell mapping and identification of proteins in complexes One way to observe interacting proteins involved in a given biological process is to specifically enrich for these proteins. Typically, this requires knowledge of the activity of atleast one protein in 102 Proteomic Techniques for Application in Food Science the multiprotein complex. Under nondenaturing conditions, interacting proteins can be enriched from complex protein mixtures (e.g., cell lysates) using methods such as: вЂў Coimmunoprecipitation or вЂњpull-downвЂќ techniques using antibodies directed against one of the component proteins. вЂў Coprecipitation using affinity-tagged recombinant proteins and antibodies directed against the вЂњtagвЂќ epitope вЂў Protein-affinity-interaction chromatography (e.g using recombinant glutathione S-transferase (GST)fusion proteins and glutathione-affinity chromatography). вЂў Isolation of intact multiprotein complexes (e.g., nuclear pore complex, ribosome complexes, spliceosomes). Determination of Partial Amino Acid Sequence Usually, the final step of most proteomic studies, independent of the purification method employed, utilizes either SDS-PAGE or 2D acrylamide gels to separate the proteins for identification and characterization. Following electroblot and transfer to an inert membrane, such as polyvinylidine difluoride (PVDF), intact proteins can be identified directly by amino- or carboxy-terminal amino acid sequence analysis or indirectly from peptides generated by in-gel or on-membrane digestion of the protein with a protease usually trypsin. MS-based methods usually identify a protein, not by analyzing it directly, but by analyzing the peptides derived from proteolytic digestion. Usually, a small number of peptides yield sufficient information to permit protein identification (by peptide mass finger printing (PMF) and/or MS/MS of individual peptides. In contrast to peptides, the molecular mass of intact proteins is usually insufficient to allow database identification. MALDI-MS is used to determine the accurate mass of a group of peptides derived from a protein by digestion with a sequence-specific protease, usually trypsin, thus generating a peptide mass map or peptide mass fingerprint. Because trypsin cleaves proteins at the amino acids arginine and lysine, the masses of tryptic peptides can be predicted theoretically for Cell mapping: affinity capture any entry in a protein sequence database. Electrospray ionization and tandem mass spectrometry is used to sequence the isolated peptides from a peptide mixture. Differential display proteomics A fundamental aspect of proteomic research is the determination of protein expression levels between two different states of a biological system (e.g. relative quantification of protein levels), such as that encountered between a normal and diseased cells or tissues. This is referred to as differential display or comparative proteomics. This can be done in two ways such as running and comparing samples in 2D-SDS-PAGE or with LC-MS and Isotope tags. For differences in the protein-expression profiling, we compare 2D-gels from two different samples for differences in the occurrence or intensity of protein spots. This approach provides a useful means of comparing proteomes. However, identification of protein is cumbersome and difficult by this procedure. Application of peptide mass fingerprinting and LC-MS-MS analysis now makes it possible to identify essentially any protein one can detect by staining the gel. Therefore, the critical 103 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance task in comparative proteomics with 2D gels is identifying the features that differ between the gels. The LC-MS approach to proteome comparisions is conceptually the opposite of the 2D gel approach. Whereas the 2D gel approach separates proteins and begins with an image comparision, the LC-MS approach separates peptides and ends with data mining to assess differences between samples. Two protein samples are treated with reagents to вЂњtagвЂќ them. The tags are chemically identical, except that one contains heavy isotopes (e.g. 2H, 15N, 13C, 18O etc.) and the other contains light isotopes. The samples are digested and the peptides are analyzed by LC-MS-MS. Analysis of the MS-MS data allows identification of the protein present. Examination of the full-scan spectra corresponding to each MSMS scan then allows measurement of the ratio of the light- and heavy- isotope tagged peptides. This ratio corresponds to the ratio of that protein in the two samples. This approach provides a relative quantification of the level of a particular protein in two samples. Mapping protein modifications: Vast majority of all eukaryotic proteins are posttranslationally modified and more than 200 posttranslational modifications (PTMs) of amino acids have been reported so far. Practically all PTMs are associated with either an increase or a decrease in molecular mass. The two major PTMs of proteins are phosphorylation and glycosylation. Phosphorylation of proteins is a ubiquitous regulatory mechanism in both eukaryotes and prokaryotes. Intracellular phosphorylation is regulated by protein kinases (dephosphorylation is regulated by protein phosphatases), which are activated in response to extracellular signals and trigger cells to switch on or off many diverse processes such as metabolic pathways, kinase cascade activation, membrane transport, gene transcription, and motor mechanisms. Protein phosphorylation can be examined in several ways such as вЂ�phosphopeptide mapping of 32Plabelled proteins and peptidesвЂ™, amino-terminal sequencing using Edman degradation procedure and Mass spectrometry. While all the three methods are equally good, MS is an ideal tool in proteomics studies of PTM identification and characterization because of its high sensitivity. Application in food science Microarray-based comparative genomics research, which takes advantage of information available from whole genome sequences, is leading to an increased understanding of the evolution and pathogenesis of food-borne pathogens and is providing critical information for the development of improved detection and genotyping methods.DNAmicroarray technology provides accurate measurements of gene expression for every gene in a genome and allows this expression to be analyzed in response to specific environmental variables. Further, this technology can be utilized to identify genes that are controlled by specific regulators by comparing gene expression in mutant and wild-type bacteria. However, the potential for the analysis of gene expression of pathogens in food environments has not yet been completely realized due to the substantial technical challenges associated with accurately measuring bacterial gene expression in complex matrices. Genomotyping involves the comparison of whole genomes of bacteria using DNA microarrays and has been utilized to identify potential genes associated with virulence, disease severity, and adaptation to different hosts and ecological niches. Used as diagnostic tools, DNA microarrays offer the capability to detect and characterize a broad spectrum of pathogens simultaneously in a relatively short period of time. Various food grade bacteria with specific reference to lactic acid bacteria are used for production of fermented foods. Different lactic acid bacteria produce different proteins in the system during fermentation. Global analysis of proteome of useful lactic acid bacteria using proteomic approaches will help to identify various proteins expressed in the system. Systematic analysis of the proteins expressed will give an idea about the importance of various proteins during fermentation. Differential expression proteomics in between various useful microorganisms will help us to identify useful biomolecules specific for a particular microorganism. This will help us to identify organism specific cellular markers for future application in food product development. Milk constitutes an important ingredient of food system. This is constituted of number of growth 104 Proteomic Techniques for Application in Food Science promoting proteins, enzymes and signaling molecules. Global and differential expression analysis of proteins in milk of various animal species will help us to identify various new proteins of health importance. Until now, most of the abundant proteins have been studied in milk. However, many low abundant proteins which are secreted in milk are generally ignored and have not been studied in detail. Proteomic approaches will help to identify useful low abundant proteins, which can be studied further for understanding their beneficial properties. Thus proteomic techniques are extremely useful for discovery of novel biomolecules for future applications in food science. Global genetic-based analyses provide information regarding which genes an organism contains or which genes are expressed under specific conditions; however, examining the posttranslational protein output of an organism allows one to query the ultimate outcome of the organismвЂ™s genetic and regulatory activities. Techniques that fall within the category of either proteomics or protein arrays are used for global analysis of cellular protein output under different conditions and potentially those relevant to food and foodprocessing environments. The integration of both genetic- and protein based approaches provides a global analysis of treatment- or environment-related changes at the molecular level, thus presenting a more comprehensive view of cellular activities. The development of high-throughput analysis techniques will make possible multi-omics approaches to understanding complete biological systems, a field known as systems (integrated) biology. Although omics technologies are becoming standard research tools that offer tremendous opportunities, there are also significant challenges. There is a need to properly manage the large quantity of complex raw data generated by these technologies in a manner such that it can be adequately analyzed, scrutinized, and compared for the benefit of the scientific community. There are various omics standardization activities underway, which are critical for the integration and interpretation of data from different data sources. Lastly, there is a need to bridge the gap between knowledge of the genome, proteome, and metabolome, and results obtained in relevant systems by studying the behavior of pathogens in foods and in the animal host, not only in model systems under laboratory conditions. The knowledge garnered from omics-based research in the coming years will play an important role in understanding how pathogens survive food safety barriers and interact with host species. Each new advance in our understanding will potentially give rise to improved and novel strategies for detection, identification, and control of food-borne pathogens, as well as for diagnosis and control of infections. 105 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Evaluation of Probiotic Attributes of Dairy Starter Cultures Using Various Test Methods Rameshwar Singh Dairy Microbiology Division, NDRI, Karnal Probiotics вЂ“ friendly bacteria with a host of benefits вЂњLet food be the medicine and medicine be the food,вЂќ the age-old quote by Hippocrates, is certainly the dogma of today. With the growing interest in self-care, recognition of the link between diet and health is becoming stronger day by day. As a result, the market for functional foods, or foods that promote health beyond providing basic nutrition, is flourishing. Within the functional foods is the rapidly expanding arena of probiotics. Probiotics (according to the currently adopted definition by FAO/WHO) are: вЂњLive microorganisms which when administered in adequate amounts confer a health benefit on the hostвЂќ. The term probiotics is derived from the Greek word вЂ�proвЂ™ means вЂ�forвЂ™ and вЂ�bioвЂ™ means вЂ�lifeвЂ™. Lilly and Stillwell were the first one to introduce the term probiotics in the year 1965 to describe the growth promoting factors produced by the microorganisms. However over the years, the term probiotics has been linked to several definitions. As per the version of Parker, probiotics can be defined as those organisms and substances, which contribute to the intestinal microbial balance. Later, Fuller redefined probiotics as foods containing live microorganisms, which actively enhance the health of consumers by improving the balance of microflora in the gut, when ingested live in sufficient numbers. Types of probiotics Many types of bacteria have been used as probiotics since time immemorial. Today food products containing probiotics are almost exclusively dairy products вЂ“ fluid milk, dahi, soy yogurt, yogurt due to the historical association of lactic acid bacteria with fermented milk. The most frequently used bacteria in these products include the Lactobacillus and Bifidobacterium species. Some Enterococcus species, yeasts like Saccharomyces species too find a place in the long list of probiotics. In particular lactobacilli are generally used as probiotics. This may have historical reasons since Metchnikoff proposed that the lactobacilli present in yoghurt would have a health promoting effect. Potential health benefits of probiotic The list of potential health promoting traits attributed in particular to LAB is quite impressive. Health benefit: proposed mechanism(s) 1. Alleviation of lactose intolerance: Bacterial ОІ-galactosidase acts on lactose 2. Positive influence on intestinal flora: Lactobacilli influence activity of overgrowth flora, decreasing toxic metabolite production Antibacterial characteristics a. b. 3. a. b. c. d. e. f. g. h. 106 Prevention of intestinal tract infections: Adjuvant effect increasing antibody production Stimulation of the systemic or secretory immune response Competitive exclusion Alteration of intestinal conditions to be less favorable for pathogenicity (pH, short chain fatty acids, bacteriocins) Alteration of toxin binding sites Gut flora alteration Adherence to intestinal mucosa, preventing pathogen adherence Competition for nutrients Evaluation of Probiotic Attributes of Dairy Starter Cultures Using Various Test Methods 4. a. b. c. d. e. f. g. Improvement of the immune system: Strengthening of non-specific defense against infection Increased phagocytic activity of white blood cells Increased serum IgA after attenuated Salmonella typhimurium challenge Increase in IgA production Proliferation of intra-epithelial lymphocytes Adjuvant effect in antigen-specific immune responses Regulation of the Th1/Th2 balance, induction of cytokines a. b. c. Reduction of inflammatory or allergic reactions: Restoration of the homeostasis of the immune system Regulation of cytokine synthesis Prevention of antigen translocation into blood a. b. c. d. e. Anti-colon cancer effect Mutagen binding Carcinogen deactivation Alteration of activity of colonic microbes Immune response Influence on secondary bile salt concentration a. b. c. Blood lipids, heart disease : Assimilation of cholesterol Alteration of activity of bile salt hydrolase enzyme Antioxidative effect 5. 6. 7. 8. b. Antihypertensive effect: Peptidase action on milk results in antihypertensive tripeptides (angiotensin converting enzyme inhibitors) Cell wall components act as angiotensin converting enzyme inhibitors a. b. c. Urogenital infections: Adhesion to urinary and vaginal tract cells Competitive exclusion Inhibitor production (H2O2, bio-surfactants) a. 9. 10. a. b. c. Infection caused by Helicobacter pylori: Competitive exclusion Lactic acid production Decreased urease activity of H. pylori in humans after administration of a supernatant of a Lactobacillus culture 11. Regulation of gut motility (constipation) Characteristics expected of potential probiotic strains вЂў Non toxic and non-pathogenic вЂў Accurate taxonomic identification вЂў Normal inhabitant of the targeted species вЂў Capable of survival, proliferation and metabolic activity in the target site, which вЂў resistance to gastric acid and bile вЂў ability to persist, albeit for short periods, in the gastrointestinal tract вЂў adherence potential preferred вЂў ability to compete with the resident flora вЂў Production of antimicrobial substances вЂў Antagonism towards pathogenic bacteria вЂў Ability to modulate immune responses вЂў Ability to exert at least one clinically documented health benefit implies: 107 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance вЂў вЂў вЂў вЂў Genetically stable Amenability of the strain and stability of the desired characteristics during processing, storage and delivery Viability at high populations Desirable organoleptic and technological properties when included in fermentation processes Evaluation of the probiotic attributes of lactic acid bacteria (1) Acid tolerance: The ability of lactic acid bacteria (LAB) to resist acidic conditions (Clark et al., 1997) is tested. The LAB are grown in their respective broth overnight at their respective growth temperatures. The actively grown cells (8 log10 cfu ml-1) are harvested by centrifugation and resuspended in equal volume of broth with pH adjusted to pH 4.0, pH 3.0, pH 2.0 with 1 M HCl and simultaneously in broth with pH 7.0 as control. Survival is evaluated by determining the viable counts of the samples serially diluted in peptone water after 0, 30, 60 and 120 min in acidic conditions, which is subsequently plated on their respective agar and incubated at their respective temperature. (2) Bile tolerance : Tolerance for bile acids is tested according to the method of Gilliland et al. (1984). The LAB are grown in their respective broth overnight at their respective growth temperature. The actively grown cells (8 log10 cfu/ ml) are harvested by centrifugation and resuspended in equal volume of their broth supplemented with 0.5%, 1%, 2% w/v ox bile and without supplement as a control . Survival is evaluated by plate count on their respective agar, after 0, 1, 3 and 12h of incubation in broth containing bile salts reflecting the time spent by food in the small intestine and subsequently the plates were incubated at their respective temperature. (3) Cell surface hydrophobicity : Ability of the organisms to adhere to hydrocarbons is a measure of their adherence to the epithelial cells in the gut i.e. cell surface hydrophobicity. Cell surface hydrophobicity of LAB is determined according to the method described by Rosenberg et al., (1980) with slight modification using n-Hexadecane, n-Octane and Xylene. Cultures of the strains are grown in their respective broth overnight at their respective growth temperatures. The cells (8 log10 cfu ml-1) are harvested in their early log phase by centrifugation at 12,000 x g for 5 min at 5ВєC, washed twice and resuspended in 5 ml phosphate urea magnesium (PUM) buffer (pH 6.5) and the cell suspension is adjusted to an absorbance value (A610) of approx. 0.8 - 1.0. Three ml of the bacterial suspension are put in contact with 1 ml of each of the hydrocarbons. The cells are pre-incubated at their respective temperature for 10 min and then vortexed for 120 s. The suspension is then kept undisturbed at their respective temperatures for 1h to allow phase separation and the hydrocarbon layer is allowed to rise completely. After 1h, aqueous phase is removed carefully with a Pasteur pipette and the absorbance (A610) is measured using Spectrophotometer . The decrease in the absorbance is taken as a measure of the cell surface hydrophobicity (%H) calculated with the given equation. Where, ODinitial and ODfinal are the absorbance (at 610nm) before and after extraction with the three hydrocarbons. (4) Antibiotic susceptibility : Pattern of resistance/susceptibility to antibiotic of LAB is studied by disc diffusion method. Various antibiotic discs of ampicillin, amoxycillin, bacitracin, chloramphenicol, ciprofloxacin, cotrimoxazole, erythromycin, gentamicin, kanamycin, nalidixic acid, penicillinG, rifampicin, streptomycin, tetracycline, and vancomycin are used. Mueller Hinton agar 2 (Himedia) plates are poured in petri plates and allowed to solidify. These are subsequently over laid with 4 ml of Mueller Hinton agar 2 soft agar tempered at 45ВєC and seeded with 200 ВµL of active cultures. Petriplates are allowed to stand at room temperature for 15 min and then the antibiotic discs are dispensed onto agar using forceps under aseptic conditions. The agar plates are incubated at 37ВєC aerobically for 24 h. Diameter (mm) of zone of inhibition is measured using antibiotic zone scale and results are expressed 108 Evaluation of Probiotic Attributes of Dairy Starter Cultures Using Various Test Methods in terms of resistance, moderate susceptibility or susceptibility by comparing with the interpretative zone diameters given by Performance Standards for Antimicrobial Disk Susceptibility tests (CLSI, 2007) for disc diffusion antibiotic susceptibility test. (5) Antimicrobial activity : LAB are screened for their antibacterial activity and inhibitory spectra against a broad range of Gram-positive and Gram-negative strains by spot-on-lawn assay (Uhlman et al., 1992). Active pure cultures of LAB are grown in broth for 16-18 h at 37ВєC. Cell free culture supernatants (CFCS) are prepared by centrifuging the broth at 10,000 rpm for 10 min at 4ВєC. The culture supernatants thus obtained are heat treated (90ВєC, 5-7 min) to kill any live cell. Fresh culture of indicator bacteria grown for 16-18 h are further inoculated for its active growth at optimum temperature for 3-4 h (absorbance at 660 nm = 0.01). Fifty microlitres of this culture is mixed with 7 ml of melted and tempered (45ВєC) TGE soft agar and poured onto the previously surface dried TGE agar plates. The soft agar is allowed to solidify and 5 Ојl of CFCS is directly spotted on the lawns of indicator organism. The plates are kept undisturbed for 2 h and subsequently incubated at 37oC. After 24 h of incubation, a 5 mm or more diameters (mm) of the growth inhibition zones are considered positive inhibition. (6) Cholesterol reduction test : For the ability of probiotic culture to reduce cholesterol present in the media, 20 mL of respective broth (containing 3% oxgall and 1% lipid cholesterol rich) is inoculated with culture and incubate at respective temperature for 16 h. Uninoculated broth (control) is processed in the same way. Cells are removed by centrifugation at 8000 g for 5 min. 0.5 mL supernatant is placed into a clean glass tube and 3 mL of 95% ethanol is added to each tube, followed by 2 mL of 50% potassium hydroxide and mixed. Tubes are placed in water bath at 60В°C for 10 min. and cooled at room temperature (20В°C). After this, 5 mL of hexane is carefully added and mixed vigorously with a vortex for 20s. A 3 mL H2O is added and mixing is done with the vortex. Then the tubes are allowed to settle at room temperature for 15 min or until complete phase separation (aqueous and organic phase). Next, 2.5 mL of the hexane layer (upper phase) is transferred into a clean tube and dried at 60В°C under nitrogen gas flow. The residues formed are resuspended in 4 mL of o-phthalaldehyde reagent. Tubes are kept at room temperature for 10 min and then 2 mL of concentrated sulfuric acid is pipette slowly down the inside of each tube. These tubes are mixed thoroughly. After standing at room temperature for an additional 10 min, absorbance is recorded at 550 nm (A550) against the reagent blank. The results are expressed as micrograms (Ојg) of cholesterol per milliliter. References Clark, P.A., Cotton, L.N. and Martin, J.H. 1997. Selection of bifidobacteria for use as delivery adjuncts in cultured dairy foods. II. Tolerance to stimulated pH of human stomachs. Cult. Dairy Prod. J., 28(4): 11-14. Gilliland, S.E., Staley, T.E. and Bush, L.J. 1984. Importance of bile tolerance of Lactobacillus acidophilus used as dietary adjunct. J. Dairy Sci., 67: 3045-3051. Rosenberg, M., Gutnick, D. and Rosenberg, E. 1980. Adherence of bacteria to hydrocarbons: A simple method for measuring cell-surface hydrophobicity. FEMS Microbiol. Lett., 9: 29-33. Performance Standards for Antimicrobial Disk Susceptibility tests, Clinical and Laboratory Standards Institute (CLSI), 27(1), 2007. Uhlman, U., Schillinger, U., Rupnow, J.R. and Holzapfel, W.H. 1992. Identification and characterization of two bacteriocin-producing strains of Lactococcus lactis isolated from vegetables, Int. J. Food Microbiol., 16: 141-151. Spencer, J. and Spencer, A. 2001. Methods in Biotechnology: Food Microbiology protocols, 14: 174-181. 109 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Identification of Lactobacillus spp by PCR based Molecular Methodology Sachinandan De and Rupinder Kaur Animal Biotechnology Centre, NDRI, Karnal Lactic Acid Bacteria (LAB) constitute an important class of organism widely distributed in nature and occurring naturally as indigenous microflora in raw milk. They play an important role in food and feed fermentation. Lactobacillus forms the most numerous genus in the -heterogeneous group of LAB. Members of the genus Lactobacillus are also found in plants and in plant-derived materials, such as silage, grains and foods, but also in the gastrointestinal tract (GIT) of humans and animals (Stewart, 1997). Lactobacillus species are used industrially for the production of yogurt, cheese, sauerkraut, pickles, beer, wine, cider, kimchi, chocolate and other fermented foods, as well as animal feeds, such as silage. The genus Lactobacillus currently consists of over 149 species and 29 subspecies and encompasses a wide variety of organisms (http://www.bacterio.cict.fr/l/lactobacillus.html). Members of the genus Lactobacillus are Gram positive, non motile, non spore forming rods or cocci bacteria that produce mainly lactic acid after carbohydrate fermentation (Kandler and Weiss 1986). Quality assurance programs associated with research, development, production and validation of the health or technological benefits of these bacteria require their relevant isolation, counting and identification. The precise identification of these bacteria to the genus and species level is quite laborious. At present the identification of Lactobacilli largely depend on selective growth in microaerophilic MRS (deMan Rogosa - Sharpe) media and an array of biochemical tests like Gram staining, catalase test, carbohydrate fermentation. These microbiological / culture based methods are time consuming and often give rise to ambiguous results. Polyphasic approaches combining biochemical, molecular, and morphological data are important for the accurate classification of lactic acid bacteria (Klein et al., 1998). Lactobacillus species may be difficult to identify by conventional biochemical methods, although simplified approaches are useful for presumptively assigning organisms to this genus. Many DNA based methods have been applied to the identification of Lactobacilli. The ribosomal RNA gene sequences (16 S rRNA and 23S rRNA) have been used by many workers for the identification of LAB. This is possible because of the conserved nature of the 16S rRNA gene sequence and a vast repertoire of online rRNA gene sequences reported by the scientific community against which the rRNA could be compared. The 16S rRNA gene based classification has revealed considerable diversity in this genus (Vela et al. 2008). New Lactobacillus species are continually being described (www.bacterio. cict.fr), with 10 new species in 2007 and four in 2008. Some Lactobacillus species have been renamed over the years. These changes cause confusion and some previous identification of Lactobacilli may yet be subject to change . Dubernet et al (2002) have developed a PCR assay using a genus specific primer, targeted to the genes encoding the 16S rRNA. As we enter into the genomics era the rRNA based microbial phylogeny is under critical scrutiny. Other useful genotypic studies using protein encoding genes tuf gene (encoding elongation factor Tu, involved in protein biosynthesis, Chavagnat et al 2002), rpoB (RNA polymerase beta subunit) , gyr B (B subunit of DNA gyrase), hsp 65, ( heat shock protein 65) dnaJ (asoociated with DnaK chaperone machinery) , recA (encoding recombinase A), groEL (groEL, encoding a 60-kDa heat shock protein) pheS (phenylalanyl-tRNA synthase) have been published recently. Being housekeeping genes from biosynthetic pathways, they retained the amino acid structure more or less conserved without modifying the product of translation substantially by tolerating silent point mutations, which lead to a greater degree of variability at the nucleotide level. Characterisation and identification of lactobacilli from genus level to strain level For decades, differentiation between genera has been based on phenotypic characters. Under a light microscope, lactobacilliare generally regularly shaped, non-motile, non-spore-forming, Gram110 Identification of Lactobacillus spp by PCR based Molecular Methodology positive rods. However, cell morphology varies widely, from long, straight or slighty crescent shaped rods to coryneform coccobacilli. Numerous genera display such morphological features. However, we can separate by simple tests such as tests for the oxygen tolerance, presence of catalase and growth on acidified MRS. Classical phenotypic tests for identification of lactobacilli are based on physiological characteristics such as respiratory type, motility, growth temperature and growth in NaCl, and on biochemical characteristics such as homo/hetero-fermentative, production of lactic acid isomers, metabolism of carbohydrate substrates, coagulation of milk and presence of particular enzymes (e.g. arginine dihydrolase, antibiotic susceptibilities, and so on). Lactobacilli are typically chemoorganotrophic and ferment carbohydrates, producing lactic acid as a major end product. Analysis at genus level The genus Lactobacillus is heterogeneous, with the G+C content of the DNA of its species varying from 33 to 55% (Hammes and Vogel 1995). However, it is generally thought that G+C content should vary by no more than a 10% range within a well-defined genus (Vandamm et al., 1996). The nucleotide sequences of Lactobacillus 16S ribosomal DNA (rDNA) provide an accurate basis for identification. The sequence obtained from an isolate can be compared with those of Lactobacillus species held in databases. Recently, Dubernet et al. (Dubernet et al., 2002) defined a genus-specific primer by analysing similarities between the nucleotide sequences of the spacer region between the 16S and 23S ribosomal RNA genes of Lactobacillus. The specificity of this genus-specific primer combined with a universal primer was tested against 23 strains of lactobacilli of varied origin (corresponding to 21 species) Escherichia coli, two leuconoctocs species, Carnobacterium piscicola, Pediococcus pentosaceus, Bifidobacterium bifidum, Weissella confusa, Enterococcus faecalis, Staphylococcus aureus and Listeria monocytogenes. Positive amplification was only obtained with the lactobacilli strains. Analysis at species level Phenotypical micro methods Several combinations of tests and ready-to-inoculate identification kits such as API 50 CH, LRA Zym and API Zym enzymatic tests can be used for the rapid and theoretically reproducible phenotypic identification of pure cultures. They have been used for the characterisation and identification of lactobacilli in milks [Medina et al., 2001], yoghurts and other fermented milks (Andrighetto et al., 1998) and in cheeses (Andrighetto et al., 1998, Tilsala and Alatossava 1997). However, the reliability of these tests has been questioned, especially for API 50 CH, initially developed for the identification of medical Lactobacillus strains. In addition, the manufacturerвЂ™s database is not updated and some Lactobacillus species are missing. Andrighetto et al.(Andrighetto et al., 1998) used API 50 CH to analyse 25 strains of thermophilic lactobacilli isolated from yoghurt and from semi-hard and hard cheeses (Lb. delbrueckii ssp. lactis and ssp. bulgaricus, Lb. helveticus and Lb. acidophilus). For most of the strains, clear assignment to a particular species or subspecies was not possible because ambiguous results were obtained for the sugar fermentation profile. Nigatu (Nigatu 2000) also reported a lack of agreement between the API 50 CH grouping pattern of isolates and RAPD clusters. Tynkkynen et al. (Tynkkynen et al., 1999) used API 50 CH for identifying strains of the Lb. casei group (Lb. rhamnosus, Lb. zeae and Lb. casei). The exact identifications of these closely related species were not reliable; some were doubtful or unacceptable and some strains were misidentified with a good identification level. Furthermore, variability may be observed within a single strain. For example, the Lb. rhamnosus GG strain has traditionally been detected, counted and identified on the basis of cultures in selective anaerobic conditions on MRS or Rogosa agar (37В°C for 78 h), colony morphology (large, white, creamy and opaque), Gram staining and cell morphology (Gram-positive and uniform rods in chains) and the carbohydrate fermentation profile in the API 50 CHL test. However, it has been pointed out that the colony morphology and the carbohydrate fermentation pattern of strain GG are not always typical, due to variation (Charteris et al 1997). This variation may result from the loss or gain of plasmids, leading to inconsistency in the metabolic traits of a strain, as most of the proteins involved in carbohydrate fermentation are plasmidencoded (ArhnГ© et al., 1989). 111 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Sequencing Comparison of rRNA gene sequences is currently considered to be the most powerful and accurate method for determining the degree to which microorganisms are phylogenetically related (Woese 1987). Advances in molecular biological techniques have made it possible to sequence long stretches of rRNA genes. Initially, reverse transcriptase was used to generate DNA from rRNA, and this DNA was then sequenced. It is now possible to sequence 16S or 23S rDNA molecules by direct PCR sequencing, and this method has generated large sequence databases. Although the speciesspecific sequences are located in the first half of the 16S rRNA gene (V1-V3 region), identification is more accurate if the whole gene is sequenced (Stackebrandt and Goebel 1994). This requires the sequencing of about 1.5 kb of DNA. Tannock et al. (Tannock et 1999) showed that comparison of the16S-23S spacer region sequences of lactobacilli can be used in practical situations for strain identification. The spacer region sequences is sequencing rapidly and accurately identifies Lactobacillus isolates obtained from gastrointestinal, yoghurt and silage samples. The 16S-23S spacer sequences of lactobacilli are small, only about 200 bp in length. These short sequences are easy to sequence on both strands and provide reliable information forcomparative work. The spacer region method has the advantage of distinguishing between Lb. rhamnosus and Lb. casei strains . (Tannock et 1999) It can be used to distinguish Lb. plantarum, from Lb. paraplantarum, these two closely related species belonging to the Lb. plantarum group [12]. Chen et al. (Chen et al., 2000) analysed the 5S-23S rRNA intergenic spacer regions (ISRs) of the Lactobacillus group. This method was found to be an effective way of discriminating Lb. rhamnosus from Lb. casei/ Lb. paracasei because spacer length polymorphism results in a 76/80 bp insertion with respect to the 16S V2-V3 sequences. Conclusion It is widely recognised that the identification of lactobacilli to species or strain level on the basis of physiological and biochemical criteria is very ambiguous and complicated. Numerous taxonomic changes have been observed in the Lactobacillus genus as qualification of old species in new genera or description of new species. This leads to a problematic genus characterization by phenotypic tests and to an increasing use of classical culture-based molecular methods. New molecular techniques for microbial community analysis that do not require isolation of the microorganisms are very promising. They provide a complementary picture of the population obtained using culture-based techniques when applied to the analysis of milks and dairy products. However, these molecular approaches have several limitations, including the design of adequate primers, and the possibility that DNA isolation, amplification and cloning might be biased by certain strains and sequences. There is also dependence on the detection threshold and on the number of lactobacilli, unfortunately low in high quality raw milks. Numerous techniques, culture- dependent or culture-independent, are based on the use of probes and primers. For these techniques the discrimination level depends on the existence or not of the probes and primers at the taxonomic level desired. To date we are very far from having specific primers and probes for the 88 lactobacilli species, and regarding those which have been designed, their specificity and validity should be checked one by one with closed genera, species or strains. Another problem results from the given list of 88 lactobacilli species since it is not an official list (it does not exist) and thus to bypass possible misidentification all probes and primers should be validated against the same reference strain at the beginning to ensure their common specificity. Moreover, all the techniques mentioned in this review have not been applied to the lactobacilli using the same objectives. The genus primer designed by Dubernet et al. (2002), has been used for PCR and PCR-TGGE, but not for hybridisation, but it is clear that it could be used. The difficulty of choosing a technique that has good discrimination power depends not only on the techniques but also on the species or strains. Results also depend on the quality and exhaustivity of a database. Finally, only a few limited techniques can be applied with a high degree of confidence although they are dependent on 112 Identification of Lactobacillus spp by PCR based Molecular Methodology database robustness: sequencing to identify at genus and species level, and sequencing or pulsed field gel electrophoresis to discriminate strains. In conclusion, analysis of lactobacilli in cheeses and other dairy products is very complicated and the use of different techniques, especially molecularbased phenotypic or genomic techniques, is recommended. Reference Hammes W.P., Vogel R.F., The genus Lactobacillus, in: Wood B.J.B., Holzapfel W.H. (Eds.), The lactic acid bacteria. The genera of lactic acid bacteria, Blackie Academic, London, UK, 1995, pp. 19вЂ“54. Vandamme P., Pot B., Gillis M., de Vos P., Kersters K., Swings J., Polyphasic taxonomy, a consensus approach to bacterial systematics, Microbiol. Rev. 60 (1996) 407вЂ“438. Dubernet S., Desmasures N., GuГ©guen M., A PCR-based method for identification of lactobacilli at genus level, FEMS Microbiol. Lett. 214 (2002) 271 Medina R., Katz M., Gonzalez S., Oliver G., Characterization of the lactic acid bacteria in eweвЂ™s milk and cheese from northwest Argentina, J. Food Prot. 64 (2001) 559вЂ“563 Andrighetto C., De Dea P., Lombardi A., Neviani E., Rossetti L., Giraffa G., Molecular identification and cluster analysis of homofermentative thermophilic lactobacilli isolated from dairy products, Res. Microbiol. 149 (1998) 631вЂ“643 Tilsala-Timisjarvi A., Alatossava T., Development of oligonucleotide primers from the 16S-23S rRNA intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by PCR, Int. J. Food Microbiol. 35 (1997) 49вЂ“56 Nigatu A., Evaluation of numerical analyses of RAPD and API 50 CH patterns to differentiate Lactobacillus plantarum, Lact. fermentum, Lact. rhamnosus, Lact. sake, Lact. parabuchneri, Lact. gallinarum, Lact. casei, Weissella minor and related taxa isolated from kocho and tef, J. Appl. Microbiol. 89 (2000) 969вЂ“978. Tynkkynen S., Satokari R., Saarela M., Mattila-Sandholm T., Saxelin M., Comparison of ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L. casei strains, Appl. Environ. Microbiol. 65 (1999) 3908вЂ“3914 Charteris W.P., Kelly P.M., Morelli L., Collins J.K., Selective detection, enumeration and identification of potentially probiotic Lactobacillus and Bifidobacterium species in mixed bacterial populations, Int. J. Food Microbiol. 35 (1997) 1вЂ“27 ArhnГ© S., Molin G., Stahl S., Plasmids in Lactobacillus strains isolated from meat and meat products, Syst. Appl. Microbiol. 11 (1989) 320вЂ“325. Woese C.R., Bacterial evolution, Microbiol. Rev. 51 (1987) 221вЂ“271 Stackebrandt E., Goebel B.M., Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology, Int. J. Syst. Bacteriol. 44 (1994) 846вЂ“849 Tannock G.W., Tilsala-Timisjarvi A., Rodtong S., Ng J., Munro K., Alatossava T., Identification of Lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16S-23S rRNA gene intergenic spacer region sequence comparisons, Appl. Environ. Microbiol. 65 (1999) 4264вЂ“4267 113 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Antimicrobial Substances produced by Lactic Acid Bacteria (LAB) Shilpa Vij, Subrota Hati and Minakshi Dahiya Dairy Microbiology Division, NDRI, Karnal Introduction Lactic acid bacteria (LAB) are found in many nutrient rich environments and occur naturally in various food products such as dairy, meat products and vegetables. They have traditionally been used as natural biopreservatives of food and feed. Biopreservation refers to extended shelf life and enhanced safety of foods obtained by using the natural or added microflora and their antimicrobial products. Lactic acid bacteria have traditionally been used as natural biopreservatives in food and animal feed, sauerkraut and silage. Their preserving effect relates mainly to the formation of organic acids and hydrogen peroxide, competition for nutrients and production of antimicrobial substances. Lactic acid bacteria are able to produce antimicrobial compounds such as organic acids, hydrogen peroxides, bacteriocins etc. Antifungal compounds such as proteinaceous compounds, phenyllactic acid, cyclic dipeptides and hydroxylated fatty acids and Bacteriocin-like substances (BLIS) and other low and medium molecular weight mass compounds are also produced by LAB. Organic acids Organic acids occurring in foods are additives or end-products of carbohydrate metabolism of LAB. Lactic and acetic acids are the main products of the fermentation of carbohydrates by LAB. Acetic acid is the strongest inhibitor and has wide range of inhibiting activity against bacteria, yeast and molds. These acids generally recognised as safe agents for the preservation of foods (El-Ziney, 1998), diffuse through the membrane of the target organisms because they are lipid soluble. After entering the cell, the acid gets dissociated. The release of protons in the cytoplasm leads to acidification and inhibition of the cell growth. Hydrogen peroxide (H2O2) Most LAB have flavoprotein oxidases, enabling them to produce hydrogen peroxide (H2O2) in the presence of oxygen. Hydrogen peroxide accumulates in the environment since LAB do not produce catalase. The antimicrobial effect of hydrogen peroxide attributes to a strong oxidizing effect on the bacterial cell, and to the destruction of basic molecular structures of cellular proteins. The antimicrobial effect of hydrogen peroxide at non-inhibitory concentrations is potentiated by lactoperoxidase and thiocyanate present in milk and saliva (Condon, 1987). The lactoperoxidaseвЂ“ thiocyanateвЂ“peroxide system involves the reaction of hydrogen peroxide and thiocyanate through catalysed by lactoperoxidase. Hypothiocyanate (OSCNвЂ“) and other intermediary products then inhibit other microorganisms. The structural damage and changes in bacterial membrane due to exposure to OSCN вЂ“. Occurs. It inhibits glucose transport and some enzyme activity due to oxidation of sulfahydral in the metabolic enzymes. SCNвЂ“+ H2O2 в†’ OSCNвЂ“+H2O The Gram вЂ“negative bacteria are rapidly killed whereas, the Gram-positive bacteria are inhibited. Lactoperoxidase and thiocyanate are present in milk, and when some LAB are grown in milk or milk products, the third needed component, hydrogen peroxide, is added. Diacetyl Diacetyl (2, 3-butanedione), the characteristic aroma compound of butter, has antimicrobial effects at low pH (Jay, 1982) and is produced by strains of some genera of LAB during citrate fermentation. However, the amounts of diacetyl needed to exert antimicrobial activity (close to 200 mM) dramatically alters both the taste and aroma of the product. It has antimicrobial activity against Bacillus sp. 114 Antimicrobial Substances produced by Lactic Acid Bacteria (LAB) Bacteriocins Bacteriocins are bacterial ribosomally synthesized peptides or proteins with antimicrobial activity and kill very closely related bacteria upon binding to the inner membrane or other cytosolic targets. Nowadays, the term bacteriocin is mostly used to describe the small, heat-stable cationic peptides synthesized by Gram positive bacteria, namely lactic acid bacteria (LAB), which display a wider spectrum of inhibition. Based on their cationic and their hydrophobic nature, most of these peptides act as membrane permeabilizers. Pore formation leads to the total or partial dissipation of the proton motive force, ultimately causing cell death. Bacteriocin pore formation seems to be target mediated. Nisin and other lantibiotics use the cell wall precursor lipid II as a docking molecule. Thereby, two modes of action, i.e. inhibition of cell wall biosynthesis and pore formation, are combined within one molecule for potent antimicrobial activity. Class General Features Produced by LAB I-lantibiotics: la-Linear, lb-Globular and lc-Multi component Modified, heat stable, <15kDa, Pore forming, cationic Enzyme inhibitors Nisin, lacticin 481, Plantaricin C, Lct3147 II-Unmodified peptides:lla-Pediocin like, llb-Miscellaneous, llcMulticomponent Heat stable, <15 kDa, antilisteria, two peptides, non-pediocin like Pediocin PA1/AcH, Enterocin A, Sakacin A, Lactococcin G, Plantaricin S, Lactacin F III-Large Proteins: llla-Bacteriolytic, lllb-Non-lytic Heat Stable, >30 KDa, Cell wall degradation, cytosolic targets Enterolysin A, Colicins E2-E9 IV-Circular peptides Heat stable, tail-head peptide bond AS-48, Gassericin A, Acidocin B (Heng and Tagg, 2006) Reuterin Reuterin is produced from glycerol by starving cells under anaerobic conditions, and the active reuterin is an equilibrium mixture of monomeric, hydrated monomeric and cyclic dimeric forms of 3-HPA (3-hydroxypropionaldehyde). Reuterin is active against Gram-positive and Gram-negative bacteria, yeast and fungi. Antifungal activity has been shown against species of Candida, Torulopsis, Saccharomyces, Aspergillus and Fusarium. The production of reuterin (3-HPA) has also been reported from L. brevis and L. buchneri, L. collinoides and L. coryniformis (Magnusson, 2003). A sourdough isolate of L. reuteri has also been shown to produce the antibiotic reutericyclin, a tetramic acid active against many Gram-positive bacteria, including common sourdough LAB, but lacking activity against yeast. Glycerol addition to all L. coryniformis strains dramatically increase their antifungal activity. During isolation of glycerol metabolites from L. coryniformis detects equal amounts of 3-hydroxypropionic acid and 1,3-propanediol and only trace amounts of 3-HPA. They proposed a mechanism for glycerol breakdown by LAB through dehydration of glycerol to 3-HPA, that might be oxidized further to 3-hydroxypropionic acid or reduced to 1, 3-propanediol. First step is catalysed by a glycerol dehydratase and the second step by a NAD-linked reductase, whereas the oxidation to 3-hydroxypropionic acid appears to be spontaneous. Bioactive Peptides Bioactive peptides are described as вЂ�food-derived components (genuine or generated) that, in addition to their nutritional value, exert a physiological effect in the bodyвЂ™. Biological activities associated with such peptides include immunomodulatory, antibacterial, anti-hypertensive and opioid-like properties. Milk proteins are recognized as a primary source of bioactive peptides, which can be encrypted within the amino acid sequence of dairy proteins, requiring proteolysis for release and activation. Fermentation of milk proteins using the proteolytic systems of lactic acid bacteria (LAB) is an attractive approach for generation of functional foods enriched in bioactive peptides given the low cost and positive nutritional image associated with fermented milk drinks and yoghurt. Thus, fermentation of milk and milk proteins by proteolytic lactic acid bacteria can lead to development of functional foods conferring specific health benefits to the consumer beyond basic nutrition. The starter culture applied in the manufacture of `FestivoвЂ™ cheese, a novel bioactive cheese is a mixture of commercial starter cultures containing 12 different strains of the following genera or species: 115 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Lactococcus sp. and Leuconostoc sp. (BD type cultures), Propionibacterium sp. Lactobacillus sp. as well as Lactobacillus acidophilus and Bifidobacterium. Antifungal compounds of LAB Proteinaceous compounds: Ribosomally synthesized antimicrobial peptides generally have a hydrophobic and a hydrophilic end, a size of 20вЂ“50 amino acids, and cationic properties. Many LAB produce bacteriocins, antibacterial, ribosomally synthesized peptides or proteins. Antifungal activity of the compounds produced by LAB are well known. Lactococcus lactis subsp. lactis and Lactobacillus casei produced proteinaceous compounds with antagonistic activity against several filamentous fungi. The anti-aflatoxigenic properties of LAB depend on adherence of fungal toxins to cells of LAB. A proteinaceous compound from Lactobacillus coryniformis subsp. coryniformis strain Si3 as antifungal effect against several moulds and yeasts. The peptide is small (approximately 3 kDa), heat stable, active in the pH range 3вЂ“6 and totally inactivated by proteinase K. Similar characteristics are found among the heat stable, unmodified bacteriocins of subclass II. Phenyllactic acid: Phenyllactic acid and 4-hydroxy-phenyllactic acid from L. plantarum 21B have antifungal activity against several species of filamentous fungi (Lavermicocca et al. (2000). Phenyllactic acid has also been identified from culture supernatants of L. plantarum MiLAB 393, L. coryniformis strain Si3, and strains of Pediococcus pentosaceus and L. sakei. Phenyllactic acid is only active against yeasts and moulds. However, this metabolite certainly contributes to the overall antifungal effect in synergy with other compounds produced by LAB. Cyclic dipeptides and other low-molecular-mass inhibitory compounds: New types of antimicrobial compounds from the culture filtrate of L. plantarum VTT E-78076 was found (Niku-Paavola et al. (1999) . The active fraction include benzoic acid, 5-methyl-2,4-imidazolidinedione (methylhydantoine), tetrahydro-4-hydroxy-4-methyl-2H-pyran-2- one (mevalonolactone), and cyclo(glycyl-L-leucyl). Two cyclic dipeptides are cyclo (Phe-Pro) and cyclo (Phe-OH-Pro) in the supernatant of L. plantarum MiLAB 393. The antimicrobial effect of several different cyclic dipeptides has been found that cyclo(Phe-Pro) and cyclo(Phe-OH-Pro) are also produced by strains of P. pentosaceus, L. sakei and L. coryniformis and thus might be common LAB metabolites. Phenolic compounds: This phenolic compound produced by P. acidilactici LAB 5 and showed varying degrees of antifungal activity against a number of foods and plant pathogenic fungi. Hydroxy fatty acids: Some LAB can produce antimicrobial fatty acids that improve the sensory quality of fermented products. Caproic acid isolated from Lb. sanfrancisco CB1 is a potent antifungal substance produced by this strain. This compound can act in synergy with other acids such as propionic, butyric and valeric acids. Among these fatty acids, the most active is shown to possess a 12-carbon atom chain length. Hydroxylated fatty acid compounds present a very broad inhibition spectrum and are efficient against moulds and yeasts. The minimum inhibitory concentration (MIC) of hydroxylated fatty acids ranges between 10 and 100 Вµg/ml (SjГ¶gren et al., 2003). Reference: Heng, N. C. K. and Tagg, J. R. (2006). What is in a name? Class distinction for bacteriocins. Nature Reviews Microbiology, 4. doi:10.1038/nrmicro1273-c1. Correspondence (February 2006). El-Ziney, M. (1998). Antimicrobial activity of lactic acid bacteria metabolites: The role of lactic acid enterocin 5701 and reuterin. Ph.D. Thesis, University of Gent (pp. 3вЂ“ 23). SjГ¶gren, J., Magnusson, J., Broberg, A., SchnГјrer, J. and kenne, L. (2003). Antifungal 3 - hydroxyl fatty acids from Lactobacillus plantarum MiLAB14. Applied and Environmental Microbiology, 69, 7554вЂ“7557. Meisel, H. and Bocklmann W. (1999). Bioactive pepitdes encrypted in milk proteins; proteolytic activation and throphofuntional properties. Antonie van Leeuwenhoek, 76: 207-215. Magnusson, J., StrГ¶m, K., Roos, S., SjГ¶gren, J. and SchnГјrer, J. (2003). Broad and complex antifungal activity among environmental isolates of lactic acid bacteria. FEMS Microbiology Letters, 219, 129вЂ“135. Lavermicocca, P., Valerio, F. and Visconti, A. (2003). Antifungal activity of phenyllactic acid against molds isolated from bakery products. Applied and Environmental Microbiology, 69, 634вЂ“640. Niku-Paavola, M. L., Laitila, A., Mattila-Sandholm, T. and Haikara, A. (1999). New types of antimicrobial compound produced by Lactobacillus plantarum. Journal of Applied Microbiology, 86, 29вЂ“35. Condon, S. (1987). Responses of lactic acid bacteria to oxygen. FEMS Microbiology Reviews, 46, 269вЂ“280. Jay, J.M. 1982. Antimicrobial properties of diacetyl. Applied and Environmental Microbiology, 44, 525вЂ“ 532. 116 Microbiological Risk Assessment: A New Concept to Ensure Food Safety Microbiological Risk Assessment: A New Concept to Ensure Food Safety Naresh Kumar and Raghu H. V. Dairy Microbiology Division, NDRI, Karnal The significance of milk in human nutrition in now well established as it is considered as the best, ideal and complete food for all age groups. Milk can also serve not only as a potential vehicle for transmission of some pathogens but also allows these organisms to grow, multiply and produce toxins. A variety of pathogenic organisms may gain access in milk and milk products from different sources and cause different types of food born illnesses which includes food infection, intoxication and toxio-infection (Aneja et al., 2002). Recent development regarding Quality and safety management systems such as ISO and Hazard Analysis Critical Control Point (HACCP) has reduced such incidences. The safety of milk and milk products has been extensively reviewed by regulatory agencies in India and internationally. A large number of risk assessments and risk profiles have been undertaken, examining the risks across the entire dairy supply chain and conducting in-depth evaluations of specific pathogen-product combinations. This risk assessment will summarize the major body of relevant work undertaken to date. Evolution of food safety systems: When it was accepted that people can contract disease from contaminated food, hygiene control laws were introduced and examples can be seen in old legal records. Table 1 gives an overview of the more important milestones in developing food safety systems. In the absence of knowledge about the causes of serious foodborne diseases and their etiology, use was made of the вЂ�prohibitionвЂ™ principle. This means that it was prohibited to produce and/or to consume certain type of food after it was realized that the foods could be a cause of high mortality. The principle was used particularly to protect special groups of individuals within society, such as soldiers. After the recognition at the end of the nineteenth century that microbial agents were often responsible for foodborne illness, systems for controlling the safety of the food supply began to be introduced. First, use was made of microbiological testing of foods and this became widely accepted as a means of assessing food safety during the early part of the twentieth century. Eventually, statutory microbiological requirements relating to food safety were established in many parts of the world. Further progress occurred when Esty and Meyer (1922) developed the concept of setting process performance criteria for heat treatment of low-acid canned food products to reduce the risk of botulism. Later, many other foods processed in this way were controlled in the same manner. An outstanding example is the work of Enright et al. (1956, 1957) who established performance criteria for the pasteurization of milk that provided an appropriate level of protection against Coxiella burnetii, the causative agent of Q fever. Studies for tuberculosis have been carried out earlier. The work is an early example of the use of risk assessment principles in deriving process criteria. The ability of different bacteria to multiply in foods is influenced by several key factors, including pH, water activity and storage temperature. The effects of these factors, both singly and in combination, have been studied extensively in laboratory media and model food systems, and this has led to the development of mathematical models for predicting bacterial growth in commercial food products. Although not a food safety system on its own, predictive modelling is a valuable tool, which has helped to make possible the introduction of QRA. The latter has been used for many years in other disciplines and its use in food microbiology has been stimulated by the decision of the World Trade Organisation (WTO) to promote free trade in safe food (Anon, 1995). It has been emphasized, however, that control of food safety in this context must be based on the application of sound scientific principles, and risk analysis is seen as the basis for ensuring that the requirement is met. Setting public health goals вЂ“ The concept of Appropriate Level of Protection (ALOP): During the past decade, there has been increased interest and effort in developing tools to more effectively link 117 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance the requirements of food safety programs with their expected public health impact. This document introduces two such tools, the "Food Safety Objective" (FSO) and the вЂњPerformance ObjectiveвЂќ (PO). These can be used to communicate food safety Severity Description requirements to industry, trade partners, consumers and other countries. Good practices and HACCP Moderate Not usually life threatening; no sequelae; normally short duration; remain essential food safety management systems to symptoms are self-limiting; can be achieve FSOs or POs. Setting goals for public health severe discomfort are the right and responsibility of governments. Incapacitating but not life These goals may specify the maximum number Serious threatening; sequelae infrequent; of harmful bacteria that may be present in a food. moderate duration Where possible, the determination of this number Severe Life threatening, or substantial should be based on scientific and societal factors. sequelae, or long duration The level of risk can be expressed in a qualitative way (e.g., high, medium or low risk), or when possible, as the number of cases of foodborne disease per number of people per year. The ICMSF ranking scheme categorizes hazards by the severity of the threat they pose to human health, taking into consideration the: likely duration of illness; likelihood of death; and potential for ongoing adverse health effects. The severity of adverse health effects caused by a hazard is ranked as moderate, serious or severe according to the following definitions: Under the ICMSF ranking, severe hazards are further divided into those applying to the general popu-lation and those applying to specific sub-populations, that is, susceptible individuals (for example, the very young and old, the immunocompromised, and pregnant women and their unborn children). This takes into account those situations where a hazard considered to be of moderate or serious to the general population may cause a severe illness in certain susceptible sub-populations. The estimates of the risk level have to be based on clinical information available (e.g., how many stool samples have been found to contain salmonellae) in combination with results from microbiological surveys of foods, evaluations of the types of foods that are produced, how they are produced and how they are stored, prepared and used. A few countries may use scientific techniques such as Quantitative Microbiological Risk Assessment (QMRA) to estimate the risk of illnesses using detailed knowledge of the relationship between the number of microorganisms in foods and the occurrence of foodborne diseases. Whatever method is used to estimate the risk of foodborne illness, the next step is to decide whether this risk can be tolerated or needs to be reduced. The level of risk a society is willing to accept is referred to as the "Appropriate Level Of Protection" (ALOP). Importing countries with more strict requirements for a particular hazard (e.g., harmful bacteria) may be asked to determine a value for the ALOP according to the SPS agreement. When a country is willing to accept the current risk of illnesses, that level is the ALOP. However, most countries will wish to lower the incidence of foodborne disease and may set targets for future ALOPs. For instance, the current level of listeriosis could be 6 per million people per year and a country may wish to reduce this to 3 per million people per year. A Food Safety Objective (FSO): When a government expresses public health goals relative to the incidence of disease, this does not provide food processors, producers, handlers, retailers or trade partners with information about what they need to do to reach this lower level of illness. To be meaningful, the targets for food safety set by governments need to be translated into parameters that can be assessed by governmentвЂ™s agencies and used by food producers to process foods. The concepts of food safety objectives (FSOs) and performence objectives (POs) have been proposed to serve this purpose. The position of these concepts appearing in the food chain can be seen in Figure 1. An FSO is вЂњThe maximum frequency and/or concentration of a hazard in a food at the time of consumption that provides or contributes to the ap-propriate level of protection (ALOP)вЂќ It transforms a public health goal to a concentration and/ or fre-quency (level) of a hazard in a food. The FSO sets a target for the food chain to reach, but does not specify how the target is to be achieved. Hence, the FSO gives flexibility to the food chain to use 118 Microbiological Risk Assessment: A New Concept to Ensure Food Safety dif-ferent operations and processing techniques that best suit their situation, as long as the maximum hazard level specified at consumption is not exceeded. FSO and Product/pathogen/Pathway Analysis: The ICMSF has introduced a simple equation that summarises the fate of a hazard along the food chain as follows: Ho - SR + SI = FSO Where: FSO = Food Safety Objective Ho = Initial level of the hazard SR = the cumulative (total) decrease in level SI = the cumulative (total) increase in level в‰¤ = preferably less than, but at least equal to FSO, Ho, R, and I are expressed in log10 units I (increase) is determined by growth (G) as well as by recontamination (RC). Since the FSO is the level of a hazard at the moment of consumption, another term is needed to describe the level at another point in the food chain. The term Performance Criterion has been proposed by the ICMSF, but this term is also used to describe the outcome of a processing step (for example a 6 decimal reduction of a pathogen). For this reason the term Performance Standard is used in this document to reflect the level of a hazard and Performance Criterion to describe the impact of a process on the level of a hazard. As a consequence of this, the following equation is proposed: Where: FSO = Food Safety Objective PS = Performance Standard Ho = Initial level of the hazard SR = the cumulative (total) decrease of the hazard SIRC = the cumulative (total) recontamination with the hazard SI G = the cumulative (total) growth of the hazard в‰¤ = preferably less than, but at least equal to Note that the PS of one point of the food chain may be the Ho of the following one. This equation is helpful to determine the effect of control measures necessary to meet a FSO. It is im-portant to recognise that data used in PPP analyses that can be used to determine the various values of Ho, R, IRC, IG and PS, may differ according to their source and use. A Performance Objective (PO): For some food hazards, the FSO is likely to be very low, sometimes referred to as "absent in a serving of food at the time of consumption". For a processor that makes ingredients or foods that require cooking prior to consumption, this level may be very difficult to use as a guideline in the factory. Therefore, it is often required to set a level that must be met at earlier steps in the food chain. This level is called a performance objective (PO). A PO may be obtained from an FSO, as will be explained below, but this is not necessarily always the case. Foods that need to be 119 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance cooked before consumption may contain harmful bacteria that can contaminate other foods in a kitchen. Reducing the likelihood of cross-contamination from these products could be important in achieving a public health goal. The level of contamination that should not be exceeded in such a situation is a PO. For example, raw chicken may be contaminated with Salmonella. Although thorough cooking will make the chicken safe (absence of Salmonella in a serving), the raw chicken may contaminate other foods during preparation of a meal. A PO of вЂњno more than a specified percentage of raw chicken carcasses may contain SalmonellaвЂќ may reduce the likelihood that Salmonella will contaminate other foods. In products, such as ready-to-eat foods, the POs can be calculated from the FSO by subtracting expected bacterial contamination and/or growth between the two points. Process performance criteria for heat pasteurisation of milk: The work of Enright et al. (1957) led to the development of process standards for controlling Cox. burnetii in milk. The heat treatments used initially for milk were designed to inactivate any tubercle bacilli present and these were considered to be the most heat-resistant of the nonsporing pathogenic bacteria likely to occur in the product. The treatments were based on information from many studies on the heat-resistance of both human and bovine strains (Mycobacterium tuberculosis and Myc. bovis respectively). In the USA, the heating regime adopted in 1924 for the conventional process was 142В°F (61.1В°C) - 145В°F (62.8В°C) for 30 min. In 1933 a heating regime was introduced for the High-Temperature, Short-Time (HTST) process: 161В°F (71.7В°C) for 15 s. In practice, Cox. burnetii appears to be slightly more heat-resistant than the tubercle bacilli and, following recognition that the organism, which causes Q fever in man, could be transmitted by raw milk, it was necessary to check on the adequacy of existing pasteurisation processes for inactivating the organism. The work undertaken by Enright and colleagues (1956, 1957) fulfilled this requirement and, although no formal MRA was employed, elements of the MRA approach were implicit in their studies. These aspects are discussed below. Meeting the FSO: Since the FSO is the maximum level of a hazard at the point of consumption, this level will frequently be very low. Because of this, measuring this level is impossible in most cases. Compliance with POs set at earlier steps in the food chain can sometimes be checked by microbi-ological testing. However, in most cases, validation of control measures, verification of the results of monitoring critical control points, as well as auditing good practices Figure 1. Model food chain indicating the position of a and HACCP systems, will provide the reliable food safety objective and derived performance objectives evidence that POs and thus the FSO will be met. Microbiological criteria can be derived from FSOs and POs, if such levels are available. If such levels are not stated, microbiological criteria can be developing, if appropriate. The ICMSF (2002) has provided guidance on the establishment of microbiological criteria. Risk assessment & HACCP: The relation between Risk assessment and Hazard analysis and critical control point (HACCP) system has been the source of much confusion. HACCP is the food safety management tool applied in a production, processing, used to continuously control hazards and thus, to reduce risks. Control measures are put into place at critical control points in the 120 Figure 2. FSOs and POs are means of communicating public health goals to be met by food processors by good practices and HACCP. Also, industry can set POs to ensure that FSOs are met. Microbiological Risk Assessment: A New Concept to Ensure Food Safety production process to prevent or eliminate a food safety hazard or reduce it to an acceptable level. Risk assessment, on the other hand, is scientific processes of compiling and analysing information objectively, systematically and transparently estimate risk. A HACCP study is done for a particular product on a particular process line, sold and used under a specific set of conditions. It is some times thought that Risk Assessment is a part of a HACCP study, may be because the first activity in HACCP is Called вЂњHazards AnalysisвЂќ. In HACCP this includes identifying potential hazards and determining which are significant, i.e. those that need to be controlled. In Risk Assessment the first activity is calledвЂќHazard identificationвЂќ. This is one of the reasons for confusion. Coxiella burnetii is a small, Gram-negative bacterium, originally classified as a rickettsia that cannot be grown in axenic culture but can now be cultivated in vitro in various cell lines (Maurin and Raoult, 1999). Q fever is characterised by fever, chills and muscle pain, with occasional long-term complications. It was first described by Derrick (1937). And is known to occur worldwide. The organism infects many wild and domestic animals, which often remain asymptomatic. Domestic animals, such as cattle, sheep and goats, are considered the main sources of infection for humans (Maurin and Raoult, 1999) and, when shed in milk, Coxiella burnetii is often present in relatively high numbers. Contact with infected animals was known to result in transmission of Coxiella burnetii to man, with subsequent development of illness, and the likelihood of the organism contaminating raw milk was recognised. Early on, there was a lack of epidemiological evidence for transmission via milk, but this was suspected in several outbreaks and there was strong supporting evidence from a UK outbreak in 1967 (Brown et al. 1968). Thus, the hazard was the presence of Coxiella burnetii in milk intended for human consumption. To determine the significance of potential hazards, the HACCP study team assesses the probability of contamination, survival and growth of the pathogen in the food during and after processing, as well as in the production environment. This part of the HACCP study is similar to the product pathogen pathway analysis that is used in risk assessment; however, the aim and output are different. In HACCP, it is done to introduce control measures at critical control point to prevent, eliminate or reduce hazards. In risk assessment, it is done to assess exposure. In HACCP, the input is product and population line specific. After implementation of HACCP plan, a вЂњresidualвЂќ level of a hazard can remain and this is the input for exposure assessment in risk assessment. A full risk assessment as defined by the Codex can be useful when acceptable level (or Food Safety Objectives) have not been established, and when dealing with a production line that does not reduce pathogens (i.e. when HACCP is not fully effective). The risk assessor may estimate the effectiveness of changes in control measures or the introduction of new control measures in terms of reduction of estimated illnesses. The result of such a risk assessment might help the HACCP-team to determine CCPs or the critical limits at CCPs. This limited form of Risk Assessment could better be called Safety Assessment, and can be used as a tool for product and process development. This approach is not normally taken in industrial settings. CCPs and critical limits are determined on the basis of previous experience. Such experience includes both incidents that initiated corrective actions and the safety record for the particular product and processing line. For new products, the experiences with similar products, or challenge and storage tests, are used. Hazard analysis and critical control point (HACCP) technique is the foremost system for the control of microbiological hazards in food. The first phase of both MRA and HACCP is the identification of Hazard. Consequently, there is potential confusion between the two concepts. However, HACCP is really a risk management system, thus the role of MRA is to provide the information that HACCP system developers need to make more informed decisions on. In addition to enhancing the hazard identification phase of HACCP, Risk Assessment can be used to help identify critical control points (CCPs), establish the critical limits, and determine the extent of hazard associated with a product during periods of CCP deviation (ICMSF, 1998). Microbiological Risk Profile: Risk analysis (RA) and its component parts (risk assessment, risk 121 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance management and risk communication) should be used as a tool in evaluating and controlling microbiological hazards. A risk-management based approach is required to develop recommendations to ensure consumer protection and facilitate fair practices in the food trade. This structured approach may employ microbiological risk assessment and may utilize a spectrum of risk communication products including guidance documents, codes of hygiene practice, food safety objectives (FSO) and microbiological criteria (CCFH, 2004). Principle of Risk assessment described by Codex Alimentarius Commission: Protocol for Risk assessment originally developed to manage chemical hazards. Principle of microbiological Risk Assessment as described by Codex Alimentarius and the FAO/WHO report on Risk management. According to the principle the risk manager who selects the hazards (Figure 3), while the risk assessor describes the behavior and other important characteristics of the selected hazards. Subsequently, the risk assessor determines the level of exposure to the hazard either by analyzing products or by describing the complete route from the raw materials, transport, processing, and storage to consumption. This is called a Dynamic Flow Tree model, process risk Model, Pathogen вЂ“Product Pathway or Farm-to Fork-Model. It allows to estimate the various levels of hazards in various situations/circumstances and the probability that the population is exposed to them. Finally risk assessor combine the exposure data with data on the dose response relationship and severity of the effects, in a final risk estimate the probability and the severity of the illness due to a particular pathogen in a particular food, in a specific group of consumers. Some general guidelines used to manage pathogens in foods have been described by ICMSF (2002), indicating the respective roles of industry and government. A series of steps is described, including: a) analysis of epidemiological data which may give rise to concern for public health or a need for im-proved controls; b) risk evaluation by an expert panel or through quantitative risk assessment; c) es-tablishment of a FSO when necessary; d) assessing whether the FSO is technologically achievable through preliminary process and/or product formulation criteria; and e) if the FSO is achievable, establishment of process/product requirements. An explicit description of an ALOP may be in terms of the probability of an adverse public health consequence or the incidence of disease (e.g. the number of cases per 100,000 populations per year). Translation of an ALOP into a Food Safety Objective (FSO), expressed in terms of the required level of hazard control in food, provides a measurable target for producers, manufacturers and control au-thorities. An FSO is defined as вЂњthe maximum frequency and/or concentration of a microbiological hazard in a food at the time of consumption that provides an appropriate level of protectionвЂќ (ICMSF, 2002). An alternative definition of an FSO might be a limit to the prevalence and the average concen-tration of a microbial hazard in food, at an appropriate step in the food chain at or near the point of consumption that provides the appropriate level of protection (Havelaar et al., 2004). The assessment of risks to public health and safety from microbiological hazards in milk and milk products has been undertaken in the form of a Microbiological Risk Profile. It provides a broad overview of risks asso-ciated with consumption of dairy products. The risk profile identifies key food safety hazards and as-sesses where in the primary Figure. 3 Principle of Risk assessment described by production and processing supply chain these Codex Alimentarius Commission hazards might be introduced, increased, reduced or eliminated. The WTO/SPS agreement (WHO, 1997) describes the rules for the international trade in safe food 122 Microbiological Risk Assessment: A New Concept to Ensure Food Safety and has introduced the term "appropriate level of protection" (ALOP) to express what is mentioned in the first bullet point above. This ALOP has also been called "acceptable level of risk". This term is similar to the expression "tolerable level of risk" (TLR) preferred by the ICMSF, because it recognises that risks related to the consumption of food are seldom accepted, but at best tolerated. Also implied is that for a number of food safety hazards, вЂњzero riskвЂќ does not exists and/or too costly (financial, societal) to achieve. Risk Characterization in Dairy Products: The risk involved in consuming raw milk could not be estimated because of the absence of dose response data. The data for the prevalence of contaminated milk, the maximum level of contamination and the fact that milk would have been consumed regularly by the majority of the population were probably implicit factors in an assumption that the risks associated with inadequate heat treatment were high. The studies of Enright et al. (1956, 1957) led to the conclusion that heating at вЂњ143В°F for 30 min was wholly inadequate to eliminate viable Coxiella burnetii from whole, raw milk, while heating at 145В°F ensures elimination of these organisms with a high level of confidenceвЂќ (Enright et al., 1957). This led to the adoption of the higher temperature for vat pasteurisation in the USA. The work on the HTST process indicated that the recommended standard of 161В°F for 15 s was sufficient for total elimination. In preparing the Dairy Risk Profile, previous risk assessments conducted by other scientific agencies were reviewed and evaluated in this document. There have been few assessments undertaken for dairy products, and typically they address specific pathogen: commodity pairs. This profile considers the entire dairy supply chain, including the wide range of milk and milk products. Dairy products likely to support the growth of pathogens and prone to contamination after pasteurization may be categorised as higher risk than other dairy products. Alternatively, dairy products that do not support the growth of pathogens, if correctly formulated, can be classified as low risk. The actual ranking of the dairy products is quite variable. Once a shelf-stable UHT product is opened, it may become contaminated and when subjected to temperature abuse it could become a high-risk food. In contrast, the low pH and low water activity of extra hard cheese means its will be very robust and unlikely to support the growth of any pathogen that adventitiously contaminates the surface. Dried milk powders and infant formulae are inherently stable products due to their low water activity, however these products may be prone to contamination, and upon reconstitution become higher risk, especially if improperly reconstituted and stored. Following criteria in food matrix may be considered while characterizing the risk: вЂў Intrinsic properties of the product (i. e. the impact of aw, pH, salt concentration, and their effect on the growth of contaminating microorganism) вЂў Extent to which food is exposed to factory environment or handling after heat treatment вЂў Hygiene and control during distribution and retail sale вЂў Degree of reheating or cooking before consumption (many dairy products are RTE, so this is rarely a factor). Attribution of Food-borne Illness to Dairy Products: While there is enhanced quantitative data on the incidence of illness due to specific pathogens, there is often not the ability or capacity to identify or distinguish specific food vehicles. The causative agent of an illness is usually determined through epidemiological studies, but confirming the identity of a key ingredient or the original source of product contamination, or critical factors contributing to their occurrence is problematic. This inability to attribute cases of food-borne illness to causal vehicles is a major issue internationally, and is especially difficult where illness is linked to foods with multiple ingredients. Critical in this process is the capacity to link epidemiological data to animal and food monitoring data. The development of public health interventions requires accurate data defining the source from which humans are acquiring pathogens and how specific foods contribute to the total burden of food-borne illness. However, outbreak data represents only a small component of actual cases of food-borne illness, as 123 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance many outbreaks go unrecognized. People do not always seek medical attention for mild forms of gastroenteritis, and not all food-borne illnesses require notification to health authorities. Dose response: There was no information on the dose response in humans, since challenge trials had not been carried out and epidemiological data were lacking in this respect. Exposure assessment: Information relevant to this step in MRA was obtained by injecting guinea pigs to determine the presence and titre of Coxiella burnetii in milk. The organism was found in 33% of 376 samples of raw milk from California, USA. вЂњThe maximum number of Coxiella burnetii demonstrated in the milk of an infected dairy cow was the number of organisms contained in 10,000 infective guinea pig doses of Coxiella burnetii per millilitreвЂќ (Enright et al., 1957). Similar titres were found in milk that had been frozen and thawed. However, the study did not involve testing of all breeds of dairy cattle, and it is possible that even higher levels of shedding may have occurred in some breeds that were not examined. Nevertheless, it was concluded that the maximum level of consumer exposure would be represented by the highest infective dose demonstrated in this study and that the pasteurisation process should bring about thermal inactivation of such a number (Enright et al., 1957). Risk Management Issues and Control Strategies for Dairy foods: The critical factors having the most significant impact on the safety of processed dairy products are as follows: вЂў The quality of raw materials вЂў Correct formulation вЂў Effective processing вЂў The prevention of recontamination of product вЂў Maintenance of temperature control through the dairy supply chain. Risk ranking of pathogen: Product L. Monocytogenes EHEC Campylobacter S. Aureus TBEV Dairy Normal Susceptible Pasteurized Milk Cheese Medium High low low low low Raw milk cheese Medium High high medium medium low While pathogenic microorganisms may contaminate raw milk supplies, pasteurization is a very effective Critical Control Point (CCP) in eliminating pathogens; good manufacturing practices must also be employed to ensure that post-pasteurization contamination does not occur. The effectiveness of pasteurization is dependent upon the microbiological status of the incoming raw milk. Control measures at the primary production level involve minimizing the likelihood of microbiological hazards contaminating the raw milk. This is achieved through the implementation of a food safety program incorporating good The relative risk from dairy products may also be expressed graphically as a agricultural practices continuum: (GAP). These measures are 124 Microbiological Risk Assessment: A New Concept to Ensure Food Safety effective in reducing the microbial load of milk being sent for processing. However, should microbial contamination of raw milk occur, it is critical that milk is stored at a temperature that minimizes the opportunity for the bacteria to multiply. Temperature abuse of the milk may allow growth of pathogenic bacteria to the extent where the pasteurization process may not eliminate all pathogenic bacteria and/or toxins. The Aflatoxins can be formed and ingested by dairy cattle during feeding, eventually contaminating the milk. Aflatoxin contamination of milk is more common where intensive supplementary feeding of dairy herds is conducted. Concluding Remarks: FSOs and POs are new concepts that have been introduced to further assist government and industry in communicating and complying with public health goals. These tools are additional to the existing programmes of GAPs, GHPs and HACCP which are the means by which the levels of POs and FSOs will be met. Hence FSOs and POs build on, rather than replace, existing food safety practices and concepts. References: Aneja, R. P., B. N. Mathur, R. C. Chandan, A. K. Banerjee, 2002. Technology of Indian Milk Products. A Dairy India Publication, Delhi. Brown G L, Colwell D C and Hooper, W L, вЂ�An outbreak of Q fever in Staffordshire. Journal of Hygiene, Cambridge 1968 66 649-655. Codex Committee on Food Hygiene (CCFH, CX/FH 04/5/6), 2004. Proposed draft process by which the committee on food hygiene could undertake its work in microbiological risk assess-ment/risk management, Alinorm 04/27/13. Derrick E H, вЂ�вЂќQвЂќ fever, A new fever entity: Clinical features, diagnosis, and laboratory investi-gation. Med J Australia, 1937 2 281-299 Enright, J. B., Sadler, W. W. and Thomas, R. C. вЂ�Thermal inactivation of Coxiella burnetii and its relation to pasteurisation of milkвЂ™, Public Health Service Publication No. 517. United States Gov-ernment Printing Office, Washington, D C, 1957 Enright, J. B., Sadler, W. W. and Thomas, R. C. вЂ�Observations on the thermal inactivation of the organism of Q fever in milkвЂ™, J Milk Food Technol, 1956 10 313-318. Havelaar, A. H., Nauta, M. J., Jansen, J. T., 2004. Fine-tuning food safety objectives and risk as-sessment. International Journal of Food Microbiology 93, 11вЂ“29 ICMSF, 1998, Principles for the establishment of microbiological food safety objectives and related control measures. Food Control 9, 379-384. ICMSF, 2002. Microorganisms in Foods 7. Microbiological testing in food safety management. Kluwer Academic / Plenum Publishers, New York, USA. Jansson, E., Moir, C., Richardson, K., 1999. Final Report Review of Food Safety Systems devel-oped by the NSW Dairy Corporation. Food Science Australia Report. Maurin M and Raoult D, вЂ�Q FeverвЂ™. Clinical Microbiology Reviews, 1999 12 518-553. WHO, 1997. Food Safety and Globalization of Trade in Food, a challenge to the public health sector. WHO/FSF/ FOS/97.8 Rev. 1, WHO, Geneva. Zottola, E.A., Smith, L.B., 1991. Pathogens in cheese. Food Microbiology 8, 171-182. 125 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria R. K. Malik and Gurpreet Kaur Dairy Microbiology Division, NDRI, Karnal In spite of modern advances in technology, the preservation of foods is still a debated issue, not only for developing countries (where implementation of food preservation technologies are clearly needed) but also for the industrialized world. Amelioration of economic losses due to food spoilage, lowering the food processing costs and avoiding transmission of microbial pathogens through the food chain while satisfying the growing consumers demands for foods that are ready to eat, freshtasting, nutrient and vitamin rich, and minimally-processed and preserved, are major challenges for the food industry. The extent of microbiological problems in food safety was clearly reflected in the WHO food strategic planning meeting (WHO, 2002): вЂў The emergence of new pathogens and pathogens not previously associated with food consumption is a major concern; вЂў Microorganisms have the ability to adapt and change, and changing modes of food production, preservation and packaging have, therefore, resulted in altered food safety hazards. The consumers in the developed world often question the safety of the thousands of non-food preservatives and other additives that are incorporated in food. It has also encouraged them to voice their feelings against the use of these chemicals in foods and also to look for foods that are вЂњnaturalвЂќ, вЂњhealthyвЂќ and not treated with harsh contaminants. At the same time they are also concerned about the loss of nutritional value of the вЂњharshly processed foodsвЂќ and the possible health risks of food preserved with chemicals. The empirical use of microorganisms and/or their natural products for the preservation of foods (biopreservation) has been a common practice in the history of mankind (Ross et al., 2002). Food fermentations have a great economic value and it has been accepted that these products contribute in improving human health. Lactic Acid Bacteria (LAB) have contributed in the increased volume of fermented foods world wide especially in foods containing probiotics or health promoting bacteria. Potential risk from psychrotrophic pathogenic and spoilage organisms Until relatively recently it was assumed that refrigeration at or below 4oC was sufficient to prevent the growth of infectious and toxigenic food borne organisms. However, this assumption has changed with the reports that several food borne pathogens are psychotrophs e.g. Listeria monocytogenes, Yesinia enterocolitica, Aeromonas hydrophila, some enterotoxigenic E. coli and Clostridium botulinum B & E. Moreover, it has been often observed that during distribution and before consumption of refrigerated foods, some temperature abuse may occur which may permit conditions for the growth of several other pathogens that can grow at 5 and 12oC. (Del Giudice, 1991; Snyder et al., 1991). Long storage of refrigerated foods, even at low temperatures will allow the psychrotrophic and spoilage microorganisms to multiply and reach a high level even from a very low initial population. Safety concerns of the chemical preservatives The consumersвЂ™ preference for the refrigerated foods that do not contain any preservative(s) is based on their perception of these foods to be nutritious, healthy and closed to natural as opposed to harshly processed and chemically preserved foods. This is because the safety of some preservatives as well as some other additives has been questionable such as NO2, sulphides, sodium diacetate, beta propiolactones and therapeutic antibiotics. Reports on possible health hazard from the consumption of some preservatives and other additives currently being used such as nitrite and saccharine, and additives previously used but currently not been permitted for use such as cyclomate and some dyes have shaken the faith of consumers, thus prompting them to question the safety and wholesomeness 126 Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria of food they eat. Antimicrobial chemical preservatives inhibit or retard the growth of spoilage and pathogenic microorganisms and are used to enhance the safety and shelf life of foods. They produce their antimicrobial effect by interfering with the structural and functional components of microorganisms. Their effectiveness is dependant on the type of chemical, the concentration of chemicals used, the microorganism present, the type of microorganisms and their physiological state (vegetative cell or spore), the composition and pH of food, and the temperature and duration of storage. Moreover, in recent years the chemicals used in food items have increased exponentially to several thousands. The effect of actual consumption of these chemicals in multiple products over substantial length of time should be an important consideration in judging their safety. Therefore, the basis of selection of antimicrobial biopreservatives to be used in foods should not only be their effectiveness against both Gram positive and Gram negative pathogens and spoilage organisms and other desired characteristics of preservatives but also their proven safety records and their acceptance by the health conscious consumers and health regulatory agencies. Among the compounds that have generated considerable interest in the recent years are several antimicrobial metabolites of lactic acid bacteria used to produce, or associated with, fermented foods. Lactic acid bacteria Lactic acid bacteria belong to a group of Gram-positive anaerobic bacteria that excrete lactic acid as their main fermentation product into the culture medium. LAB were among the first organisms to be used in food manufacturing. Today LAB play crucial role in the manufacturing of fermented milk products, vegetables and meat, as well as in the processing of other products such as wine. Lactic acid bacteria which include the genera Lactococcus, Streptococcus, Lactobacillus, Pediococcus, Leuconostoc, and Carnobacterium (Nettles and Barefoot, 1993), play an essential role in food fermentations. The most important contribution of these microorganisms to the product is to preserve the nutritive qualities of Fig.1 Production of various metabolites by a lactic culture including acid, H2O2, diacetyl and bacteriocin the raw material through an extended shelf life and the inhibition of spoilage and pathogenic bacteria. This is due to competition for nutrients and the presence of inhibitors produced by the starter. The Lactic Acid Bacteria produce an array of antimicrobial substances (such as organic acids, diacetyl, acetoin, hydrogen peroxide, reuterin, reutericyclin, antifungal peptides, and bacteriocins (Holzapfel et al., 1995; El-Ziney et al., 2000; Holtzel et al., 2000; Magnusson and SchnГјrer, 2001). Bacteriocins of lactic acid bacteria There are several examples of the inhibition of spoilage and pathogenic bacteria by LAB. Extensive investigations, over the last few decades, into the antagonistic behaviour of such strains have led to the identification and characterization of numerous bacteriocins produced by LAB (Jack et al, 1995; 127 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Nettles and Barefoot, 1993; Klaenhammer, 1993). Such investigations have led to the discovery of a range of different bacteriocin-producing strains, many of which have potential in food applications. Given the ease with which bacteriocin-producing strains can be isolated from food sources, it is clear that many of these bacteriocins have been safely consumed for decades and thus it could be argued that reintroduction of such cultures should have negligible associated safety or toxicological problems when consumed (Kelly et al., 1996). Bacteriocin could be highly advantageous as even in small amount; these peptides are sufficient to kill or inhibit bacteria competing for the same ecological niche or the same nutrient food. Bacteriocins produced by bacteria can be defined as biologically active protein and protein complex (protein aggregates), lipo-carbohydrate proteins, glycoproteins, etc displaying a bactericidal mode of action exclusively towards Gram positive bacteria and particularly against closely related species. They form a heterogenous group with respect to producing bacterial species, molecular size, physical and chemical properties, stability, anti microbial spectrum and mode of action, etc. The bacteriocins produced by LAB are of particular interest to the food industry (Nettles and barefoot, 1993), since these bacteria have generally been regarded as safe (GRAS status). Moreover, majority of bacteriocin producing LAB are natural food isolates, they are ideally suited for food preservation. The production of bacteriocins by LAB is not only advantageous to the bacteria themselves but could also be exploited by the food industry as a tool to control undesirable bacteria in a food grade and natural manner, which is likely to be more acceptable to consumers. Bacteriocins are antimicrobial peptides or small proteins which inhibit, by a bactericidal or bacteriostatic mode of action, micro-organisms that are usually closely related to the producer strain (De Vuyst and Vandamme 1994; Schillinger and Holzapfel 1996). A bacteriocin producer protects itself against its own antimicrobial compound by means of a system referred to as immunity, which is expressed concomitantly with the antimicrobial peptide (Nes et al., 1996). The bacteriocin family includes a diverse group of proteins in terms of size, microbial targets, modes of action, and immunity mechanisms. The bacteriocins produced by LAB offer several desirable properties that make them suitable for food preservation: Inhibitory spectrum of bacteriocins of lactic acid bacteria In the original definition of Jacob et al (1953), bacteriocins were characterized by predominate intra species killing activity. While this is true for most of the bacteriocins of LAB especially those produced by a large number of lactococci and lactobacilli, others have been found to exhibit a broad range of inhibitory activity extending across numerous Gram positive bacteria. Thus Klaenhammer (1998) defined two types of bacteriocins of lactic acid bacteria; one type exhibiting a classical bacteriocin antibacterial spectrum affecting only closely related bacteria and the second type effective against a wide range of Gram positive bacteria. Inhibition of Gram negative bacteria in their native state has not been reported for any of the purified and thoroughly characterized bacteriocins. Similarly, inhibition of yeast and molds has not been observed. Classification of bacteriocins of lactic acid bacteria Most LAB bacteriocins are small (< 6 kDa), cationic, heat-stable, amphiphilic, membranepermeabilizing peptides that may be divided into three main groups: the modified bacteriocins, known as lantibiotics (Class I), the heat-stable unmodified bacteriocins (Class II), and the larger heat-labile bacteriocins (Class III) as proposed by Klaenhammer (1993). A fourth group (Class IV) with complex bacteriocins carrying lipid or carbohydrate moieties is often included in bacteriocins classifications. Recently a fifth class of circular bacteriocins has been included in the classification scheme with lesser amount of modified amino acids (Table 2). 128 Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria Table 2. General classification of LAB Bacteriocins. a Category excluded from NesвЂ™ classification (Nes et al., 1996) but included in GarneauвЂ™s (Garneau et al., 2002) CLASS CHARACTERISTICS AND SUBCATEGORIES Class I. Lantibiotics Ribosomally synthesized peptides that undergo posttranslational modifications. Molecular weight 2вЂ“ 5 kDa. Contain lanthionine and ОІ-methyl lanthionine. Class II. NonlantibioticsвЂ” Unmodified Bacteriocins. Heat stable peptides formed exclusively by unmodified amino acids. Ribosomally synthesized as inactive pre peptides to get activated by posttranslational cleavage of the N- terminal leader peptide. Molecular weight < 10 kDa. Class III. NonlantibioticsвЂ”Large, Heat-labile Bacteriocins. Heat-labile proteins. Molecular weight >30 kDa. Class IVa Complex bacteriocins carrying lipid or carbohydrate moieties Class V Circular Bacteriocins Bacteriocins of LAB as potential food biopreservatives The term вЂњbiopreservativeвЂќ includes the antimicrobial compounds that are of plant, animal and microbial origin and have been used in human food for long time, without any adverse effect on human health. They are used to enhance safety and extend shelf life of food and can thus be regarded as вЂњbiopreservativesвЂќ. Fermented foods are good examples of biopreserved foods in which the starter cultures are allowed Fig 2. Influence of different factors on the efficacy of in situ bacteriocin to grow so that they can produce anti production for biopreservation. (Galvez et al., 2007) microbial metabolites. In fermentation the raw materials are converted by desirable microorganisms such as bacteria, yeast and molds to products that have acceptable qualities of food. In controlled fermentation, the starter cultures are added to the raw material in large number and then incubated under conditions to stimulate the growth and production of desirable products. An example of food produced by controlled fermentation is yoghurt in which Lactobacillus bulgaricus and Streptococcus thermophilus are added to achieve the fermentations. The lactic acid and other metabolites produced by these desirable bacteria in вЂ�SauerkrautвЂ™ and yoghurt prevent the growth of undesirable microorganisms present in the non sterile raw materials and make the products shelf stable. (Ray, 1992) Biopreservation by bacteriocins of LAB The small heat-stable bacteriocins of lactic acid bacteria have been recognized as perhaps the most promising entities for use in applications of food preservation for a number of reasons. They are widely distributed and established as food-grade bacteria and often have a suitable spectrum of bacterial targets, for example, strains of Listeria, Clostridium and other Gram-positive bacteria including LAB. Furthermore, these Bacteriocins can endure harsh treatments, such as boiling, without loosing much of their activity. Bacteriocins produced by lactic acid bacteria have received particular attention in recent years due to their potential application in the food industry as natural preservatives. This trend reflects the increasing consumer awareness of the risks derived not only from food borne pathogens, but also from the artificial chemical preservatives used to control them (Abee et al., 1994). Some bacteriocins have well established their action as potential antimicrobial and also their possible applications in food 129 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance preservation systems. Nisin A already showed effective inhibitory activity on the Listeria monocytogenes growth in cheese up to eight weeks. Enterocin, when inoculated in ham, pig meat, meat chicken, and sausage, showed inhibitory capacity on the L. monocytogenes growth. Lactocin also had inhibitory capacity on the same microorganism, when applied in ground meat (Vignolio et al., 1996; Davies, 1999; Aymerich et al., 2000). There are numerous applications of nisin as food preservative, including shelflife extension of dairy products, canned foods, vacuum-packed meat and cold smoke salmon (Hurst, 1981; Davies, 1999; Nilsson et al., 2000). Nisin presents almost all the desirable characters of a potential biopreservative like: 1. It is non toxic 2. It is natural and safe (produced by Lactococcus lactis having GRAS status) 3. Heat and storage stable 4. It can be degraded by digestive enzymes so pose no harmful side-effect to human 5. It does not confer any undesirable taste and flavor to foods and It show prominent antimicrobial spectrum against Gram-positive microorganisms (Kominsky, 1999; Fiorentini et al., 2001). The accumulation of studies carried out in recent years clearly indicate that the application of bacteriocins in food preservation can offer several benefits, still the use of food grade bacteriocins as biopreservative is in its infancy. Civilization has reaped the benefits of Bacteriocins unknowingly for 1000s of years, yet nisin is the only bacteriocin bio-preservative that has received acceptance in countries worldwide. Among the major bacteriocins apart from nisin, pediocin, acidocin, bavaracin, curavaticin, and sakacin, can be other alternatives though there is need to well characterize them with respect to their use in food preservation along with safety issues associated with them. Nisin is the single bacteriocin commercially used as natural agent of food conservation (biopreservation) and considered safe by World Health Organization (WHO) and has received the denomination of Generally Recognized as Safe (GRAS) and also by Food and Drug Administration (FDA). Nisin is produced by Lactococcus lactis subsp. lactis and is used in various countries (Abee et al., 1994). Dairy Products Nisin is used in pasteurized, processed cheese products to prevent outgrowth of spores such as those of Clostridium tyrobutyricum that may survive heat treatments as high as 85вЂ“105В°C. Use of nisin allows these products to be formulated with high moisture levels and low NaCl and phosphate contents, and also allows them to be stored outside chill cabinets without risk of spoilage. The level of nisin used depends on food composition, likely spore load, required shelf life and temperatures likely to be encountered during storage. (Hirsch et al., 1951). Nisin is also used to extend the shelf life of dairy desserts which cannot be fully sterilized without damaging appearance, taste or texture. Nisin can significantly increase the limited shelf life of such pasteurized products. Nisin is added to milk in the Middle East where shelf-life problems occur owing to the warm climate, the necessity to transport milk over long distances and poor refrigeration facilities. It can double the shelf life at chilled, ambient and elevated temperatures and prevent outgrowth of thermophilic heatresistant spores that can survive pasteurization. It can also be used in canned evaporated milk. Canned foods Nisin may also be added to canned foods at levels of 100вЂ“200 IU gвЂ“1 to control thermophilic sporeformers such as Bacillus stearothermophilus and Clostridium thermosaccharolyticum which may survive and grow in canned foods stored at high temperatures. It also allows a reduction in heat processing required without compromising food safety. It is used in canned potatoes, peas, mushrooms, soups, and cereal puddings. It increased activity at acid pH levels makes it ideally suitable in low pH foods such as canned tomatoes, to inhibit acid-tolerant spoilage flora such as B. macerans and C. pasteurianum. (Eckner, 1992). 130 Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria Meat Concern about the toxicological safety of nitrite used in cured meat has led to investigation into the use of nisin to allow a reduction in nitrite levels. However, uneconomically high levels are required to achieve good control of Clostridium botulinum, perhaps as a consequence of nisin binding to meat particles, uneven distribution, poor solubility in meat systems, or possibly interference in activity by meat phospholipids. (Nielson et al., 1990; Eckner, 1992). Cereals Little research has been conducted on the use of bacteriocins in cereal or cereal related products. Delves- Broughton (1996) discussed the use of bacteriocins in cereal puddings. Another possible use could be foreseen in pasta. Pasta dough is susceptible to contamination and growth of S. aureus. Bacteriocins, with their activity against Gram positive microbes, may be able to inhibitgrowth of this pathogen in the dough. (Eckner, 1992). Wine The insensitivity of yeasts to nisin allows its use to control spoilage lactic acid bacteria in beer or wine. It can maintain its activity during fermentation without any effect on growth and fermentative performance of brewing yeast strains and with no deleterious effect on taste. It can therefore be used to reduce pasteurization regimens and to increase shelf life of beers. It has similar applications in wine except for those that require a desirable malolactic fermentation. However, nisin-resistant bacterial starter cultures such as resistant strains of Leuconostoc oenos, in conjunction with nisin, can be used to actually control the malolactic fermentation. Nisin may also be used to reduce the amount of sulphur dioxide used in winemaking to control bacterial spoilage. (Todorov et al., 2003). Pediocin-like bacteriocins Pediocin-like bacteriocins are members of the Class II bacteriocins, a group of bacteriocins in which there is considerable commercial interest. They are small, heat-resistant peptides that are not post-translationally modified to the same extent as the Class I bacteriocins, apart from the cleavage of a leader sequence from a double glycine site upon export of the bacteriocin from the cell, and the presence of disulphide bridges in some molecules. All of the pediocins share certain features,including a seven amino acid conserved region in the N-terminal of the active peptide (-Tyr-Gly-Asn-Gly-ValXaa-Cys-). Perhaps the best-known is pediocin PA-1, which is produced by Pediococcus acidilactici. A commercial formulation has been introduced under the trade name ALTA. Pediococci are important in the fermentation of vegetables and meat for both acid production and flavour development. The pediocin-like bacteriocins (which are also produced by genera other than the pediococci) are active against other lactic acid bacteria but are particularly effective against Listeria monocytogenes, a foodborne pathogen of increasing concern to the food industry. Listeria may be found in raw milk, dairy products, vegetables and meat products and can grow under conditions such as refrigeration temperatures (growth has been reported at temperatures as low as вЂ“1В°C), high salt concentrations (up to 10%), low pH (pH 5.0), and high temperatures (44В°C). Pediocin PA-1 has been observed to inhibit Listeria in dairy products such as cottage cheese, ice cream, and reconstituted dry milk. It has also been demonstrated as a biocontrol agent on meat systems. In situ production in dry fermented sausage inhibits L. monocytogenes throughout fermentation and drying, possibly owing to a combination of the reduction in pH and bacteriocin production. Pediococcus acidilactici is also used as a low-level inoculum in reduced-nitrite bacon to prevent the outgrowth of Clostridium botulinum spores and subsequent toxin production. Potential uses for other bacteriocins As more and more bacteriocin producers are being isolated and characterized, usually from food environments, the potential for their use increases. Lactobacillus plantarum produces plantaricins S and T in the Spanish-style green olive fermentation. Many traditional African foods are fermented by lactic acid bacteria before consumption. Naturally occurring bacteriocin131 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance producing strains in these products may have the potential to improve the quality and shelf life of other African fermented foods which are often plagued by problems such as inconsistent quality, hygienic risks and premature spoilage. Other bacteriocins which have been isolated from food environments include plantaricin F, from chilled processed channel catfish; acidocin B, produced by Lactobacillus acidophilus with a narrow spectrum of activity which includes Clostridum sporogenes and a narrow range of other lactobacilli; and salivaricin B, produced by Lactobacillus salivarus with a very broad host range including Listeria monocytogenes, Bacillus cereus, Brochothrix thermosphacta, Enterococcus faecalis and many lactobacilli, which may have a more widespread application. Another recently identified bacteriocin with a broad host range similar to that of nisin is lacticin 3147, produced by a strain of Lactococcus lactis. Since lacticin 3147 is also an effective inhibitor of many Gram-positive food pathogens and spoilage microorganisms, these starters may provide a very useful means of controlling the proliferation of undesirable microorganisms during Cheddar cheese manufacture. Microgard (Wesman Foods Inc., USA) is commercially produced from grade A skim milk fermented by a strain of Propionibacterium shermanii, and has a wide antimicrobial spectrum including some Gram-negative bacteria, yeasts and fungi. This product is added to 30% of the cottage cheese produced in the USA as an inhibitor against psychrotrophic spoilage bacteria. It is added to a variety of dairy products such as cottage cheese and yoghurt and a nondairy version is also available for use in meat and bakery goods. The inhibitory activity almost certainly depends primarily on the presence of propionic acid, but there has also been a role proposed for a bacteriocin-like protein produced during the fermentation. This use of milk fermented by a bacteriocin producer as an ingredient in milk-based foods may be a useful approach for introducing bacteriocins into foods at little cost. Bacteriocins and hurdle technology Hurdle technology refers to the manipulation of multiple factors (intrinsic and extrinsic) designed to prevent bacterial contamination or control growth and survival in food. A combination of preservation methods may work synergistically or at least provide greater protection than a single method alone, thus improving the safety and quality of a food. While in certain foods intrinsic properties such as high salt may provide adequate protection, the conscious addition of an extra hurdle(s) can ensure safety. (Leistner, 2000) The concept of hurdle technology began to apply in the food industry in a rational way after the observation that survival of microorganisms greatly decreased when they were confronted with multiple antimicrobial factors (Leistner, 1978; Leistner and Gorris, 1995; Leistner, 2000). Over 60 potential hurdles have been described to improve food stability and/or quality (Leistner, 1999). The application of bacteriocins as part of hurdle technology has received great attention in recent years (Chen and Hoover, 2003; Ross et al., 2003; Deegan et al., 2006), since bacteriocins can be used purposely in combination with selected hurdles in order to increase microbial inactivation (Fig 3). The combination of hurdles to be applied will depend greatly on the type of food and its microbial composition. This must be carefully considered, since different hurdles usually have different effects on the members of a microbial Fig 3. Application of bacteriocins as part of hurdle technology. community. 132 Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteria Antimicrobial packaging Bio-active packaging is a further potential application in which bacteriocins can be incorporated into packaging destined to be in contact with food. This system combines the preservation function of bacteriocins with conventional packaging materials, which protects the food from external contaminants. Spoilage of refrigerated foods usually begins with microbial growth on the surface, which reinforces the attractive use of bacteriocins being used in conjunction with packaging to improve food safety and improve shelf-life (Collins-Thompson & Hwang, 2000). Bio-active packaging can be prepared by directly immobilizing bacteriocin to the food packaging, or by addition of a sachet containing the bacteriocin into the packaged food, which will be released during storage of the food product. Studies investigating the effectiveness of bio-active cellulose- based packaging inserts and a vacuum packaging pouch made with polyethylene/polyamide to improve shelflife and safety aspects have proved promising. When considering bio-active packaging, the stability and the ability to retain activity while immobilised to the packaging film is of vital importance. While many LAB bacteriocins possess significant antimicrobial qualities that could greatly enhance the safety of a food, it may yet emerge that industrially they will be most frequently applied as a вЂ�finalhurdleвЂ™ in a food system where another hurdle(s) already exists to eliminate pathogens and spoilers that survive only in adventitious circumstances. Bacteriocin resistance among pathogens and food spoilage bacteria Although the use of bacteriocins for preservation is a novel approach to eliminating or controlling pathogens in food, the development of highly tolerant or resistant strains remains the main concern and decreases the efficiency of bacteriocins as biopreservatives. Resistant food-borne pathogens are posing a global problem which is further facilitated by international trade of raw and processed foods. In foods with a long shelf life, even a small number of these resistant cells can multiply to very high number and thus may lead to food-borne outbreaks and food spoilage. Future prospects A large number of bacteriocins from LAB have been characterized to date, and many different studies have indicated the potential usefulness of bacteriocins in food preservation. Bacteriocins are a diverse group of antimicrobial proteins/peptides, and, therefore, are expected to behave differently on different target bacteria and under different environmental conditions. Since the efficacy of bacteriocins in foods is dictated by environmental factors, there is a need to determine more precisely the most effective conditions for application of each particular bacteriocin. Bacteriocinogenic cells may also act as living factories in foods. The antimicrobial effects of bacteriocins and bacteriocinogenic cultures in food ecosystems must be understood in terms of microbial interactions. Among the food borne pathogens, knowledge of the characteristics of bacteriocin resistant variants and the conditions that prevent their emergence will help in determining the optimal conditions for application of bacteriocins in foods and minimize the incidence of resistance. References Abee T., Rombouts FM., Hugenholtz J., Guihard G., and Letellier L. 1994. Mode of action of nisin Z against Listeria monocytogenes Scott A grown at high and low temperatures. Applied Environmental Microbiology, 60, 1962-1968. Aymerich T., Garriga M., Ylla J., Vallier J., Monfort JM., and Hugas M. 2000. Effect of sausage ingredients and additives on the production of enterocin A and B by Enterococcus faecium CT492. Optimization of in vitro production and anti-listerial effect in dry fermented sausages. Journal of Applied Microbiology, 88, 686-694. Chen H., and Hoover DG. 2003. Bacteriocins and their food applications. Comprehensive Reviews in Food Science and Food Safety, 2, 82вЂ“100. Collins-Thompson D., and Hwang CA. 2000. Packaging with antimicrobial properties. In Robinson RK., Batt CA.,and Patel PD. (eds.), Encyclopedia of food microbiology,. Academic press, London, UK, Pp. 416вЂ“420. Davies EA. 1999. Effective use of nisin to control lactic acid bacterial spoilage in vacuum-packed bologna-type sausage. Journal of Food Protection, 9, 1004-1010. Deegan LH., Cotter PD., Hill C., and Ross P., 2006. Bacteriocins: biological tools for bio-preservation and shelf-life extension. International Dairy Journal, 16, 1058вЂ“1071. Del Giudice, VJ. 1991. We must need the 21st century standards, Natl. Provisioner, 204 (6), 12 133 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Delves-Broughton, J., Blackburn, P., Evans, RJ. and Hugenholtz, J. 1996. Applications of the bacteriocin, nisin. Antonie Leeuwenhock, 69: 193-202. DeVuyst L. and Vandamme E. 1994. Bacteriocins of Lactic acid bacteria: microbiology, genetics and application. Chapman & Hill Ltd., London, UK. Eckner KF. Bacteriocins and food applications. 1992. Dairy Food and Environment Sanitation,12 (4), 204-209 El-Ziney MG., Debevere J., and Jakobsen M. 2000. Reuterin. 2000. In: Naidu AS. (ed.), Natural Food Antimicrobial Systems, CRC Press, London, Pp. 567вЂ“587. Fiorentini, AM., Ernani SS., Porto ACS., Jaciara ZM., and Franco BDGM. 2001. Influence of bacteriocins produced by Lactococcus plantarum BN in the shelf-lie of refrigerated bovine meat. Brazilian Journal of Microbiology, 32, 42-46 GГЎlvez A., Abriouel H., LГіpez ., and Ben Omar N. 2007. Bacteriocin-based strategies for food biopreservation, Int. J. Food Microbiol. 120, 51вЂ“70. Hirsch A., Grimstead E., Chapman HR., and Mattic ATR. 1951. A note on the inhibition of an anaerobic sporeformer in Swiss cheese by a nisin producing streptococcus, Journal of Dairy Science, 18, 205-206 Holtzel A., Ganzle MG., Nicholso, G.J., Hammes W.P., and Jung G. 2000. The first low-molecular-weight antibiotic from lactic acid bacteria: reutericyclin, a new tetramic acid. Angewandte Chemie, International Edition, 39, 2766вЂ“2768. Holzapfel WH., Geisen R., and Schillinger U. 1995. Biological preservation of foods with reference to protective cultures, bacteriocins and food-grade enzymes. International Journal of Food Microbiology, 24, 343вЂ“362. Hurst A. 1981. Nisin. Applied Microbiology, 27, 85-122. Jack RW., Tagg JR. and Ray B. 1995 Bacteriocins of Gram-Positive Bacteria. Microbiology Reviews, 59, 171-200. Jacob F., Lwaff A., Siminonvich A., and Wallman E. 1953. Definition de qualques terms relatifs Г la lysogenie. Annales de Institut Pasteur, 84, 222-224. Kelly WJ., Asmundson RV., and Huang CM. 1996. Isolation and characterization of bacteriocin-producing lactic acid bacteria from ready-to-eat food products. International Journal of Food Microbiology, 33, 209вЂ“218. Klaenhammer TR. 1993. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiology Reviews, 12, 39вЂ“86. Klaenhammer TR.1998. Bacteriocins of lactic acid bacteria, Biochimie 70, 337вЂ“349. Kominsky GMR. 1999, AvaliaГ§ГЈo da sensibilidade de microrganismos selecionados a diferentes concentraГ§Гµes de nisina em salsichas comuns e de frango. Higiene Alimentar, 13, 56-62. Leistner L. 1978. Hurdle effect and energy saving. 1978 In: Downey, WK. (ed.), Food Quality and Nutrition. Applied Science Publishers, London, UK, Pp. 553вЂ“557. Leistner L. 1999. Combined methods for food preservation. 1999 In: Shafiur Rahman M. (ed.), Handbook of Food Preservation. Marcel Dekker, New York, Pp. 457вЂ“485. Leistner L. 2000. Basic aspects of food preservation by hurdle technology. International Journal of Food Microbiology, 55, 181вЂ“186. Leistner L., and Gorris LGM. 1995. Food preservation by hurdle technology. Trends in Food Science & Technology, 6, 41вЂ“46. Magnusson J., and SchnГјrer J. 2001. Lactobacillus coryniformis subsp. coryniformis strain Si3 produces a broadspectrum proteinaceous antifungal compound. Applied and Environmental Microbiology, 67, 1вЂ“5. Nes IF., Bao Diep D., Havarstein LS., Brurberg MB., Eijsink V., Holo H. 1996. Biosynthesis of bacteriocins of lactic acid bacteria. Antonie van Leeuwenhoek 70, 113-128. Nettles CG., and Barefoot SF. 1993 Biochemical and genetic characteristics of bacteriocins of food-associated lactic acid bacteria. Journal of Food Protection, 56, 338-346. Nielsen JW., Dickson JS., and Crouse JD. 1990. use of bacteriocin product by Pediococcus acidilactici to inhibit Listeria monocytogenes associated with fresh meat, Applied and Environmental Microbiology, 56, 2142-2145 Nilsson L., Chen Y., Chikindas ML., Huss HH., Gran L., and Monteville TJ. 2000.Carbon dioxide and nisin act synergistically on Listeria monocytogenes. Applied and Environmental Microbiology, 66, 769-774. Ray B., and Daeschel MA. 1992. Food Biopreservatives of Microbial Origin. CRC Press, Boca Raton, FL. Ross AIV., Griffiths MW., Mittal G.S., and Deeth HC. 2003. Combining on thermal technologies to control foodborne microorganisms. International Journal of Food Microbiology, 89, 125вЂ“138. Schillinger, U. and Holzapfel, W.H. 1996. Guidelines for manuscripts on bacteriocins of lactic acid bacteria. Int. J. Food Microbiol., 33: 3вЂ“5. Snyder, op., and Poland, DM. 1991. AmericaвЂ™s safe food-Part II, Dairy Food Environment Sanit., 11, 14 Todorov S., Vaz-Velho M., and Dicks LMT. 2003. Isolation and partial characterization of bacteriocins produced by four lactic acid bacteria isolated from traditional South African Beer. Electronic Journal of Environmental and Agricultural Food Chemistry, 2(4), 1-6. Vignolio G., Fadda S., Kairuz MN., Ruizholgado AA., and Oliver G. 1996. Control of Listeria monocytogenes in ground beef by lactocin 705, a bacteriocin produced by lactobacillus casei CRL 705. International Journal of Food Microbiology, 29, 3997-4002. WHO. 2002. Food safety strategic planning meeting: report of a WHO strategic planning meeting, WHO headquarters, Geneva, Switzerland. 134 Regulatory Aspects of Functional Foods Regulatory Aspects of Functional Foods Bimlesh mann , Rajesh Kumar and Prerna Saini Dairy Chemistry Division, NDRI, Karnal Introduction: The term вЂњFunctional FoodsвЂќ was first introduced in Japan in the mid-1980s and refers to processed foods containing ingredients that aid specific body functions, in addition to being nutritious. Currently, there is no universally accepted term for functional foods. A variety of terms have appeared worldwide such as nutraceuticals, medifoods, vita foods and the more traditional dietary supplements and fortified foods. However, the term Functional foods have become the predominant one even though several organizations have attempted to differentiate this emerging food category. Consumer interest in the relationship between diet and health has increased substantially. There is much greater recognition today that people can help themselves and their families to reduce the risk of illness and disease and to maintain their state of health and well being through a healthy lifestyle, including the diet. Ongoing support for the important role of foods such as fruits and vegetables and wholegrain cereals in disease prevention and the latest research on dietary antioxidants and combinations of protective substances in plants has helped to provide the impetus for further developments in the functional food market. Current research suggests that functional foods can make a positive contribution to addressing those challenges. Behind functional food research and development, the key drivers are the food industry, consumers and governments. The growth of the functional foods sector not only represents significant benefits to the health sector but also offers opportunities for processing and manufacturing companies. Manufacturers and their search for added-value, higher margin products provided key impetus for the growth of functional products. However, the potential for financial gain resulted in many unsupported claims for functional ingredients by commercial enterprises whose interests lie more in profit rather than sound science. As a result, the functional foods field has been tarnished and suffers a credibility gap. Many academic, scientific and regulatory organizations are actively working on ways to establish the scientific basis to support claims for functional components or the foods containing them. Any regulatory framework will need to protect consumers from false and misleading claims and to satisfy the needs of industry for innovation in product development, marketing and promotion. For functional foods to deliver their potential public health benefits, consumers must have a clear understanding of, and a strong confidence level in, the scientific criteria that are used to document health effects and claims. As interest in this category of foods has grown, new products have appeared and interest has turned to the development of standards and guidelines for the development and promotion of such foods. Existing national and international regulatory systems governing the production and distribution of functional foods: WHO (1991) published a seminal report вЂњGuidelines for the Assessment of Herbal MedicinesвЂќ which set out вЂњto define basic criteria for the evaluation of quality, safety and efficacyвЂќ of all herbal (including mushrooms) medicines. вЂњAs a general rule in this assessment, traditional experience means that long-term use as well as the medical, historical and ethnological background of those products shall be taken into account.вЂќ Depending on each countryвЂ™s situation, вЂњthe definition of long-term use may vary, but would be at least several decades вЂ¦ Prolonged and apparently uneventful use of a substance usually offers testimony of its safetyвЂќ. The Guidelines call for various assessments of quality, efficacy and the intended use, and reference should be made to pharmacopoeia monographs where they exist. If none exist, then the manufacturer should be required to produce a similar statement. Procedures should all correspond to Good Manufacturing Practices and include stability testing of the final product as packaged. With regard to safety вЂњA guiding principle should be that if the product has been traditionally used without demonstrated harm, no specific restrictive regulatory action should be undertaken unless new evidence demands a revised risk-benefit assessmentвЂќ (Alkerele, 1992). 135 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance It is recommended that consumer product information should include a quantitative list of active ingredients, dosage, dosage form, indications, mode of administration, duration of use, any major adverse effects, contraindications, warnings, etc. (Wasser et al., 2000a). In this article the preliminary recommendations by FAO about regulation of functional foods followed by an overview of the functional foods regulatory systems of Europe, USA, Canada, Australia, Japan , other Asian countries and guidelines of Codex Alimentarius as well as food safety act 2006 (India) are presented. Some preliminary recommendations: Some recommendations have previously been made by FAO (FAO, 2004). 1. Functional foods should be clearly defined: An international definition for functional foods should be adopted: Functional foods should be вЂњa food similar in appearance to a conventional food (beverage, food matrix), consumed as part of the usual diet which contains biologically active components with demonstrated physiological benefits and offers the potential of reducing the risk of chronic disease beyond basic nutritional functionsвЂќ; вЂў An international database from dietary active compounds should be encouraged: вЂў The basic principles for the addition of dietary active compounds in foods could be based on the principles for the addition of essentials nutrients to foods as stated by the Codex Alimentarius Commission: 2. Health claims vs structure/functions claims vs nutrition claims should be clearly defined вЂў Nutrition Claims could be referred to what the product contains; вЂў Health Claims: could be related to what the food or food components does or do. The Codex Alimentarius guidelines for use of nutrition and health claims in foodlabelling should be encouraged. 3. Health claims should require scientific validation and substantiation Substantiation of a claim should be based on human data using rigorous scientific protocols: вЂў There is a need to define guidelines for safety and efficacy assessment of functional foods. EUROPE : In December 2006, the regulation on the use of nutrition and health claims for foods was adopted by the Council and Parliament of Europe. For the purposes of this regulation, the following definitions have been proposed: вЂў вЂњClaimвЂќ: any message or representation, which is not mandatory under Community or national Legislation, including pictorial, graphic or symbolic representation, in any form, which states, suggests or implies that a food has particular characteristics; вЂў вЂњNutrition claimвЂќ: means any claim which states, suggests or implies that a food has particular beneficial nutritional properties due to: a) the energy (calorific value) it (i) provides; (ii) provides at a reduced or increased rate; or (iii) does not provide; and/or b) the nutrients or other substances it (i) contains; (ii) contains in reduced or increased proportions; or (iii) does not contain; вЂў вЂњHealth claimвЂќ: means any claim that states, suggests or implies that a relationship exists between a food category, a food or one of its constituents and health; вЂў вЂњReduction of disease risk claimвЂќ: means any health claim that states, suggests or implies that the consumption of a food category, a food or one of its constituents significantly reduces a risk factor in the development of a human disease. вЂў European Agencies: European Commission, European Food Safety Authority (EFSA), European Food Information Council (EUFIC) and International Life Sciences Institute (ILSI) вЂў USA: Currently, Food and Drug Administration (FDA) has neither a definition nor a specific Regulatory rubric for foods being marked as вЂњfunctional foodsвЂќ, they are regulated under the 136 Regulatory Aspects of Functional Foods same regulatory framework as other conventional foods under the authority of the Federal Food Drug and Cosmetic Act. There are three categories of claims that can be used on food: вЂў Health Claims - Health claims describe a relationship between a food substance and a disease or health-related conditions. There are three sets of legislation by which FDA exercises its oversight in determining which health claims may be used on a label or in labeling for a food or dietary supplement: вЂў NLEA Authorized Health Claims вЂ“ Under the provisions of the Nutrition Labeling and Education Act (NLEA) of 1990, the Dietary Supplement Act of 1992, and the Dietary Supplement Health and Education Act of 1994 (DSHEA), FDA may authorize a health claim for a food or dietary supplement based on an extensive review of the scientific literature, generally as a result of the submission of a health claim petition, using the significant agreement standard to determine the nutrient/disease relationship is well established вЂў Health Claims Based on Authoritative Statements вЂ“ Under the 1997 Food and Drug Administration Modernization Act (FDAMA), a health claim may be authorised for a food based on an authoritative statement of a scientific body of the U.S. government or the National Academy of Sciences. FDA has prepared a guide on how a firm can make use of authoritative statement-based health claims on food вЂў Qualified Health Claims вЂ“ FDAвЂ™s 2003 Consumer Health Information for Better Nutrition Initiative provides for the use of qualified health claims when there is emerging evidence for a relationship between a food, food component, or dietary supplement and reduced risk of a disease or health-related condition. вЂў Nutrient Content Claims - The Nutrition Labelling and Education Act of 1990 (NLEA) permits the use of label claims that characterize the level of a nutrient in a food (i.e., nutrient content claims) made in accordance with FDAвЂ™s authorizing regulations. вЂў Structure/Function Claims - Structure/function claims have historically appeared on the labels of conventional foods and dietary supplements as well as drugs. However, the Dietary Supplement Health and Education Act of 1994 (DSHEA) established somespecial regulatory procedures for such claims for dietary supplement labels. Manufacturers of dietary supplements that make structure/function claims on labels or in labelling must submit a notification to FDA no later than 30 days after marketing the dietary supplement that includes the text of the structure/ function claim. вЂў Agencies: The Food and Drug Administration (FDA), American Heart Association (AHA), The Institute of Medicine (IOM). CANADA: вЂў In Canada, Health Canada regulates the functional foods and nutraceutical industry and the Canadian Food Inspection Agency enforces these regulations. Within Health CanadaвЂ™s Health Products and Food Branch, the Food Directorates regulates functional foods, while the Natural Health Products Directorate regulates other natural health products including vitamins, minerals; herbal remedies; homeopathic medicines; traditional medicines such as traditional Chinese medicines; probiotics, and other products like amino acids and essential fatty acids. Briefly, the term вЂњhealth claimвЂќis not defined in Canada but currently, there are 3 types of nutrition claims allowed: вЂў Nutrient Content Claims- Nutrient content claims are the simplest label statement as they identify/quantify the amount of a nutrient contained in a food. In addition, comparative nutrient content claims (e.g. reduced, less, light) are allowed based on thestandardized reference amount. вЂў Biological Role/ Structure Function Claims вЂ“ The second category of nutrition claims are referred to as biological role or structure/function claims. Biological role claims are for nutrients, not a 137 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance food containing the nutrient. These statements identify the generally recognized function of a nutrient as an aid in maintaining the functions of the body necessary for the maintenance of good health, or for normal growth and development. вЂў Risk Reduction Health Claims вЂ“ Health Canada began to consider the possibility of risk reduction claims for foods in 1999, by reviewing the ten U.S. approved health claims. In 2003, the Food and Drug Regulations were amended to introduce the first series of authorized health claims in Canada. In the meantime Health Canada developed a proposed regulatory framework for product-specific authorization of health claims In Canada, the most of nutraceuticals fall under the Natural Health Products Regulations of the Food and Drugs Act which came into effect on January 1, 2004. In addition, a compliance policy is in place to ensure the safety of Canadians until all natural health products have undergone Health CanadaвЂ™s approval process. вЂў Agencies: Health Canada, the Canadian Food Inspection Agency JAPAN: The Japanese Ministry of Health, Labour, and Welfare (MHLW) set up вЂ�Foods for Specified Health UseвЂ™ (FOSHU) in 1991 as a regulatory system to approve the statements made on food labels concerning the effect of the food on the human body. FOSHU refers to foods containing ingredient with functions for health and officially approved to claim its physiological effects on the human body. The regulatory range of FOSHU was broadened in 2001 to accept the forms of capsules and tablets in addition to those of conventional foods. FOSHU increased the total to about 330 items in January 2003. In April 2001, the MHLW enacted a new regulatory system, вЂ�Foods with Health ClaimsвЂ™, which consists of the existing FOSHU system and the newly established вЂ�Foods with Nutrient Function ClaimsвЂ™ (FNFC). FNFC refers to all food that is labeled with the nutrient function claims specified by the MHLW. The labelling of functional foods should always be based on scientific evidence and be in harmony with international standards. The nutrientвЂ“function claim was adopted in the guidelines for nutrition claims by the Codex Alimentarius in 1997. The claims of the Japanese FNFC are equivalent to the nutrient function claims standardized by The Codex Alimentarius. вЂў Agencies: Ministry of Health, Labour and Welfare Other asian countries: Recently, the Asian-Pacific Network for Food and Nutrition (ANFN) of the FAO regional office for Asia and the Pacific held its regional expert consultation on functional foods and their implications in the daily diet and published a report on the development and status of Functional foods in different asian countries including China, India, Bangladdesh, Indonesia, Nepal, Malaysia, Philippines, Thailand, Sri Lanka, and Vietnam (FAO, 2004). In Korea, the term вЂњhealth/functional foodвЂќ (HFF) refers to food supplements containing nutrients or other substances (in a concentrated form) that have a nutritional or physiological effect whose purpose is to supplement the normal diet. The Korean Health/Functional Food Act that came into effect in 2004 requires these products to be marketed in measured doses, such as in pills, tablets, capsules, and liquids. Codex Alimentarius: The Codex Alimentarius Commission (CAC) was created in 1961/62 by Food and Agriculture Organization of the United Nations (FAO) and the World Health Organization (WHO), to develop food standards, guidelines and related texts such as codes of practice under the Joint FAO/WHO Food Standards Programme. The main purpose of this Programme is to protect the health of consumers, ensure fair practices in the food trade, and promote coordination of all food standards work undertaken by international governmental and non-governmental organizations. вЂњCodex IndiaвЂќ the National Codex Contact Point (NCCP) for India, is located at the Directorate General Of Health Services, Ministry of Health and Family Welfare (MOH&FW), Government of India. It coordinates and promotes Codex activities in India in association with the National Codex Committee and facilitates IndiaвЂ™s input to the work of Codex through an established consultation process.The Codex Alimentarius has defined two types of nutrition claims- Nutrition content claim 138 Regulatory Aspects of Functional Foods and Nutrient comparative claim- and three types of health claims- nutrient function claims; enhanced function claims and reduction of disease risk (Codex Alimentarius Commission, 2004). вЂў Nutrition Claims -Guidelines for the use of nutrition claims by the Codex Committee on Food Labeling proposed that вЂ�nutrient claim means any representation which states, suggests or implies that a food has particular nutritional properties including but not limited to the energy value and to the content of protein, fat and carbohydrate, as well as the content of vitamins and mineralsвЂ™. Nutrition Claims include two types: (i) Nutrient content claim that is a nutrition claim that describes the level of a nutrient contained in a food and (ii) Nutrient comparative claim is a claim that compares the nutrient levels and/or energy value of two or more foods. вЂў Health Claims - Guidelines for the use of nutrition claims by the Codex Committee in Food Labelling proposed that вЂњhealth claim means any representation which states, suggests or implies that a relationship exits between a food or a constituent of that food and healthвЂќ. Health claims include three types: (i) Nutrient Function Claim that is the claim that describes the physiological role of the nutrient in growth, development, and the normal function of the bodyвЂ™; (ii) Enhanced Function Claim concerns specific beneficial effects of the consumption of foods and their constituents in the context of the total diet and relate to a positive contribution to health or to improvement of a function or to modifying or preserving health and (iii) Disease Risk Reduction Claim relates to the consumption of a food or food constituent, in the content of the total diet, to the reduced risk of developing a disease or a health-related condition. Risk reduction means significantly altering a major risk factor(s) for a disease or a health related condition. Diseases have multiple factors and altering one of these risk factors may or may not have a beneficial effect. The presentation of Risk Reduction Claims must ensure, for example, by use of appropriate language and reference to other risk factors, that consumers do not interpret them as prevention claims.вЂ™ Food Safety and Standards Act, 2006 (India): Several Acts and orders prevailed in India to safeguard food safety and the health of the consumer. They were introduced to complement and supplement each other in achieving total food safety and quality. However due to variation in the specifications/standards in different Acts/Orders, and administration by different Departments and Ministries, there were implementation problems and the lack of importance given to safety standards over a period of time. The food industries were facing problems as different products were governed by different orders and ministries and the rules and regulations in the Country needed consolidation. The Food Safety and Standards Act 2006 was introduced to overcome these shortcomings and to give more importance to safety standards. This Act consolidates the laws relating to food and establishes the Food Safety and Standards Authority of India (FSSAII) for laying down science-based standards for articles of food and to regulate their manufacture, storage, distribution, sale and import, to ensure availability of safe and wholesome food for human consumption. This Act provides for the establishment of the FSSAII which is an autonomous body under the Ministry of Health and Family Welfare, Government of India. FSSAIIвЂ™s work programs ensure the provision of appropriate scientific, technical and administrative support for scientific committees and scientific panels, ensuring that the FSSAII carries out its tasks in accordance with the requirements of its users, prepares statements of revenue and expenditure and executes the budget, while developing and maintaining contact with the Central Government and ensuring a regular dialogue with its relevant committees. The FSSAI also constitutes scientific panels and scientific committees to address various technical issues such as food additives, pesticides and antibiotics, genetically modified foods, functional foods, biological hazards, contaminants, labeling and methods of sampling. The Scientific Committee is responsible for providing scientific opinions to FSSAI. Finally the FSSAI is also responsible for regulating and monitoring the manufacture, processing, distribution, sale and import of food so as to ensure safe and wholesome food to consumers. The general principles to be followed by the Central Government, State Governments and FSSAI while implementing the provisions of this Act shall be guided by the following seven principles: 139 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 1. To endeavour to achieve appropriate levels of protection of human life and health and protection of consumersвЂ™ interests including fair practices in all kinds of food; 2. Carry out risk management based on risk assessment; 3. Adopt risk management measures necessary to ensure appropriate levels of health protection; 4. Measures adopted shall be proportionate and no more trade restrictions shall be imposed than required; 5. Measures adopted shall be revised within a reasonable period; 6. In case of suspected risks of the public consuming contaminated food, the FSSAI shall take appropriate steps to inform the general public of the risk to health; and 7. If any lot of food fails to comply with food safety requirements it shall be presumed that the whole consignment fails to comply with these requirements. Genetically modified foods, organic foods, functional foods, nutraceuticals and proprietory foods are regulated by this Act. Packaged foods, labelling requirements and advertising requirements are adequately covered along with import regulations for food articles. There is a provision for the FSSAI to establish various Scientific Panels such as: вЂў Food additives, flavours, processing aids, materials in contact with food; вЂў Pesticides and antibiotic residues; вЂў Genetically modified organisms and foods; вЂў Functional foods, nutraceuticles and foods for special dietary purposes; вЂў Biological hazards, other contaminants; and вЂў Food labelling and methods of sampling and analysis. The Act has laid down certain broad principles for implementing the food safety, viz; 1. To lay down food safety standards and to ensure fair trade practices while achieving an Appropriate Level of Protection (ALOP) of human life and health; for contaminants and hazards, 2. To carry out risk analysis so as to ensure an appropriate level of protection to the consumers as well to see that such measures are least trade restrictive and are in accordance with SPS and TBT measures of WTO; 3. Wherever appropriate, food standards are to be specified on the basis of risk analysis; 4. Risk assessment is to be based on the available toxicological evaluation (e.g. JECFA) and extensive open and transparent discussion with all stakeholders, and the underlying principle is to ensure protection of consumers by preventing fraudulent, deceptive or unfair trade practices. The Act also prescribes general provisions for articles of food: вЂў Food additives / processing aids are to be added only in accordance with provisions / regulations under the Act; вЂў Foods are not to contain any contaminants such as toxic metals, toxins, pesticide residues, antibiotics and veterinary drugs, in excess of limits prescribed under the regulation; вЂў Regulations will be made for the manufacture, distribution or trade of any novel foods, GM foods, irradiated foods, organic foods, foods for special dietary uses, functional foods, nutraceuticals, health supplements, proprietary foods etc. The onus of safety of food production, processing, import, distribution and sale lies with the food business operator. The Commissioner of Food Safety of the state will implement rules under this Act at state level. The FSSAI and the State Food Authorities will maintain a system of control, involving risk communication, food safety surveillance and other monitoring activities covering all stages of food business. The FSSAI is empowered to recognise any agency to conduct food safety audits which are 140 Regulatory Aspects of Functional Foods a systematic and functionally independent examination of food safety measures based on food safety management systems consisting of Good Manufacturing Practices, Good Hygienic Practices, Hazard Analysis and Critical Control Points or any other such measures specified by regulation. Food testing laboratories are required to be accredited by any accreditation agency so that the analytical results are reliable and consistent. The FSSAI and State Food Safety Authorities are responsible for enforcement of this Act. Both shall monitor and verify that the relevant requirements of law are fulfilled by food business operators at all stages of food business. There is provision for food recall by the business operator if the food does not comply with the Act. The Food Safety Authority in the State (Health Ministry) appoints a Commissioner of Food Safety, designated officers (district level) and food safety officers to implement the programmes under the provisions of this Act. The FSSIA will notify food laboratories and research institutions accredited by the National Accreditation Board for testing and calibration laboratories. It may also recognise more referral food laboratories by this Act. This Act gives more importance for ensuring a very safe food product to consumers by providing quicker disposal of cases within the state. Punishments offered are very severe which would make the retailer/wholesaler be more cautious in their dealings. The standards for quality and safety laid down in this Act are harmonised standards and applicable throughout the country, and all other standards/specifications become null and void. This system provides for quicker corrective actions by the regulators as the problems are localised and traceable. Conclusion/ Recommendatrions: Several approaches to the use of health claims on foods have been made around the world, and the common theme is that any health claim will require scientific validation and substantiation. There is also broad consensus that any regulatory framework should protect the consumer, promote fair trade and encourage innovation in the food industry. However, there is a clear need to have uniform understanding, terminology and description of types of nutrition and health claims. References: Food Safety and Standards Act , 2006 of India Ministry of Health and Family Welfare, New Delhi, Government of India http://www.mohfw.nic.in/pfa.htm Food Safety in India Ministry of Health and family Welfare, New Delhi, Government of India http://www. foodsafetyindia.nic.in/ P. Roupas_ P. G. Williams (2007) Regulatory aspects of bioactive dairy ingredients . Food Science Australia University of Wollongong, http://ro.uow.edu.au/ Report on Functional Foods Food Quality and Standards Service (AGNS) Food and Agriculture Organization of the United Nations (FAO) November, 2007 141 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Nanomaterials - Their Applications and Safety Aspects in Foods Bimlesh Mann , Rajesh Kumar and Prabhakar Padgham Dairy Chemistry Division, NDRI, Karnal Nanomaterials which include nanoparticles, nano-emulsions and nano-capsules are now being used in processed foods, food packaging and food contact materials. Because of their unique properties, nanomaterials offer many new opportunities for the food industries, as potent colourings, flavourings, nutritional additives and antibacterial ingredients. Due to their very large surface area,the nanoparticles have better chemical reactivity, biological activity and catalytic behaviour as compared to larger particles of the same chemical composition (Garnett and Kallinteri, 2006). The Chemical Selection Working Group of the U.S. Food and Drug Administration (FDA) defined nanomaterials as вЂњparticles with dimensions less than micrometer scale [i.e. less then 1,000 nm] that exhibit unique properties not recognized in micron or larger sized particlesвЂќ (U.S. FDA 2006). AustraliaвЂ™s Commonwealth Scientific and Industrial Research Organisation (CSIRO) food scientists have also defined nanomaterials as measuring up to 1,000 nm (Sanguansri and Augustin, 2006). In another report on nanomaterials FDA chose not to offer a size-based definition at all (U.S. FDA, 2007). Nanomaterials also have far greater bioavailability than larger particles, resulting in greater uptake into individual cells, tissues and organs. Materials which measure less than 300 nm can be taken up by individual cells (Garnett and Kallinteri, 2006), while nanomaterials which measure less than 70 nm can even be taken up by cellsвЂ™ nuclei, where they can cause major damage (Chen and Mikecz, 2005). Nanotechnology has potential applications in all aspects of food processing, food packaging and food monitoring.These includes: вЂў Developments of the methods for the production of foods such as soft drinks, ice cream, chocolate or chips to be marketed as вЂ�healthвЂ™ foods by reducing fat, carbohydrate or calorie content or by increasing protein, fibre or vitamin content. вЂў Production of stronger flavourings, colourings, and nutritional additives. вЂў Development of foods capable of changing their colour, flavour or nutritional properties according to a personвЂ™s dietary needs, allergies or taste preferences. вЂў Development of packaging materials to increase food shelf life and which can detect spoilage, bacteria, or the loss of food nutrient. One of the earliest commercial applications of nanotechnology within the food sector is in packaging (Roach, 2006). Between 400 and 500 nanopackaging products are estimated to be in commercial use now. A key purpose of nano packaging is to deliver longer shelf life by improving the barrier functions of food packaging to reduce gas and moisture exchange and UV light exposure (Sorrentino et al., 2007). Nano packaging can also be designed to release antimicrobials, antioxidants, enzymes, flavours and nutraceuticals to extend shelf-life (Cha and Chinnan, 2004; LaCoste et al., 2005). Packaging equipped with nano sensors is designed to track either the internal or the external conditions of food products, pellets and containers throughout the supply chain. The use of nanomaterials to strengthen bioplastics (plant-based plastics) may enable bioplastics to be used instead of fossil-fuel based plastics for food packaging and carry bags (Sorrentino et al., 2007; Technical University of Denmark, 2007). Unfortunately, the greater chemical reactivity and bioavailability of nanomaterials may also result in greater toxicity of nanoparticles compared to the same unit of mass of larger particles of the same chemical composition (Hoet et al., 2004; OberdГ¶rster et al., 2005b).Other properties of nanomaterials that influence toxicity include: chemical composition, shape, surface structure, surface charge, catalytic behaviour, extent of particle aggregation (clumping) or disaggregation, and the presence or absence of other groups of chemicals attached to the nanomaterial (Brunner et al., 2006; Magrez et al., 2006; Sayes et al., 2006).The potential health risks associated with nanomaterials in foods has mainly focused on 142 Nanomaterials - Their Applications and Safety Aspects in Foods manufactured nanomaterial food or food packaging additives but ignored the nanoparticles created during processing. Thus nanoparticles are also present in many foods because of the technology used to process the foods, rather than because they are food additives or ingredients. Although food processing technologies that produce nanoparticles are not new, the rapidly expanding consumption of highly processed foods is most certainly increasing our exposure to nanoparticles in foods. Processing techniques which produce nanoparticles, particles up to a few hundred nanometres in size, and nanoscale emulsions are used in the manufacture of salad dressings,chocolate syrups, sweeteners, flavoured oils, and many other processed foods (Sanguansri and Augustin, 2006). The formation of nanoparticles and nanoscale emulsions can result from food processing techniques such as high pressure valve homogenisation, dry ball milling, dry jet milling and ultrasound emulsification. Although many food manufacturers may remain entirely unaware that their foods contain nanoparticles, it is likely that these processing techniques are used precisely because the textural changes and flow properties they produce are attractive to manufacturers. Recent research has found that many food products contain insoluble, inorganic nanoparticles and microparticles that have no nutritional value, and which appear to have contaminated foods unintentionally, for example as a result of the wear of food processing machines or through environmental pollution. The health implications of food processing techniques that produce nanoparticles and nanoscale emulsions also warrant the attention of food regulators. The potential for such foods to pose new health risks must be investigated in order to determine whether or not related new food safety standards are required. Just as a better understanding of the health risks of incidental nanoparticles in air pollution have resulted in efforts to reduce air pollution, improved understanding of the health risks associated with incidental nanoparticle contaminants in foods may also warrant efforts to reduce incidental nanoparticlesвЂ™ contamination of processed foods. The commercial manufacturing of food products, food packaging and food contact materials should be after the introduction of nanotechnology specific regulation which protects the public workers and the environment from their risks. Because of their potentially serious health risks, environmental risks and social implications, the following points have to be ascertained, before the commercial applications of these nanomaterials. вЂў These manufactured food nanomaterials must be subject to new safety assessments as new substances, even where the properties of their larger scale counterparts are well-known. вЂў The manufactured nanomaterials must be subject to rigorous nano-specific health and environmental impact assessment and demonstrated to be safe prior to approval for commercial use in foods, food-packaging and food contact materials. вЂў All particles up to 300nm in size must be considered to be вЂ�nanomaterialsвЂ™ for the purposes of health and environment assessment, given the early evidence that they pose similar health risks as particles less than 100nm in size which have to date been defined as вЂ�nanoвЂ™. вЂў The data related to safety assessments, and the methodologies used to obtain them, must be placed in the public domain. вЂў The nano ingredients must be clearly indicated on product labels to allow the public to make an informed choice about product use. вЂў The public, including all stakeholder groups affected, must be involved in all aspects of decision making regarding nanotechnology in food. This includes in the development of regulatory regimes, labeling systems, and prioritization of public funding for food and agricultural research. References: Cha D, Chinnan M. 2004. Biopolymer-based antimicrobial packaging: A review. Critic RevFood Sci Nutrit 44:223-237. Chen M, von Mikecz A. 2005. Formation of nucleoplasmic protein aggregatesimpairs nuclear function in response to SiO2 nanoparticles. Experiment Cell Res 305:51-62. Friends of the Earth International. 2009. OUT OF THE LABORATORY AND ON TO OUR PLATES Nanotechnology in Food & Agriculture Amsterdam. Available at: http://www.foei.org 143 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Garnett M, Kallinteri P. 2006. Nanomedicines and nanotoxicology: some physiological principles. Occup Med 56:307311. Gatti A. Undated. вЂњNanopathology : a new vision of the interaction environment-human lifeвЂќ. Available at: http://ec.europa.eu/research/qualityoflife/ ka4/pdf/report_nanopathology_en.pdf (accessed 11 September 2007). Hoet P, Bruske-Holfeld I, Salata O. 2004. Nanoparticles вЂ“ known and unknown health risks. J Nanobiotechnol 2:12. Hund-Rinke K, Simon M. 2006. Ecotoxic effect of photocatalytic active nanoparticles (TiO2) on algae and daphnids. Environ Sci Poll Res 13(4):225-232. Invest Australia. 2007. Nanotechnology: Australian Capability Report, Third Edition. Commonwealth of Australia, Canberra. Available at: http://www. investaustralia.gov.au/media/NANOREPORT07. pdf(accessed 17 January 2008). LaCoste A, Schaich K, Zumbrunnen D, Yam K. 2005. Advanced controlled release packaging through smart blending. Packag Technol Sci 18:77-87. OberdГ¶rster G, Maynard A, Donaldson K, Castranova V, Fitzpatrick J, Ausman K, Carter J, Karn B, Kreyling W, Lai D, Olin S, Monteiro-Riviere N, Warheit D, Yang H. 2005b. Principles for characterising the potential human health effects from exposure to nanomaterials: elements of a screening strategy. Particle Fibre Toxicol 2:8 Roach S. 2006. Most companies will have to wait years for nanotechвЂ™s benefits. Foodproductiondaily.com 21 August 2006. Available at: http://www.foodproductiondaily.com/news/ng.asp?id=69974 (accessed 17 January 2008). Sanguansri P, Augustin M. 2006. Nanoscale materials development вЂ“ a food industry perspective. Trends Food Sci Technol 17:547-556. Sayes C, Wahi R, Kurian P, Liu Y, West J, Ausman K, Warheit D, Colvin V. 2006. Correlating nanoscale titania structure with toxicity: A cytotoxicity and inflammatory response study with human dermal fibroblasts and human lung epithelial cells. Toxicol Sci 92(1):174вЂ“185. Sorrentino A, Gorrasi G, Vittoria V. 2007. Potential perspectives of bio-nanocomposites for food packaging applications. Trends Food Sci Technol 18:84-95. Technical University of Denmark. 2007. Bioplastic developed into food packaging through nanotechnology. News 23 March 2007. Available at: http://risoe-staged.risoe.dk/News_archives/News/2007/0322_bioplast.aspx (accessed 17 January 2008). U.S. FDA. 2006. Nanoscale Materials [no specified CAS] Nomination and Review of Toxicological Literature. December 8, 2006. Prepared by the Chemical Selection Working Group, U.S. Food & Drug Administration. Available at: http://ntp.niehs.nih.gov/ntp/htdocs/Chem_Background/ExSumPdf/Nanoscale_materials.pdf (accessed 15 January 2008). U.S. FDA. 2007. Nanotechnology: A Report of the U.S. Food and Drug Administration Nanotechnology Task Force. July 25, 2007. Available at: http://www.fda.gov/ nanotechnology/taskforce/report2007.html (accessed 15 January 2008). 144 Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticals Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticals Ayyasamy Manimaran1 and Bimlesh Mann2 1 Livestock Production Management and 2Dairy Chemistry Division, NDRI, Karnal Introduction The word вЂњnutraceuticalвЂќ was first coined by DeFelice (2007) who defined it as вЂњa substance that is a food or a part of food and provides medical and health benefits, including prevention and treatment of disease.вЂќ Research and awareness about nutraceuticals has been increased in last few decades and expected to continue to increase. Basic research using laboratory animals is critical to furthering understanding of the impact of nutraceuticals on health promotion and disease management, apart from regulatory prerequisite for conducting further human clinical trials. A variety of laboratoryand small-animals are used for evaluation of functional food and nutraceutical efficacy/metabolic evaluation. These pre-clinical trials can be conducted utilizing either immune competent or immunocompromised animals like nude mice which are not having cell mediated immune response. Although significant evidence exists that functional foods and nutraceuticals can play key roles in disease prevention and health promotion, as in decreasing the risk of certain chronic diseases, safety considerations must not be ignored. Safety pharmacology studies for developing nutraceuticals are necessary and compulsory to support human clinical trials of a given scope and duration as well as marketing authorization for pharmaceuticals. The objective is to identify possible, undesirable pharmacodynamic effects of the nutraceuticals which are unrelated to the main pharmacological activity, after therapeutic administration or overdose. Safety pharmacology and pharmacodynamic studies includes the assessment of effects on cardiovascular, central nervous and respiratory systems and should generally be conducted before human exposure. Safety pharmacology studies can be performed as independent studies or can be incorporated as a part of toxicological studies thus reducing the number of animals used in accordance with the 3RвЂ™s principles. Incorporation into toxicological studies may offer the additional advantage that the effect of the nutraceuticals can be evaluated not only after a single administration but also after repeated administration for a given period of time. However, one objection is that the dose levels involved can be much higher than the therapeutic dose. In safety pharmacology studies, the low dose should be equal to or slightly higher than the therapeutic dose. The purpose of toxicity testing of animals is to know the biological effects of substances, so that precautions can be taken to protect humans, animals and the environment. Mice are the most widely used species accounting for more than 50% of animals use. Mice biology is well known than any other laboratory animal and this is widely used by immunologist, oncologist and geneticist. Rats are second most widely used a laboratory animal species and they are generally preferred over mice by toxicologist and pharmacologists due to convenient size and they do not have many virally-induced tumors as mice. Rabbits have been widely used for antisera production, pyrogen testing and reproductive studies particularly for teratogenicity. Analysis of nutraceuticals Milk and dairy products are important source for proteins, peptides and amino acids. They have angiotension converting enzymes (ACE) inhibitory activities, antibacterial, antioxidant, immunomodulating, antithrombotic, absorption of minerals and anti-inflammatory activities. These health promoting effects make these compounds as nutraceuticals for prevention and treatment of hypertension, diabetes and hepatitis etc. Their identification requires advanced analytical techniques due to complexity of these compounds. In general, analysis of milk compounds are carried out by liquid chromatography coupled to mass spectrometry (LC-MS) or capillary electrophoresis (CE) (Campanella et al., 2009; Contreras et al., 2008; Meltretter et al., 2008; Simone et al., 2009) and immunosensors for particular determination of lactoferrin and immunoglobulin G in milk (Campanella et al., 2009). 145 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Further, an omics-rooted study of milk proteins has been carried out using advanced analytical techniques (HPLC-MS/MS, 2D-PAGE, MALDI-TOFMS) showing the great potential of this modern approach (Casado et al., 2009). Polyacrylamide gel electrophoresis (PAGE), sodium dodecyl sulfate PAGE (SDS-PAGE) and 2D-PAGE have been employed to analyze proteins in milk, (Casado et al., 2009). However, these more classical techniques do not provide an identification of these biomolecules as accurate as CE or HPLC coupled to mass spectrometry. Thus, mass spectrometry alone or coupled to HPLC has been used to characterize, identify and analyze proteins, peptides and amino acids in several sources including milk. Gas chromatography (GC) and HPLC are preferred analytical tools for analyzing bioactive compounds, probably due to their versatility, generalized availability, lowcost and simplicity. Other techniques such as CE, MS, Nuclear Magnetic Resonance (NMR) or Fourier Transformed Infrared Spectroscopy (FTIR) have also given good results, although their use is not as widespread as GC or HPLC. Table.1 Nutraceutical and analytical techniques employed for their analysis Nutraceutical Source Possible health effect Analytical techniques Reference Phytosterols and phytostanols Milk and yoghurt Decrease cholesterol levels GC-MS Santos et al., 2007 Milk lipids (triglycerides, diacylglycerides, saturated fatty acids and PUFAs). Milk Immuno-suppressive, antiinflammatory, andantimicrobial properties. HPLC-MS/MS, GC/LC. Casado et al., 2009 Gangliosides Dairy products (milk) Protect against enteric pathogens, and prebiotic functions. MALDI-TOFMS, HPTLC, HPLCMS Lacomba, et al., 2010; Mocchetti, 2005 Milk proteins, peptides, Lactoferrin and immunoglobulin G. Milk and derived products Antihypertensive, antimicrobial, antiinflammatory and inmunostimulating activities. Important source of amino acids HPLC-MS/ MS, 2D-PAGE, MALDI-TOFMS, Inmunosensors, CE (UV, MS), Lacomba, et al., 2010; Campanella et al., 2009; Contreras et al., 2008; Meltretter et al., 2008; Simone et al., 2009 Pharmacological characterization The pharmacological characterization of a nutraceutical is simply the determination of its efficacy and safety. Since many nutraceuticals are considers as food items (Dietary Supplement Health and Education Act, 1994), currently, many nutraceuticals (e.g., botanicals) do not require efficacy and safety testing before marketing. However, Morrow et al. (2005) reported that there is a concern that many nutraceuticals have pharmacological activity that can endanger the public health and that certain nutraceuticals (e.g., botanicals) should be regulated similarly to prescription nutraceuticals. Therefore, future marketing of nutraceuticals may require more rigorous testing of safety and efficacy before marketing. In fact, the FDA (2007) developed a current good manufacturing practice requirement for dietary supplements that obligates manufacturers to evaluate the composition, identity, quality, and strength of their marketed products. With future increased regulation of nutraceuticals on the horizon, pharmacological characterization of nutraceuticals will be useful. Drug development, testing and review process The drug review process is roughly divided into preclinical and clinical testing. The preclinical test is primarily in vitro and animal studies, whereas clinical are human studies. Preclinical testing in animal model (one rodent, one non-rodent) is useful to evaluate acute and short term toxicity. Doses will be at normal levels for short and long term or increasingly high levels to induce toxicity. It is useful to determine lethal dose. Pre-clinical studies will be useful to assess how drug/chemicals is absorbed, distributed, metabolized, and excreted in animals. Further, clinical studies will be conducted in human being in order to verify the mechanism and efficacy. It includes 146 Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticals the following phases (FDA, 2002; Berkowitz, 2007). вЂў Phase I: 20вЂ“80 human subjects, safety, pharmacokinetics вЂў Phase II: 36вЂ“300 human subjects, efficacy вЂў Phase III: 300вЂ“3,000 human subjects, efficacy, double-blind studies вЂў Phase IV: post-marketing surveillance Preclinical testing Preclinical safety testing assesses the potential toxicity of a drug in in vitro and animal studies (FDA, 1985; Berkowitz, 2007). Preclinical testing involves pharmacological profile tests and it can be further divided into the following (Berkowitz, 2007) 1. Molecular: receptor binding, enzyme inhibition 2. Cellular: cell cultures, isolated tissues 3. Disease models: pain, seizures Safety studies required by the FDA 1. Pharmacology studies: determine ED50 2. Acute toxicity studies: determine LD50 3. Multi-dose toxicity studies a. Subchronic toxicity: duration of one to three months b. Chronic toxicity: duration of six months c. Carcinogenicity: duration of two years 4. Special toxicity studies: route of administration 5. Reproduction studies: birth defects 6. Mutagenicity studies: Ames test 7. Pharmacokinetics studies: absorption, distribution, metabolism and excretion (ADME) Acute toxicity Acute toxicity tests are generally provide data on the relative toxicity likely to arise from a single or fractionated doses up to 24 hrs for oral and dermal studies, while 4-hr exposure for inhalation studies. Rats are preferred for oral and inhalation tests where as rabbits preferred for dermal tests. Young adults of 5 of each sex per dose level with minimum three dose levels were recommended. Animals should be monitored for 14 days for any clinical symptoms. Subacute study (repeated dose exposure) It is performed to obtain dose for subchronic studies typical protocol is to give 3-4 dosages, and 10 animals for each sex per dose are often used. For non-rodents species, usually dogs (3-4 of each sex per dose). Subchronic toxicity Subchronic toxicity tests are employed one month to three months (90 days are common). Detailed clinical observations and pathology examinations should be conducted. Two species are recommended (rodents and non-rodents). Young adult rodentsвЂ™ (10-20 animals for each sex per dose) and non-rodents species, usually dogs (4 of each sex per dose) should be used for experimentation. At least 3 dose levels, in which high dose produce toxicity but not more than 10 per cent mortality, low dose not produce toxicity and intermediate dose. The principal goal of this test is development of No Observable Adverse Effects Level (NOAEL) and sometimes these protocols can be used for further like chronic and developmental toxicity studies. 147 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Chronic toxicity Long-term or chronic toxicity tests determine toxicity from exposure for a substantial portion of a subjectвЂ™s life. They are similar to the subchronic tests except that they extend over a longer period of time, which is depend upon intended period (short or long) of exposure to human and involve larger groups of animals. In rodents, chronic exposures are usually for 6 months to 2 yrs and in non rodents 1 yr or more. It is useful to assess the cumulative toxicity of chemicals particularly carcinogencity. Dose selection for the chronic study is generally based on the results of a series of subchronic (90 day) toxicity studies. Result of weight gain, survival information, pharmacokinetic, metabolism data, and histopathology from these experiments that are used for the dose selection. Highest dose employed should be the maximum tolerated dose (MTD) which is defined as вЂњthe highest dose of the test agent during the chronic study that can be predicted not to alter the animalsвЂ™ normal longevity from effects other than carcinogenicityвЂќ. Carcinogenicity tests are similar to chronic toxicity tests. Testing in two rodent species (mice and rats), 50 of each sex per dose level are preferred due to short life span. The exposure period is at least 18 months for mice and 24-30 month for rats. They should be observed for 18-24 months for mice and 24-30 month for rats. Developmental and reproductive toxicity Developmental toxicity testing detects the potential for substances to produce embryotoxicity and birth defects. Developmental toxicity is the study of adverse effects on the developing organism occurring at any time during life span form before conception, during prenatal development or postnatally until puperty. Teratology study involves from conception to birth. Reproductive toxicity testing is intended to determine the effects of substances on gonadal function, conception, birth, and the growth and development of the offspring. The oral route is preferred. Pharmacological studies Apart from safety and efficacy of nutraceuticals, the bioavailability studies are important. Bioavailability is the measurement of the rate and extent of the active ingredient that reaches the systemic circulation. This can be determined by measuring the active ingredient of nutraceuticals or its metabolites from the blood. Active ingredient can be accurately quantitated pharmacokinetically in the plasma (tmax, Cmax and AUC) or urine (rate of drug excretion) gives the most objective data on bioavailability. Pharmacokinetic studies are preferred over pharmacodynamic (deals about mechanism of action) studies. When both pharmacokinetic and pharmacodynamical studies are not possible, then a clinical study can be used in human or suitable animals model with assumption of therapeutic success occurred because there was enough bioavailability when the nutraceuticals was administered. However, various factors such as diet, disease, or genetics, which can make it difficult to understand the success or failure (Shargel, 1993; FDA, 2003). Whenever potentially active metabolites found during human cell culture studies, these metabolites can be studied in laboratory animals to determine their safety and efficacy, which can help determine future in vitro or in vivo human studies. Moreover, animal studies can be used to examine nutraceuticals-drug interactions with regard to parent drug and its metabolites. Since several nutraceuticals (example, Grapefruit and St. JohnвЂ™s Wort) are inhibit or induce a cytochrome P450 which could affect subsequently administrated drug concentrations. Assays for ACE-inhibitory and antihypertensive activity Determination of the ACE inhibitory activity is the most common strategy followed in the selection of antihypertensive peptides derived from milk proteins. In order to facilitate the characterisation of ACE inhibitory peptides, the establishment of a simple, sensitive and reliable in vitro ACE inhibition assay like, spectrophotometric, fluorimetric, radiochemical, HPLC and capillary electrophoresis methods can be used to measure ACE activity. This is usually expressed as the IC50, i.e. concentration needed to inhibit 50% of the enzyme activity. The spectrophotometric method of Cushman and Cheung (1971) is most commonly utilized. The in vivo effects are tested in spontaneously hypertensive rats (SHR), 148 Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticals which constitute an accepted model for human essential hypertension. In addition, in many in vivo studies it is also checked that antihypertensive peptides from milk proteins do not modify the arterial blood pressure of Wistar-Kyoto (WKY) rats that are the normotensive control of the SHR. The results of hypotensive effects caused by the short-term administration to SHR of milk protein hydrolysates, fermented products and isolated milk-derived peptides have been shown to lack of correlation between the in vitro ACE inhibitory activity and the in vivo action. This poses doubts on the use of the in vitro ACE inhibitory activity as the exclusive selection criteria for potential antihypertensive substances, as it does not take into consideration of the bioavailability of the peptides or other mechanism like antioxidant effects. On other hand, long-term intake of milk products on blood pressure of SHR was shown that dose dependent attenuation of the development of hypertension in SHR during 14 weeks of treatment with milk containing the potent ACE inhibitory peptides (Nakamura et al., 1995; Sipola et al., 2002). Hypertension animal models Rats are the most popular species in hypertension. The rat models of hypertension thus provide ample opportunity not only to investigate the mechanisms involved in the pathogenesis of hypertension, but also to learn about the critical balance between stress and coping. Among rats spontaneously hypertensive rat (SHR) is most widely used rat model, although it reflects only a rare subtype of primary human hypertension, which is due to genetic inheritance. SHR stroke prone (SHR-SP) is a further developed sub-strain, with even higher levels of blood pressure, and a strong tendency to die from stroke. Other rat models of hypertension are Dahl (due to genetic inheritance like SHR), deoxycorticosterone acetate (DOCA)-salt, cause hypertension due to hormonal alterations (Contreras et al., 2009). Type 2 diabetic animal models Chemical induced diabetes model can be produced by administrating drugs like alloxan in rat (40-200 mg/kg, iv or ip), mice (50-200 mg/kg, iv or ip), rabbit (100-150 mg/kg, iv), dog (50-75 mg/ kg, iv) can cause diabetes. Administration of streptozotocin to rat (35-65 mg/kg, iv or ip), mice (100200 mg/kg, iv or ip), hamster (50 mg/kg, ip), dog (20-30 mg/kg, iv) can induce diabetus in these animals. Selective loss of pancreatic beta cells, residual insulin secretion and ketosis makes less mortality. Comparatively cheaper, easier to make and maintenance of animals. Disadvantages are, direct cytotoxic action on the beta cells and insulin deficiency rather than consequence of insulin resistance, less stable and reversible. Further, toxic actions on other body organs are constraints in long-term experiments. Though spontaneous type 2 diabetic models are resemble to human being and minimum variability of results with minimum sample size, they are limited availability, costly and required sophisticated maintenance. In dietary or nutrition induced type 2 diabetic models as a result of overnutrition, toxicity of other vital organ can be avoid. However, long period is required to create diabetes and no frank hyperglycaemia develops upon simple dietary treatment. Surgical, transgenic and knock out models of diabetes animals are need cumbersome technical procedure and costly procedure (Srinivasan and Ramarao, 2007). Conclusion Experiments using laboratory animals should be well designed, efficiently executed, correctly analyzed, clearly presented, and correctly interpreted if they are to be ethically acceptable. Laboratory animals are nearly always used as models or surrogates of humans or other species. Animals should be used only if the scientific objectives are valid (i.e. high probability of meeting the stated objectives and reasonable contributing to human or animal welfare, possibly in the long term), no other alternative, and the cost to the animals is not excessive. The reason for choosing their particular animal model and the species, strain, source, and type of animal used should be clear. The вЂњ3RsвЂќ rules (replacement, refinement and reduction) should be followed to humane use of animals. However, it is important to recognizing biological effects with sufficient numbers animals in experiments. The number of animals to be used in an experiment depends on a variety of factors, including experiment objectives, degree 149 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance of precision required, the expected difference between the effects of treatments and structure and methods of analysis. Development and application of the biomarkers to clarify functionality and risk are important to understand the fundamental molecular mechanism concerning health care and disease prevention of nutraceuticals. Through use of advanced technologies to study the relationship between nutrition intake and health associated with genes can be useful for better understanding of nutraceuticals. References Berkowitz, B. A. 2007. Development and Regulation of Drugs. In Basic and Clinical Pharmacology. 10th edition. Edited by Katzung, B. G. New York, NY: McGraw-Hill, pp. 64вЂ“73. Campanella, L., Martini, E., Pintore, M. and Tomassetti, M. (2009). Determination of lactoferrin and immunoglobulin G in animal milks by new immunosensors. Sensors, 9: 2202-2221. Casado, B., Affolter, M. and Kussmann, M. (2009). OMICS-rooted studies of milk proteins, oligosaccharides and lipids, J. Proteomics, 73: 196-208. Contreras, M. del. M., CarroВґn, R., Montero, M. J., Ramos, M. and Recio, I. (2009). Novel casein-derived peptides with antihypertensive activity. International Dairy Journal, 19: 566вЂ“573. Contreras, M. M., LГіpez-ExpГіsito, I., HernГЎndez-Ledesma, B., Ramos, M. and Recio, I. (2008). Application of mass spectrometry to the characterization and quantification of food bioactive peptides. J. AOAC Int., 91 (4): 981-994. Cushman, D.W. and Cheung, H. S. (1971). Spectrophotometric assay and properties of the angiotensin-converting enzyme of rabbit lung. Biochem.Pharmacol., 20: 1637вЂ“1648. DeFelice, S. 2007. The Foundation for Innovation in Medicine. http://www.fi mdefelice.org. Food and Drug Administration. (1985). Guidance for industry: Guideline for the format and content of the nonclinical pharmacology/toxicology section of an application. http:// www.fda.gov/cder/guidance/old032fn.pdf. Food and Drug Administration. (2002). The FDAвЂ™s drug review process: Ensuring drugs are safe and effective. http:// www.fda.gov/fdac/features/2002/402_drug.html. Food and Drug Administration. (2003). Guidance for industry. Bioavailability and bioequivalence for orally administered drug products: General considerations. http://www.fda. gov/cder/guidance/5356fnl.pdf. Food and Drug Administration. (2007). Final rule promotes safe use of dietary supplements. http://www.fda.gov/ consumer/updates/dietarysupps062207.html. Meltretter, J., Schmidt, A., Humeny, A., Becker, C.M. and Pischetsrieder, M. (2008). Analysis of the peptide profile of milk and its changes during thermal treatment and storage, J. Agric. Food Chem., 56: 2899-2906. Morrow, J., T. Edeki, M. El Mouelhi, R. Galinsky, R. Kovelesky, and C. Preuss. (2005). American Society for Clinical Pharmacology and Therapeutics position statement on dietary supplement safety and regulation. Clin. Pharmacol. Ther. 77:113вЂ“122. Nakamura, Y., Yamamoto, N., Sakai, K. and Takano, T. (1995). Antihypertensive effect of sour milk and peptides isolated from it that are inhibitors to angiotensin I-converting enzyme. J. Dairy Sci., 78: 1253вЂ“1257. Shargel, L. and A. Yu. (1993). Bioavailability and Bioequivalence. In Applied Biopharmaceutics and Pharmacokinetics. 3rd edition. Norwalk, CT: Appleton and Lange, pp. 193вЂ“223. Simone, C. D., Picariello, G., Mamone, G., Stiuso, P., Dicitore, A., Vanacore, D., Chianese, L., Addeo, F. and Ferranti, P. (2009). Characterisation and cytomodulatory properties of peptides from Mozzarella di Bufala Campana cheese whey. J. Pept. Sci., 15: 251-258. Sipola, M., Finckenberg, P., Korpela, R., Vapaatalo, H., and Nurminen, M.-L. (2002). Effect of long-term intake of milk products on blood pressure in hypertensive rats. J. Dairy Res., 69: 103вЂ“111. Srinivasan K. and Ramarao P. (2007). Animal models in type 2 diabetes research: An overview Indian J Med Res 125: 451-472. 150 Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation Chand Ram, Manju and Santosh Anand Dairy Microbiology Division, NDRI, Karnal Introduction The human gut habitats >500 species of bacteria and their proper balance is pre requisite for well being of humans and animals. It is established that beneficial microflora must be viable and should remain adhered to the inner surface of the epithelial cells to confer desired health benefits to the host. Various factors such as nutritional requirements, transit time, infections, availability of metabolizable substrates affect microbial ecology of large intestine. Dietary habits influence gut microflora e.g. bifidobacteria dominate breast fed infants which gradually decrease with advancement in age. In addition, food substrate form also plays vital role in determining composition of gut microflora for instance, presence of N- acetyglucosamine, galactose, certain glycoproteins and fucose oligomers in human milk act as specific growth factors for bifidobacteria. Further, low protein and high lactoferrin content in human milk elevate growth of bifidobacteria and inhibit growth of undesirable microorganisms, respectively. Elie Metchnikoff (1907) hypothesized longevity of Bulgarian peasants associated with continuous consumption of fermented milks, the concept of probiotics as known today. Imbalance of microbial ecology of gut can be restored by administration of probiotics. World Health Organization (WHO) has advocated application of probiotics in the form of functional foods for treatment and/or prevention of various ailments. This decade has witnessed advancement in the field of probiotics in the form of synbiotic dairy foods. Hence, it is worth to discuss safety issues related to probiotic vis a vis synbiotic dairy foods. Functional foods and related concepts: Dairy foods have always been a choice of innovation to remain competitive in the market as well as changes in the consumer preference. The primary role of these foods is to provide nutrition and satisfaction feeling to the consumer. However, in recent times apart from nutrition, the trend is towards consumption of functional foods with beneficial microbes to have a state of good health and reduce risk of disease. Dairy products have a distinct role in delivering the probiotics to the host, as these products provide suitable environment for survival and growth. Functional food- Food that satisfactorily demonstrate beneficial effect on one or more target functions in the host, beyond the adequate nutritional effects in a way that is relevant to either an improved state of health and well-being and/or reduction of risk of disease (European Functional Food Science programme, Diplock, 1999). Probiotics- Live microorganisms, which when administrated in adequate amount confer health benefits to the host (FAO/WHO,2002). Probiotic food- That contains viable probiotic microorganisms in adequate numbers incorporated in a suitable matrix so that upon ingestion claimed health effect is obtained in the host beyond regular nutrition. Probiotics adhere to epithelial cell and colonise thereby, improve metabolism, immunity and gut physiology. Prebiotics- Non digestible food ingredients that beneficially affect the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the colon. Synbiotics- A mixtures of pro and prebiotics that beneficially affect the host by improving the survival and implantation of selected live microbial strains in the gastrointestinal tract. Probiotics: Lactic acid bacteria (LAB) including bifidobacteria, natural inhabitant of human gut have been in use for preparation of various functional foods. The product can be called probiotic functional only if 151 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance the effective dose of live organisms present and its health benefit has been shown upon consumption. As per WHO recommendations food must contain 106 cfu/g or 108 cfu/day of viable microorganisms in-take for better probiotic efficacy. Health benefits can be ascribed to probiotics/synbiotics i.e. alleviation of lactose intolerance, improvement in Ca, Fe and Mg absorption, cardiovascular health, anticancer effect, cholesterol assimilation, modulation of immune function, constipation alleviation, prevention/ treatments of diarrhoea and infections, increase in nutrient bioavailability, regularisation of intestinal flow, production of vitamins etc. Some of commercially available probiotics foods in global market are enlisted in Table 1. Prerequisite of probiotic cultures: Probiotic cultures should be selected on the following criteria, irrespective of the intended host or site of application: вЂў Survival in GIT and exhibit health effects in the host. вЂў Proliferation and colonization under the host environmental condition. вЂў Survival in association with the host immune system and non inflammatory. вЂў Immuno-stimulatory for the mucosal immune system. вЂў Production of antimicrobial substances against food spoilage and pathogenic bacteria. вЂў Non-pathogenic, non-toxic, non-allergic, non-mutagenic or anti-carcinogenic, even in immunecompromised hosts. вЂў Genetically stable, non-plasmid transfer and technologically suitable for process applications. вЂў Potential for delivery of recombinant proteins and peptides. вЂў Desirable metabolic activity and antibiotic resistance / sensitivity. New generation probiotics: Due to advancement in health and nutrition science, new cultures and novel probiotic products are being introduced in market. These will require well established safety assessment procedures, e.g. in the European Novel Foods Directive and in the US Premarketing Approval Clearances are must. вЂў Novel probiotic species: Majority of probiotics belong to the genera Lactobacillus, Bifidobacterium, Lactococcus, Leuconostoc, and Propionibacterium with GRAS status. However, other organisms such as Oxalobacter formigenes, Enterococcus fecalis and Escherichia coli do not enjoy the same status and possibly more strict safety assessments are necessary to give clearance to novel probiotics for incorporation into synbiotic products. вЂў Genetically modified probiotics: Dairy food containing genetically modified (GM) probiotics have low consumer acceptance in many countries e.g. Europe. However, GM probiotics posses potential in clinical applications e.g. delivery of antigens for vaccines and thus are more readily accepted. This would provide a safer method of vaccination than the use of attenuated pathogens e.g. GM, Lactococcus lactis, produce IL-10 in the mouse intestine. This may provide new treatment strategies for inflammatory bowel disease, and similar applications may be useful for other diseases. The safety of such organisms that produce very powerful bioactive substances is of major concern as excess production of these substances in a healthy individual may be detrimental. вЂў Non-viable probiotics: Generally probiotics are live microbes, however, non-viable probiotics may also have beneficial health effects. These are likely to be in the market due to practical and economic advantages; longer shelf-life, transportation and storage, safety etc. These could be considered safe when used in extremely high-risk immune-suppressed patients. вЂў Novel applications: The main application for probiotics is their use in foods, aiming at affecting the composition or activity of the intestinal microflora or directly affecting the function of the intestine. However, the probiotic principle should be expected to work in any part of the body that has a normal microflora. With the exception of the urogenital tract, extra-intestinal 152 Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation applications of probiotics have received little attention. Such probiotic preparations would clearly need different safety requirements. вЂў Animal probiotics: Probiotics application in animals requires more strict safety assessment and should be safe to both. Because of probiotics application in farm animals, these may enter the food chain. Intimate relationship between pet and its owner result spread of probiotic from animal to human is possible. Enterococci are commonly used in animal preparations and this may be reason for some concern. The safety requirements for animals are different from those for humans. Few studies suggest that Lactococcus garvieae is associated with mastitis in cows and septicaemia in fish as well as disease in humans. However, its true pathogenesis for humans remains to be determined. Challengages for use of probiotics in food systems: вЂў Acid sensitivity is principal factors for poor viability of probiotic cultures particularly bifidobacteria in fermented dairy foods. However, microencapsulation technique can be used to improve viability of acid sensitive cultures in food systems. вЂў Oxygen sensitivity is of particular relevance to bifidobacteria as they are strict anaerobes. Toxic effects of oxygen can be overcome; milk may be deaerated prior to fermentation. Alternatively, use of impermeable packaging may eliminate the toxic effects of oxygen during product storage. Addition of reducing agents such as cysteine or oxygen scavengers such as ascorbic acid and selection of oxygen tolerating strains may also improve the tolerance of probiotic cultures to oxygen sensitivity. вЂў Processing parameters such as thermo tolerance is an important parameter when considering microbial survival in food processes such as spray-drying. Within the genera most often employed as probiotics, certain strains and species are more heat tolerant than others e.g. вЂњthermophilicвЂќ lactobacilli. Safety issues of probiotics for humans: вЂў Probiotic cultures used for preparation of functional dairy foods should be safe even in immunecompromised individuals. Long history of LAB usage in preparation of fermented food provides them generally regarded as safe (GRAS) status. WHO and LABIP outlined following parameters for their safety (Table 2.). Table 1. Commercial probiotic foods in the global market SN Commercial preparation Probiotic cultures 1 Acidophilus milk Lactobacillus acidophilus 2 Sweet acidophilus milk Lb. acidophilus 3 Acidophilin Lb. acidophilus, Lc. lactis subsp. lactis, kefir yeasts. 4 Nu-Trish A/B Lb. acidophilus, Bifidobacterium spp 5 Diphilus milk Lb. acidophilus, B. bifidum 6 Biomild Lb. acidophilus, B. bifidum 7 CulturaВ® or A/Bmilk Lb. acidophilus, B. bifidum B. longum (CKL 1969) or B. longum (DSM2054) 8 Bifighurt 9 Acidophilus buttermilk Lb. acidophilus, Lactococcus lactis subsp. lactis, subsp. cremoris, subsp. lactis biovar. diacetylactis 10 Acidophilus-yeastmilk Lb. acidophilus, Saccharomyces lactis 11 Bifidus milk B. bifidum or longum 12 Yakult Lb. casei Shirota 13 Yakult Miru-Miru Lb. casei, B. bifidum or B. bereve, Lb. acidophilus 14 A-38 fermented milk Lb. acidophilus, mesophilic lactic cultures 15 Onaka He GG, Str. thermophilus, Lb. delbrueckii subsp. bulgaricus, 16 Gefilus (Valio Ltd) Lactobacillus rhamnosus GG В® 153 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 17 CHAMYTO Lb. johnsonii, Lb. helveticus 18 Vitagen Lb. acidophilus 19 Procult drink B. longum BB536, Str. thermophilus, Lb. delbrueckii subsp. bulgaricus 20 Actimel Lactobacillus casei ImmunitasTM 21 AKTfit, Biola, BioAktiv, YOMO, LGG+, Actif Yoplait 360Вє , Kaiku Lb. rhamnosus GG 22 Gaio Lb. casei F19 23 Verum Lb. rhamnosus LB21 24 ProViva Lactobacillus plantarum 299v Adopted from Ozer and Kirmaci, 2009 Guidelines for evaluation of probiotics (FAO/WHO, 2002): вЂў Strain identification by phenotypic and genotypic methods (Section 3.1) вЂўGenus, species, strain вЂўDeposit strain in international culture collection вЂў Functional characterization (Section 3.2) вЂў In vitro tests вЂў Animal studies вЂў Safety assessment (Section 3.3) вЂў In vitro and/or animal вЂў Phase 1 human study вЂў Double blind, randomized, placebo-controlled (DBPC) phase 2 human trial or other appropriate design with sample size and primary outcome appropriate to determine if strain/product is efficacious (Section 3.4) вЂў Preferably second independent DBPC study to confirm results вЂў Phase 3, effectiveness trial is appropriate to compare probiotics with standard treatment of a specific condition вЂў Labeling (Section 3.5) вЂўContents вЂ“ genus, species, strain designation вЂўMinimum numbers of viable bacteria at end of shelf-life вЂўProper storage conditions вЂўCorporate contact details for consumer information. Table 2. Safety assessment scheme for probiotic cultures SN Attribute Safety issues for assessment 1 Intrinsic strain properties Adhesion factors, antibiotic rГ©sistance, plasmid transfer, enzyme profile 2 Metabolic products Concentrations, safety, and other effects 3 Toxicity Acute and sub acute effect of ingestion of large amounts of cultures 4 Infective properties In vitro with cell lines ; in vivo with animal models 5 Dose- response effects Oral administration in volunteers 6 Clinical assessments Potential for side effects and disease-specific effects; nutritional studies 7 Epidemiological studies Surveillance of large populations following introduction of new strains and products Prebiotics: The prebiotic application is directed to support growth of LAB due to their proposed health promoting properties. The latest definition results in an equalization of вЂ�prebioticвЂ™ and вЂ�bifidogenicвЂ™ which includes 154 Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation in the definition the prebiotic index (i.e. absolute increase in fecal bifidobacteria concentration/g of daily consumed prebiotics. Some of the properties of food ingredient to be classified as prebiotic are listed in the Table 3. Table 3. Desirable attributes of functional prebiotics Desirable attribute in prebiotic Properties of oligosaccharides Active at low dosage and lack of side effects Selectively and efficiently metabolised by вЂ�beneficialвЂ™ bacteria but not by gas producers, putrefactive organisms, etc. Persistence through the colon Controlled molecular weight distribution Protection against colon cancer Stimulate butyrate production in the colon Enhance the barrier effect against pathogens Structural basis unknown Inhibit adhesion of pathogens Possess receptor sequence Targeting at specific probiotics Selectively metabolised by restricted species of Lactobacillus and/or Bifidobacterium Table 4: List of some selected prebiotics SN Recognized prebiotics Emergent prebiotics 1 Fructo-oligosaccharides (FOS) Genti-oligosaccharides 2 Galactooligosaccharides (GOS) Gluco-oligosaccharides 3 Galacto-oligosaccharides (GOS)/ transgalactosylatedoligosaccharides (GOS/TOS) Isomalto-oligosaccharides (IMO) 4 Inulin Lactosucrose 5 Isomalto-oligosaccharides Levans 6 Lactulose Pectic-oligosaccharides 7 Pyrodextrins Resistant starch 8 Soy-oligosaccharides (SOS) Sugar alcohols 9 Xylo-oligosaccharides (XOS) Synbiotics: Another promising approach to manage correct balance of gut microflora is the use of synbiotics. These also improve survival of bacteria during storage and passage of upper part of GIT, thereby enhancing their health effects in the large intestine. The combined effects of synbiotics can be additive or even synergistic. Synbiotics foods with defined health benefits: All the commercial probiotics are highly selected to have useful properties such as resistance to acid and bile and technological stability to freeze-drying and product preparation. However, to transfer health benefits to the host synbiotic approach holds promise such as immune stimulation, cancer prevention, anti-pathogen activity etc. It would be expected that synbiotic versions of probiotic strains made with targeted prebiotics would display better survival and colonisation in the gut. It would be highly desirable to develop targeted prebiotics at particular species of microorganisms. Infant formulae and weaning foods: Bifidogenic factors in milk stimulate the growth of bifidobacteria that result health benefits to the infant, including a decreased susceptibility to microbial infections. Breast fed infantsвЂ™ gut is dominated by bifidobacteria while of formula-fed with mixed microflora resemble that of an adult. The supplementation of infant milk formula with non-digestible compounds would support growth of bifidobacteria. Hence, it would be of great interest to produce prebiotics with high selectivity towards growth of bifidobacteria that are present in the gut of breast-fed infants as the basis of novel infant food formulations. 155 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Functional foods for healthy ageing: Bifidobacterial population decreased markedly in the colon of elderly person (55вЂ“60 years of age) as compared with those of young adults. Species of Bifidobacterium are reasonable target for prebiotic viz., B. infantis and B. breve are predominant in infants, whereas B. adolescentis and B. longum in adults. Decrease in bifidobacterial numbers results in reduction in resistance to gastrointestinal infections and thus elderly people suffer more with such ailments. Development of targeted prebiotic that promotes the probiotic strains able to inhibit gastrointestinal pathogens viz., E. coli, Salmonella sp. and Campylobacter jejuni. Development of targeted prebiotics: Targeted prebiotics for probiotic can be developed firstly by screening a wide range of oligosaccharide for their prebiotic attributes which will provide information about their selectivity towards particular species. Structural diversity and cost effective manufacture technology for complex oligosaccharides is most important. The second approach is enzymes expressed probiotics which can act as synthetic catalysts. These enzymes will produce a mixture of oligosaccharide, which inturn may be more readily metabolised by the producing organism, resulting in higher selectivity. Novel ОІ-galacto-oligosaccharide mixtures have been synthesised from lactose using ОІ-galactosidases from a range of prebiotics. Technologies for manufacturing prebiotics First generation prebiotics are either extracted from plants or manufactured from cheap, readily available sources, generally by means of enzymatic hydrolysis or synthesis reactions. Second approach is enzyme hydrolysis of polysaccharide. Fungal inulinase is used to hydrolyse chicory inulin to oligosaccharides with low monosaccharide contents. Fructo-oligosaccharides and xylo-oligosaccharides are both manufactured by hydrolysis of their parent polysaccharides. Fructooligosaccharides can also manufactured by synthesis from sucrose. Consequently, FOS produced from inulin have reducing activity. The probiotic like Galactooligosaccharides, lactosucrose, isomaltooligosaccharides (IMO) and some fructooligosaccharides are manufactured by enzymic glycosyl transfer reactions from cheap sugars such as sucrose and lactose or from starch. All of the sucrosederived FOS terminate in a non-reducing glucose residue. Ion-exchange chromatography can be used to remove glucose and sucrose. Second generation prebiotics: If the full potential of enhanced prebiotics is to be realised, new technological innovations will be required. The challenge, as ever, for biotechnologists is to achieve the manufacturing technologies at economically viable costs. Two areas of development are being explored in laboratories in Europe at the current time. Controlled polysaccharide hydrolysis: Polysaccharide hydrolysis is a commercial manufacturing approach for prebiotics. In this a more controlled partial hydrolysis carried out in order to achieve control over the molecular weight distribution of the products. Different IMO with average molecular weights up to 12,000 Da can be prepared by controlled partial hydrolysis of dextran and pectins by endo-dextranase in an enzyme membrane reactor by controlling residence time and ratio of enzyme to substrate. The fractions displayed good prebiotic fermentation in vitro. Safety of pre & probiotics: Probiotics mainly belongs to genera of Lactobacillus or Bifidobacterium, have been in use to confer health effects as they enjoy status of Generally Regarded as Safe (GRAS) due to their long history of safe use. Various in vitro tests are available to evaluate efficacy and safety of pro and prebiotics. However, most probiotics do not have a documented history of safe use hence, safety evaluation is quite necessary. Some of the issues of probiotics concerned to safety are as below: вЂў 156 Antibiotic resistance: Presence of antibiotic resistance encoding genes must be determined in order to prevent transmission of drug resistance to undesirable organism. The antibiotic resistance gene specially vancomycin resistance should not be unstable plasmid encoded in probiotic organisms as this is one of the last antibiotics used as an effective tool against multidrug- Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation resistant staphylococci. It is recommended not to use any vancomycin-resistant Enterococci as either human or animal probiotics. вЂў Strain Identification: This is not possible that all strains genus would confer probiotic health benefits to the host. Proper identification of the organism is desirable by using internationally accepted molecular tools such as DNA-DNA hybridization, 16S rRNA, pulsed field gel electrophoresis (PFGE) or randomly amplified polymorphic DNA (RAPD), newer system such as terminal restriction fragment-length polymorphism (T-RFLP) etc to give proper designation so that it can be easily accessible by researcher. After identification the strain must be deposited in a collection centre so that it can be easily available for workers. вЂў Metabolic activities: Certain probiotics are capable to convert food components or biological secretions into secondary metabolites which could be potentially harmful to the host. Hence, these should be assessed for the following parameters: вЂў Biogenic amines: These are produced during degradation of food proteins by certain LAB due to deaminase activity, whish is considered as detrimental effects of probiotics. The candidate probiotic can be evaluated for this activity decarboxylase broth using Bover-Cid and HolzapfelвЂ™s method. вЂў Bile salt deconjugation: Bile salts are water soluble end products of cholesterol metabolism in liver and assist in the lipid digestion. They are absorbed actively in the terminal ileum and are subsequently re-secreted, thereby form an enterohepatic cycle. During the microbial bile acid metabolism first step is deconjugation as these are less effective in solubilisation of dietary lipids. Further, too early and too much deconjugation, particularly in the upper small intestine may disturb the lipid digestion and subsequent uptake of fat-soluble vitamins. Primary bile acids can subsequently be dehydroxylated to yield secondary bile acids. The latter are most hydrophobic and toxic to hepatocytes and the gastric and intestinal mucosa, and have been suggested to be cancer promoters and to be involved in the formation of gal stones. Considering the detrimental properties of secondary bile acids, no increase in 7О±- dehydroxylase activity can be accepted anywhere in the intestine. Potential probiotics and starters should not exhibit this property. вЂў D (-) lactic acid Production: Mammalian tissues lack D-lactate dehydrogenase (DLDH) enzyme to metabolize D(-)-lactic acid. Production of D(-)-lactic acid by probiotic bacteria, is also a concern to use them in children, due to D(-)-lactic acidosis. Acidosis is a pathologic condition characterized by neurological alterations. вЂў Others-binding: The binding of probiotics to mucosal layer is one of the prime selection criteria as it is more important for immune modulation by competitive exclusion of pathogens. However, binding is also a first step for the pathogenesis. Probiotics adhere to the extracellular matrix (ECM) proteins typically exposed in wound tissue. Pathogens often have affinity for these proteins, which also serve as receptors for invading microbes. Many lactic acid bacteria have been observed to be able to reduce bioavailability of certain toxins by absorption viz., absorb environmental toxins; mycotoxins, heterocyclic amines etc. Although, absorbing these compounds is desirable trait, it is important that such organisms do not be able bind to therapeutic compound or essential nutrients. вЂў If the strain under evaluation belongs to a species with known hemolytic potential, determination of hemolytic activity is required вЂў Assessment of lack of infectivity by a probiotic strain in immunocompromized consumers (add a measure of confidence in the safety of a probiotic) вЂў Animal and human studies: Assessment of side-effects, epidemiological surveillance (postmarket) and degradation of mucines must be carried out. 157 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Evaluation of prebiotic: вЂў Prebiotic characterisation: The component which is claimed to have prebiotic attribute(s) must be characterised for source, origin, purity, chemical structure, composition, concentration and amount required to be delivered to the host. вЂў Functionality evaluation: Correlation of physiological effect and modulation of intestinal microflora should be substantiated based on studies tested in the target host with the final product type alongwith time framework. A prebiotic can be a fiber but a fiber need not be a prebiotic. FAO has recommended the following guidelines for safety evaluation and substantiation of prebiotic (Figure 1): вЂў If the product has long history of safe usage then it should be considered as GRAS status and thus no need for further human and animal trials. If it is a new candidate, safe levels must be determined. вЂў Levels of consumption for safe and minimum side effects must be established. вЂў The product must be free from contaminants and impurities, characterisation of contaminant should be done with toxicological studies. вЂў The prebiotic must not alter the gut microbiota in a way detrimental to the host. Global regulatory status: The dietary supplement market for probiotics/synbiotic is gaining momentum at a very fast pace over the globe, hence, regulation of these products is must consumers safety. UNITED STATES: FDA controls the safety of foods of dietary supplements and probiotics that are sold as components of conventional foods or as dietary supplements. The safety of traditional LAB has been granted GRAS status. However, new and less traditional strains of microbes have to be more carefully assessed prior to distribution to consumers with potentially compromised health. In the US, Title 21 of the Code of Federal Regulations (21 CFR). EUROPEAN UNION: Probiotics/ synbiotic dairy foods fall under EC Novel Foods Regulation (258/97) to ensure the free movement of novel foods, while protecting the interests of consumers, especially with respect to safety, health and information. GERMANY: Occupational foundation of chemical industry has established an expert group to assess the safety of microbiology and biotechnology. This expert group has also assessed the safety of microbes and Figure1 Guidelines to evaluate and substantiate a product as published a list containing the classification of prebiotic (FAO Technical Meeting, 2007) bacteria used by different industries including food and feed industries (Berufsgenossenschaft der chemischen Industrie, 1998). JAPAN: Probiotics/ functional foods fall under the Food for Specified Health Uses (FOSHU) regulation. FOSHU regulations do not specifically define the safety aspects for probiotic microbes but for functional foods in general and to get FOSHU status company has to get it from Ministry of Health and Welfare. 158 Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluation International Dairy Federation(IDF): An expert action team has been constituted in collaboration with European Food and Feed Culture Association to prepare a position document on properties of dairy starters and probiotics to be used by the dairy industry.. Conclusion and future perspectives: The current safety record of food starter cultures and probiotics appears to be excellent in developed countries. Although, safety regulation related to functional/ probiotic / symbiotic foods yet to be formulated in India. The future development of probiotics/ synbiotics and also industrial dairy starters requires stringent guidelines for safety assessment of such organisms. Hence, constant surveillance of probiotics/synbiotics is essential specially in clinical applications. Development of safety assessment tools is extremely important for both premarket safety assessment and post-marketing surveillance of human populations to guarantee safety of future products in humans and animals including immunecompromised. This will enable the future use of microbes and microbial fermentations for a widening area in food technology and in functional and clinical food areas. References: Diplock A. T. 1999. Scientific concepts of functional foods in Europe: Consensus Document. Br J Nutr, 81(Suppl 1), S1вЂ“S27. Granato D., Branco, G.F., Cruz, A. G., Faria, J.A.F. and Shah, N.P. 2010. Probiotic dairy products as functional foods. Comp. Rev. Food Sci. Safety.9:455-470 Ozer, B.H. and Kirmaci, H.A. 2009. Functional milks and dairy beverages. Int. J. Dairy Tech. 63(1):1-15. Ross, R.P., Desmond, C., Fitzgerald, G.F. and Stanton, C. 2005. Overcoming the technological hurdles in the development of probiotic foods. J. Appl. Micro. 98:1410-1417. Suvarna, V.C. and Boby, V.U. 2005. Probiotics in human health: A current assessment. Curr. Sci. 88(11):1744-1748. 159 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water Activity R. R. B. Singh and Prateek Sharma Dairy Technology Division, NDRI, Karnal Physical properties of foods are manifestations of its inherent compositional make up and structural organization of its molecules. While the intrinsic properties of the foods are largely determined by factors controlled by the material itself, the extrinsic factors are influenced by external conditions. The composition of foods could be determined by either genetically or technologically induced factors. The physical properties of milk components affect the functional properties of the processed foods and are therefore of significant importance with regard to new product development or selection of new processing technologies for designing a new product formulation or packaging condition. The principal physical properties of processed dairy foods could include rheology, color, and water activity. Viscosity: Texture and rheology are two important physical properties of foods. While texture refers to sensory perception of the force-deformation relationship, rheology generally refers to response of foods as exemplified by flow properties to application of definite stress or strain. Therefore instrumental data can be usefully related to sensory data for interpreting the consumer assessment of the sensory quality of a product. Instrumental data can be alternatively also used for designing equipments, packaging requirements, processing conditions and evaluation of the finished product quality. Instrumental methods measuring rheology can be classified as (i) empirical or (ii) fundamental methods based on the test conditions in relation to the applied force and the resulting deformation (or flow) coupled with the sample geometry. The empirical methods represent large-deformation data (destructive tests) generated under specified test conditions and are highly product-specific. The data generated are useful when a comparison is to be made between different products tested under identical test conditions. Therefore these data are relevant when effect of processing variables or storage conditions on the rheological properties is to be evaluated and are also appropriate for quality tests carried out routinely. On the other hand the fundamental methods are based on small deformations (non-destructive tests) and the data are generated in well defined (physical or engineering) units of mechanical properties viz., viscosity for fluids and various modulii for solids. The results are independent of the test conditions and appropriate for engineering design considerations. However, rheological parameters measured using fundamental methods are relevant to pure engineering materials rather than complex materials such as foods. Furthermore, while the fundamental rheological measurements are made in a compression, tension, torsion or shear mode, empirical methods make measurements in terms of penetration, extrusion, pressing etc. Liquid foods are often characterized in terms of viscosity. The rheological behavior of fluids may be Newtonian, pseudoplastic, or Bingham, depending upon the manner in which shear stress varies with shear rate and time (Fig. 1). While the Newtonian fluids exhibit a viscosity which does not vary with the shear rate, the viscosity of non-Newtonian foods is shear-dependent. Non-Newtonian foods are hence classified as either shear-thinning type (decreasing viscosity with increasing shear rate) or shear-thickening (dilatant) type (viscosity increases with increasing shear rate), the former being most common to fluid foods. For example, milk with 30% or more total solids is shear-thinning. Alternately, a series of measurements may be made on a non-Newtonian product using a range of shear rates and the stress-shear rate relationship from the set of data generated expressed in terms of parameters of an appropriate mathematical expression, such as вЂ�consistency coefficientвЂ™ and вЂ�flow behaviour indexвЂ™ in the most frequently used вЂ�power lawвЂ™ model. 160 Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water Activity О·=K.Оіn-1 Where О·=viscosity, Оі= shear rate, K=consistency co-efficient and n=flow behaviour index Pseudoplastic fluids which exhibit shear thinning are the most common among the nonNewtonian fluids and include emulsions and many types of dispersions (Fig. 2). Dilatant fluids contain higher levels of deflocculated solids such as corn starch in water. Plastic fluids behave as a solid when static and flow only upon application of certain amount of force referred as yield value. Tomato ketch up is a good example of such fluids. Plastic fluids may display Newtonian, pseudoplastic or dilatant properties. Many high viscosity fluids exhibit thixotrophic behaviour which implies that the viscosity drops even at constant shear rate as a result of structural breakdown of food components until a point when it attains a constant Fig. 1. Typical time independent fluids curves value. Subsequently upon quiescent storage of such fluids, structure rebuilds and the viscosity is restored to a limited extent generally below the original value. Rheopexy fluids which are rarely encountered behave opposite to thixotrophy a n d viscosity increases with time when it is sheared at constant rate. In many cases both rheopexy a n d thixotrophy may occur in combination with any o f the flow behaviours described above. However time is a critical factor when shear rate is constant and therefore while some fluids may take only f e w seconds for the viscosity to become constant, other may take much longer time. Most pseudoplastic liquid foods follow the power law but the value of t h e exponent, which reflects the extent of digression from Newtonian flow, has not been determined for many dairy and food components. These flow properties Fig 2. Rheogram of pseudoplastic fluids of these fluid foods affect the mouthfeel and therefore are very important in determining the acceptability of food. Colour: Colour is another important physical parameter that is important from the point of view of characterizing the dairy products. This is also an indicator of chemical reactions that occur leading to formation of chemical compounds during processing or subsequent storage of the processed foods. These compounds are generally absent or are present in negligible quantities in the raw products and are formed when these are thermally processed. Therefore often the formation of these compounds is linked to measurement of severity of heat treatment. Storage induced enzymatic or non-enzymatic changes are also associated with formation of compounds that lead to change in the colour profile of the products. Color measurement techniques are used for recording desirable color changes in canning salmon with higher oil content, defining translucency of the tissues and green pigment degradation after blanching treatment of green peas, studying browning kinetics, or determining the influence of particle sizes in the final color of powders. Characterization of the color of ingredients can also help to predict the color of the final productвЂ”for example, control of raw strawberries for processing into jam. In red wine, the percentage of brown component and the relative loss of anthocyanin can be followed by reflectance measurement during storage. 161 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance The color of foods as perceived by the human eye is related to the factors such as the spectral composition of the source of light, the food properties, and the spectral sensitivity properties of the eye. Therefore instrumental measurement of colour of any food requires that at least two of these factors are standardized. As such the human eye can give fairly good estimate of the colour properties of the food however replacing it with instrumental sensor or photocell is known to give a more consistent and reproducible measure of this attribute. Early instrumental methods for color measurement were based on transmission, or reflection, spectrophotometry. However modern system of color measurement is based on CIE, Munsell, Hunter, and Lovibond systems. The important factors in these systems are source of light, geometry of viewing, and background colour. Colour may be specified in terms of three characteristics of light: Hue, saturation and brightness. Hue represents dominant wave-length in a mixture of light waves and therefore relates to the dominant color as perceived by the eye. Saturation measures relative purity or the amount of white light whereas brightness refers to chromaticity of the intensity. Hue and saturation are together called chromaticity. In CIE system, spectral curves as illustrated in Fig. 3 indicate the response of observers eyes to various spectral light types in the visible portion of the spectrum. It demonstrates that any colour can be matched by mixing different proportion of red, green, and blue. These primary combinations are called tristimulus values of color. The definite colour of an object can be thus defined in terms of chromacity coordinates x and y, and by the luminous transmittance or lightness. A chromacity diagram defines different color points that define the standard color of a food. The Munsell system (Fig. 4) describes all colors by three attributes: hue (or type of color), lightness (relative to the proportion of light emitted), and saturation or purity (associated with clear to dark perception). The hue scale has ten hues distributed on a circumference (scaled 1 to 10); the lightness ranges from black to white (0 to 10) and is distributed on a perpendicular line; the purity is of irregular length beginning with 0 for the central gray to the limit of purity obtainable by available pigments in the Munsell book of color. The Hunter system is also a three-dimensional system using parameters L*, a*, and b* in each dimension: L* is the lightness (nonlinear), a* is redness or greenness, and b* is yellowness or blueness. Combination of L*, a*, and b* can be converted to a single color. The Lovibond system is generally used for determining the color of vegetable oils. It makes comparison Fig. 3 CIE color system of visual light transmitted through a glass couvette using color filters. The oil samples oils are generally expressed in terms of red to yellow. The Lovibond index are also used to measure color in wines and juices. Modern instruments use software to convert light transition spectra into CIE, Munsell, Hunter, and Lovibond color indices.Color can be measured instrumentally with Colorimeters are also frequently used to measure colour and can be broadly classified as tristimulus colorimeters and spectrophotometers. The difference between spectrophotometers and colorimeters is that the former measures intensity of light through the completely visible spectrum, and colorimeters are designed to measure only some parameters related to sensory colors. Colorimeters are particularly suitable for quality control of foods, and give Fig. 4. Munshell colour system results correlated with visual measurements. 162 Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water Activity Water activity: The water activity of food can be conveniently expressed as the equilibrium water vapour pressure (PW) over the food system divided by the vapour pressure of pure water (Pow) at the same temperature and atmospheric pressure: The water activity is correlated to the moisture content of foods. This relationship is known as water sorpition isotherm. The water sorption isotherm for most of the food products is sigmoid in shape. It can be divided into segments representing the aw ranges in which the three principal types of water binding predominates. The region lying between aw value of 0 and 0.25 is believed to be dominated by water bound by ionic groups such as NH3 associated with proteins and -COO- groups associated with proteins, pectins Table 1. Approximate aw levels of some dairy products and other polyuronic acids. The moisture in this region is tightly bound (known as monolayer moisture), which is PRODUCT aW at 25В°C generally not available for either chemical or microbiological Dried Milk Products 0.1-0.3 activities. The region lying between aw values of 0.25 and 0.75 Butter, Unsalted >0.99 appears to be related primarily to covalently bound water, such Salted 0.91-0.93 as amide groups in proteins and -OH groups in proteins and Sweetened Condensed Milk 0.77-0.85 carbohydrate polymers such as pectins, starch, hemicellulose Cheese, Hard 0.86-0.97 and cellulose. In this region, water is bound sufficiently Soft 0.96-0.98 tightly that it is unavailable to most of the microorganisms but Fresh 0.98-0.99 available for chemical activity. The region lying between aw Cream >0.99 values of 0.75 and 1.0 is believed to represent water multilayers Frozen Desserts 0.98-0.99 on protein and carbohydrate polymers, in addition to water Fermented Milk Products 0.97-0.99 in which the vapour pressure is reduced by dissolved solutes, Milk And Whey 1 such as free amino-acids, sugars, and/or capillary attraction in Khoa 0.96 the microstructure.The water in this region is loosely bound Paneer >0.99 and is available for chemical and microbial activities. The water Fried Paneer 0.97 activity of various dairy products is presented in Table 1. Information on water binding is helpful in determining the energy requirements and conditions for drying of specific materials; controlling the growth of microorganisms to minimize quality deterioration; ensure safety, and selecting the appropriate microflora in certain foods, e.g. ripening cheese; for evaluation of water uptake, porosity, sorption/desorption enthalpies; estimation of specific surface area, crystalline state of components (lactose), and facilitating control of several chemical, physical and quality attributes of stored foods in addition to ensuring microbial stability. Besides determinant role played by aw in influencing the stability of quality parameters, aw has many other practical applications such as prediction of packaged product moisture gain/loss and prediction of shelf-life of packed food. Measurement of water activity: Analytical instruments or methods for aw value determination are many. The important ones are: Hair hygrometers, Isopiestic methods, Electronic hygrometers etc. Hair Hygrometry: Measurements is based on the magnitude of longitudinal change in length of water-sorbing fibre in the same container at equilibrium. This measurement is based on the principle that the keratinaceous proteins in hair strands stretch under tension, when they absorb moisture. If the hair strand is fixed at one end and attached to an indicating lever arm at the other end, the relative humidity within an enclosure can be read directly. The hair hygrometer is a dial-type polyamide thread hygrometer. This type of hygrometer is relatively inexpensive. Its accuracy is comparable to others (i.e. + 0.02 upto 0.01). 163 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Isopiestic Methods: This method provides the measurement of equilibrium relative humidity of any aqueous systems in a closed container at a specified temperature. This is based on a principle that most food substances are consistently adjusting their moisture content through absorption or desorption processes depending upon the moisture condition and temperature of the environment until the food substances approach equilibrium. In other words, the equilibrium vapour pressure of the reference salt slush will be identical to the vapour pressure of the sample at equilibrium condition. In this method, multiple samples must be measured at different equilibrium conditions using different salt slushes in desiccators. Upon equilibrium the sorption isotherm is drawn and the aw is measured against moisture content of the food. Electronic Hygrometers: This type of instrument features the use of calibrated aluminium oxide or lithium chloride humidity sensors. Recalibration or standardization of sensor response is by a set of reference salt slushes. Water activity measurement is carried out by connecting the appropriate sensor to an airtight food sample container and equlibrated at a specified temperature. Since the sensor is sealed in a small container, it usually takes less than 2 hr for a sample to approach equilibrium conditions. These instruments provide a better and convenient means of aw measurement with adequate accuracy and precision. However, they are susceptible to contaminants such as SO2, H2S, Chlorine and oil vapours. Temporary contaminants include ammonia, acetic acid, alcohols, glycol, glycerols, etc. depending upon the sensor material used. Foods usually contain these contaminants, thereby reducing the useful life of the sensors. The instrument using principle of chilled mirror dew point measurement to calculate aw of a given food sample is one of the frequently used systems. When a sample is placed in the instrument, a stainless steel mirror within the chamber is repeatedly cooled and heated. The mirror temperature is controlled by a thermoelectric (Peltier) cooler. A fan placed in the instrument continually circulates air in the sensing chamber to hasten the equilibration process. The precise determination of the temperature at which the condensation first appears is done with a photoelectric cell. The photodetector senses the change in reflectance when condensation occurs on the mirror. The temperature at which the condensation occurs is recorded with the help of a thermocouple attached to the mirror. Simultaneously, the sample temperature is also measured. Both the temperature of sample and the mirror temperature are used for calculating the aw. The aw is calculated and compared with the previous measurement and the process terminates with a beep only when two consecutive readings does not differ by more than 0.001. The instrument thus displays the temperature of sample and aw. References: Sogi D. S (2008). Fundamentals of rheology. In compendium of the short course on вЂњSensory and related techniques for evaluation of dairy productsвЂќ under Centre of Advanced studies held at Karnal from June 17-July 07, 2008214-220, pp.66-71. Rao M. A (2005) Rheological properties of liquid foods. In: Engineering properties of foods (Ed M. A. Rao, A. K. Datta and S. S. H. Rizvi) CRC Press, USA. Patil G. R. (2003) Water activity of foods in relation to packaging. In compendium of the short course on вЂњAdvances in Packaging of Dairy and Food ProductsвЂќ under Centre of Advanced studies held at Karnal from February 13 вЂ“ March 05, 2003, pp.66-71. Francis F J (2005) Color properties of foods. In: Engineering properties of foods (Ed M. A. Rao, A. K. Datta and S. S. H. Rizvi) CRC Press, USA. 164 Malt Based Milk Foods as вЂњValue Added Functional Dairy ProductsвЂќ Malt Based Milk Foods as вЂњValue Added Functional Dairy ProductsвЂќ Laxmana Naik, Rajan Sharma, Manju G. and Amit K. Barui Dariy Chemestry Division, NDRI, Karnal Introduction: Food is a basic nutritional requirement, but as a result of substandard diet, approximately 925 million people are suffering from undernutrition in different regions of the world. Consequently a larger population in the underdeveloped world fall prey to the protein deficiency On the other hand busy lifestyles fragmented eating habits, change in consumer perception towards physical appearance, dietary choices and more importantly demanding an ideal wholesome food that address many diet and health related issues. Thus there is a need for developing a value added nutritional food supplement. Much of scientific evidence has shown that there is a strong positive relationship between consumed foods and human health, and that there is a beneficial correlation between the function of various food components to the treatment and prevention of specific illnesses. Therefore, consumer interest has focused on a diet with the capability to promote good health and to extend a healthy life span, this strongly promoted in the functional foods development. What makes a Functional food and what is the best source? Functional foods may be defined as any food, in a natural or processed form, that contains, in addition to its nutritional components, substances which favor the good health, physical capacity and mental wellbeing of an individual. (Vasconcelles, 2001). Most of the individual foods are deficient in one or other type of constituents which are very essential to human health. To prepare a diet nutritionally complete it is essential to make a complement of two or more foods which synergistically makeup the deficiency of each other. Milk is an ideal food but milk proteins are deficient in sulfur containing amino acids like methionine and cystein. Cereals on the other hand are generally deficient in lysine, threonine and tryptophan. Thus in order to develop a balanced food cereal protein should be supplemented with milk protein. Nutritional merits of milk are well acclaimed. The malted barley is rich source of readily digestible carbohydrates, proteins and provides a carbohydrate splitting О±-amylase enzyme which hydrolyses the insoluble starch ingredients into readily soluble sugars like maltose, dextrose, glucose etc. This is also a good source of soluble fiber like ОІ-Glucans and other health-promoting components. Recently U.S. Food and Drug Administration finalized a rule that allows foods containing barley to carry a claim that they may reduce the risk of coronary heart disease. Hence special supplement and enrichment is made by use of milk and malted barely. These major ingredients synergistically fulfill most of the nutritional and technological requirements in making an ideal wholesome food. Malt based milk foods fall in the category of nutritional functional health foods, these are prepared by a mixture consisting of standardized milk or milk solids with the fluid separated from the mash of ground barley malt. Depending on the intended use these foods are prepared either in liquid form for direct consumptions or in dried powdered form to be use as an ingredient for reconstitution and some times a base material for other food recipe. Historical background of Malted Milk: In 1878 William Horlick and James Horlick, brothers, established a Horlick Food plant in the outskirts of Racine, Wisconsin USA. They began to manufacture a product known as HorlickвЂ™s Food by enriching milk with malted barley, they under took a research on this product at the request of some physician who wanted to have an infant food combining milk and cereal, First successful malted milk food was developed in 1883 and the product commercially marketed in 1887. This product gained favorable attention from the medicinal professionals and public due to its nutritional value, convenience, digestibility and palatability. 165 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Myth about Malted Barley: Barley is one of the seven internationally grown cereal grains, currently ranking fourth in world production (FAO 2006). Belongs to the genus Hordeum and the major cultivated barley species is Hordeum vulgare. Malted barley means the product obtained from soaking or steeping the whole barley kernel followed by germination and drying in a controlled environment. What makes barley so special; Barley is a rich source of both soluble and insoluble fiber and it is one of the dieterвЂ™s delightвЂќ component. However, researchers have identified ОІ-glucan as the primary component in barley that is responsible for lowering cholesterol. Based on scientific evidence, the Food and Drug Administration (FDA) finalized a rule in 2006 allowing barley foods to carry a health claim specific to soluble fiber and relating to both for reducing cardiovascular disease risk and modifying glycemic responses for treatment and prevention of diabetes (Lazaridou and Biliaderis 2007). Qualifying products may use the following claim: вЂњSoluble fiber from foods such as [name of food], as part of a diet low in saturated fat and cholesterol, may reduce the risk of heart disease. A serving of [name of food] supplies [x] grams of the soluble fiber necessary per day to have this effect.вЂќ Specifically, a food made from eligible barley sources must contain at least 0.75 g of ОІ-glucan (soluble fiber) per serving (FDA 2006). Malt based milk food: Defination Defined as вЂњMalt based milk food means the product obtained by mixing whole milk, partly skimmed milk or milk powder with the wort separately from a mash of ground barley malt, any other malted cereal grain and wheat flour or any other cereal flour or malt extract with or without addition of flavouring agents and spices, emulsifying agents, eggs, protein isolates, edible common salt, sodium or potassium bicarbonate, minerals and vitamins and without added sugar in such a manner as to secure complete hydrolysis of starchy material and prepared in a powder or granule or flake form by roller drying, spray drying, vacuum drying or by any other process. It may contain cocoa powder. It shall be free from dirt and other extraneous matter. It shall not contain any added starch (except starch natural to cocoa powder) and added non-milk fat. It shall not contain any preservative or added colour. Malted milk food containing cocoa powder may contain added sugarвЂќ (PFA 1955). The requirements according to PFA 1955 and Bureau of Indian Standards (IS-1806-1975) it shall confirm the fallowing standards. Characteristics Malted Milk Food without Cocoa powder Malted Milk Food with Cocoa powder Moisture, % by mass Not More Than 5.0 Not More Than 5.0 Total Protein (Nx6.25), % by weight Not Less Than12.5 Not Less Than 11.25 Fat, % by weight Not Less Than7.5 Not Less Than 6.0 Total Ash, % , dry basis Not More Than 5.0 Not More Than 5.0 Acid Insoluble ash, in Dilute HCl, % Not More Than 0.1 Not More Than 0.1 Alcoholic Acidity, % H2SO4 in 90% alcohol Not More Than 0.3 Not More Than 0.3 Solubility, % by weight Not Less Than 85.0 Not Less Than 85.0 Cocoa Powder, % dry basis Test for Starch Bacterial Count, Per gram N/A* Not Less Than 5.0 Negative N/A* Not More Than 50000 Not More Than 50000 Coliform Count, Per gram Not More Than 10 Not More Than 10 Yeast and Mold Count, per gram Not More Than 100 Not More Than 100 Salmonella and Shigella Absent in 25 gm Absent in 25 gm E. Coli Absent in 10.0 gm Absent in 10.0 gm Vibrio cholera and V. paraheamolyticus Absent in 0.1 gm Absent in 0.1 gm Faecal streptococci and Staphylococcus aureas * N/A: Not applicable. Absent in 0.1 gm Absent in 0.1 gm 166 Malt Based Milk Foods as вЂњValue Added Functional Dairy ProductsвЂќ Basic Ingredients of malted dairy foods: 1. Malted Barley: Provide appropriate levels of О±-amylase enzyme required to convert all the starch into simple sugars and also imparts typical malty flavor to the finished product. 2. Malt Extract: This is a concentrated extract from roasted malted barley with a solid of approximately 80 per cent, imparts desired level of colour and typical caramelized flavor. 3. Milk and Milk solids: Enhance nutritional value of the product by providing high quality protein, vitamins, minerals and milk fat provides unique flavor. 4. Wheat flour, wheat gluten, isolated soy protein, malto dextrin, vitamin premixes, salts and other micro ingredients are supplemented to improve the nutritional requirement, provide optimum pH for better digestibility, enhancing flavor and for value addition. Method of Preparation: In the manufacturing of malt based milk food (Figure 1) mashing is the first step fallowed by mix preparation, pasteurization of mix and concentration of mix in first stage up to 50 per cent solids then this base material can be directly spray dried or further concentrated up to 80 per cent solids in multiple effect evaporator then vacuum oven dried or either band dried (Dhillon, 2005). Figure 1: Flow chart for production of malt based milk food. 167 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Quality related Issues: Quality related issue either of physical, chemical or microbiological problems hampers manufacturing and business performance and ultimately to the safety of consumer health. Hence it is very much essential to address at the root level. Critical to quality issue arises mainly due to 5 M factors; these are Man, Machine, Methods of preparation, Materials quality and Mother nature of products. It is often overlooked fact that just about every food item we eat is biological in origin, consumer expect our food should to be fresh, wholesome, and not to contain any unnecessary added additives. In ordered to preserve food from microbes; processing at high temperature is essential but leads to loss of nutritional and volatile compounds, hence it is optimally processed so that nutritional identity is retained but many of these components are very heat sensitive, creates problem during processing, major bottleneck are their bioactivity will diminishes and loss of volatile aroma compounds but fortification in final stage is possible. Encapsulation of sensitive ingredients helps in protecting from thermal shock. Functional ingredients and Health benefits of malted milk foods: Malted barley has received attention from health professionals hence barley is used as the main cereal grain for the development of functional foods, as it contains two classes of compounds of strong nutritional interest: ОІ-glucans (dietary fiber) and tocols (antioxidant - vitamin E). Dietary fibers, such as ОІ-glucans, are defined as the edible parts of plants and analogous carbohydrates that are resistant to digestion and absorption in the human small intestine with complete or partial fermentation in the large intestine. Dietary fiber includes polysaccharides, oligosaccharides, lignin, and associated plant substances (AACC 2001). A diet rich in fiber has health benefits including lowered energy density, prolonged satiety, and effects related to an increase in fecal bulk. Foods containing soluble dietary fiber have been shown to lower serum cholesterol levels, postprandial blood glucose, and insulin response (Jenkins et al., 2000). There are three mechanisms for barleyвЂ™s hypocholesterolemic effects are: (1) reduced absorption of dietary lipids including cholesterol; (2) reduced absorption of bile acids; and (3) production of volatile fatty acids in the large intestine that are reabsorbed, and act as inhibitors of ОІ-hydroxy-ОІmethyl glutaril coenzyme A (HMG-CoA) reductase in the liver (McIntosh and Oakenfull 1990). It is important for diabetics to know the glycemic potential of food carbohydrates. The glycemic index (GI) is a powerful method for nutritional characterization of carbohydrates and has been proposed to diabetic subjects as a tool for managing their diet. Epidemiological data indicates that a diet characterized by a low GI reduces insulin resistance and improves certain metabolic consequences of insulin resistance. This suggests a potential role against both the development of non-insulindependent diabetes mellitus (NIDDM) and cardiovascular diseases (BjГ¶rck et al., 2000). Tocols (tocopherols and tocotrienols) are well recognized for their biological effects, including antioxidant activity (Kamal-Eldin and Appelvist 1996) and reduction of serum LDL-cholesterol. While tocopherols, mainly О±-tocopherol, are considered to have the greater biological activity, tocotrienols have been the focus of growing research interest as unique nutritional compounds for their hypocholesterolemic action. Among the four tocotrienol isomers, Оі-tocotrienol and Оґ-tocotrienol seem to be more effective than О±-tocotrienol. Tocotrienols are reported to be capable of reducing serum LDL-cholesterol in chickens, swine, and human subjects. They may act as inhibitors of the HMG-CoA reductase, a rate-limiting enzyme of cholesterol biosynthesis (Qureshi et al., 1991). Some studies indicate that the antioxidant potential of tocotrienols is even greater than that of О±-tocopherol in certain types of fatty cell membranes and in some brain cells. Moreover, recent studies suggest that tocotrienols may affect the growth and/or proliferation of several types of human cancer cells (Nesaretnam et al., 1998). 168 Malt Based Milk Foods as вЂњValue Added Functional Dairy ProductsвЂќ Conclusion: There is no room for second thought to it that food is going to be a medicine, consumers demanding that they need a food which can overcome all the health related risk. Opportunities before the technologist is that formulation and design of a product containing bioactive substances, but many of these components are very heat sensitive, creates problem during processing, major bottleneck are their bioactivity will diminishes and loss of volatile aroma compounds. Some efforts are made like; Probiotic malted milk made by encapsulation of probiotics and subsequent drying. At present Indian malted milk industry growing at a rate of 8 to10 per cent, because of marketing strategy and advertising, brand image, the health claims, variants, ease of convenience. References: 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. AACC (American Association of Cereal Chemists). 2001. The definition of dietary fiber. AACC Report., 46:3,112126. Baldwin, A.J., Baucke, A.G. and Sanderson, W. B. 1980. New Zealand J. Dairy Sci.Tec., 15: 286. BjГ¶rck, I., Liljeberg, H. and Ostman, E. 2000. Low glycemic-index foods. British Journal. of Nutrition., 83:149-155. Dhillon, L.S. 2005. Manufacturing of malt based food products. Ind. Dairyman., 57:4, 59-66. FAO. 2006. World crop production. Published online at http://www.faostat.fao.org. FDA (U.S. Food and Drug Administratin). 2006. Food labeling: health claims; soluble dietary fiber from certain foods and coronary heart disease. Fed. Reg. 71:29248вЂ“29250. Food Safety and Standards Regulations, 2010. Final Regulations Hand Book, 349-351. Jenkins, D.J.A., Axelsen, M., Kendall, C.W.C., Augustin, L.S.A, Vuksan, V. and Smith, U.2000. Dietary fibre, lente carbohydrates and the insulin-resistant diseases. British Journal of Nutrition., 83:S1,157-163. Kamal-Eldin, K. and Appelqvist, L.A. 1996. The chemistry and antioxidant properties of tocopherols and tocotrienols. Lipids., 31:7, 671-701. Lazaridou and Biliaderis. 2007. Barley products to carry heart health claim. Food Navigator-USA. Published online at http://www.foodnavigator-usa.com. McIntosh, G.H. and Oakenfull, D. 1990. Possible health benefits from barley grain. Chemistry in Australia., 57: 294296. Nesaretnam, K., Stephen, R. Dils, R and Dabre, P. 1998. Tocotrienols inhibit the growth of breast cancer cells, irrespective of estrogen status. Lipids., 33: 461-469. PFA. 1955. The Prevention of Food Adulteration Act & Rules Hand Book, as on 1.10.2004. 329-330. Qureshi, A.A., Qureshi, N. Wright, J.J. Shen, Z. Kramer, G. Gapor, A. Chong, Y.H. DeWitt, G. Ong, A. and Peterson, D.M. 1991. Lowering serum cholesterol in hypocholesterolemic humans by tocotrienols. The American Journal of Clinical Nutrition., 53: 1021s-1026s. Rosemary, K. N and Walter, C.N. 2008. Text Book of: Barley for Food and Health: Science, Technology, and Products. John Wiley & Sons Inc. pub. Salooja, M. K and Balachandran, R. 1988. Physical properties of spray dried malted milk powder, Ind. J. of Dairy Sci., 41:4, 456-461. The Hindu, 2010. U. N. Warns of food crisis. 15-09-2010, ISSN 0971-751X 133:220:9. Vasconcellos, J.A. 2001. Functional foods. Concepts and benefits. The World of Food Science.. www.worldfoodscience. org:80/vol.1_3/feature1-3b.html. 169 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Preparation and Characterization of Gold Nanoparticles, Their Conjugation with Antibodies and Construction of Lateral Flow Devices Priyanka Singh Rao1, Swapnil Sonar2, Y.S. Rajput2 and Rajan Sharma1 1 Dairy Chemistry Division, 2Animal Biochemistry Division, NDRI, Karnal Lateral Flow Assays also known as Immunochromatographic assays are a simple device intended to detect the presence (or absence) of a target analyte in sample (matrix). Traditionally designed assays are composed of a variety of materials, each serving one or more purposes. Colloidal gold is the most widely used label today in commercial lateral flow immunoassays for many reasons. It is fairly easy and inexpensive to prepare in the laboratory. The color is intense, and no development process is needed for visualization. A large body of protocols exist in the literature for its conjugation and application. Gold colloids are formed by the reduction of gold tetrachloric acid through a вЂњnucleationвЂќ process. The size and shape of the colloids depend on the type and amount of reducer used. The label is very stable in liquid or dried form and is non-bleaching after staining on membranes. An accurate and reproducible lateral-flow assay requires the use of high-quality gold conjugates. Gold particles can be produced that range in size from 5 to 100 nm in diameter. The most common size of colloidal gold particle used is 40 nm. In addition, colloidal gold in unconjugated forms (which are ready for labeling) and conjugated forms (conjugated with biologicals) are now readily available from many commercial sources. In addition to the dry parts of a lateral-flow assay, there are also the biological components that allow the visualization of the results. By virtue of their high levels of specificity and binding affinities, antibodies are the ideal choice of agent for detection. In Lateral Flow Assay an antibody molecule is conjugated to a colloidal gold particle. Antibodies can be polyclonal or monoclonal. Once the antibody has been conjugated, the quality of the gold conjugate must be assessed before incorporation into the rapid-test assay. Usually, electron microscopy is employed as a quality-control measure. Conjugation of colloidal gold particles and antibodies depends on the availability and accessibility of three amino acid residuesвЂ”lysine, tryptophan, and cysteine. Once a high-quality antibodyвЂ“gold conjugate is formed, it can be applied to the conjugate pad either by soaking or by spraying. The drying process that follows is essential. The lateral flow immunoassay devices are compact and easily portable. A test strip typically consists of a plastic backing holding together a sample pad for deposition of sample fluids, a conjugate pad pre treated with sample detection particles, a microporous membrane containing sample capturing reagents, and an absorbent pad at the distal end serving to collect excess fluids. A. Preparation of Gold Nano Particle Material: All the chemicals required for the preparation for gold nanoparticles can be procured from Sigma-Aldrich Ltd. Reagents: 1. Stock gold chloride (tetrachloroauric acid trihydrate, Mol.Wt. 393.83; 200 mM) solution- 787.6 mg of HAuCl4.3H2O is dissolved in Millipore water and volume is made up to 10 ml. The stock solution is stored at room temperature. 2. Working gold chloride solution (50 mM) - Stock gold chloride solution is diluted four times with Millipore water. 3. Trisodium citrate dihydrate (38.8 mM; M.W. 294) - 114 mg of trisodium citrate dihydrate is dissolved in 10 ml Millipore water. Procedure: 1. 1. Prepare aqua regia by mixing 3:1 concentrated HCl:HNO3 in a large beaker in a fume hood. Be extremely careful when preparing and working with aqua regia. Wear goggles and gloves, 170 Preparation and Characterization of Gold Nanoparticles, Their Conjugation with Antibodies and Construction of Lateral Flow Devices and perform the experiment in a fume hood. Aqua regia should be freshly prepared and should never be stored in a closed vessel. The capped aqua regia bottle may explode. Render it safe by dilution and neutralization. 2. Soak the 200 ml two-neck flask, magnetic stir bar, stopper and condenser in aqua regia for at least 15 min. Rinse the glassware with copious amount of deionized water and then Milliporefiltered water. Obtaining high-quality nanoparticles is the first important step towards the success of the experiment. Care should be taken to make sure that no contamination is introduced during nanoparticle synthesis. 3. Load 98 ml of Millipore water into the two-neck flask. Add 2 ml of 50 mM HAuCl4 solution so that the final HAuCl4 concentration is 1 mM. 4. Connect the condenser to one neck of the flask, and place the stopper in the other neck. Put the flask on the hot plate to reflux while stirring. 5. When the solution begins to reflux, remove the stopper. Quickly add 10 ml of 38.8 mM sodium citrate, and replace the stopper. The color should change from pale yellow to deep red in 1 min. Allow the system to reflux for another 20 min. 6. Turn off heating and allow the system to cool to room temperature (23вЂ“25В°C) under stirring. B. Characterization of gold nanoparticles The diameter of such prepared nanoparticles is ~13 nm. The extinction value of the 520 nm plasmon peak is 3.8, and the nanoparticle concentration is ~13 nM. The colour should be burgundy red, and the nanoparticle shape should be spherical under transmission electron microscopy (TEM). All gold sols display a single absorption peak in the visible range between 510 and 550 nm, and the absorption maximum shifts to a longer wavelength with increasing particle size. The relative uniformity of the particles or the range of particles can be gauged by the width of the absorption spectra: the sharper the band, the more uniform the particles. The relative concentration of each batch of colloidal gold can be determined by absorbance at 520 nm. Various batches can be brought to the same relative concentration by the addition of de-ionized water. C. Labelling of gold nanoparticles with antibody Reagents i. NaOH (0.2 N) ii. Carbonate Buffer (5 mM) iii. Tris-HCl buffer (pH 8.2) containing 1% BSA and 0.1 sodium azide Procedure: Adjust the pH of Gold nanoparticle using 0.2 N NaOH to 8.5. 6 Вµl (20 Вµg) of affinity purified antibody (against glycomacropeptide) is diluted to 160 Вµl with carbonate buffer and added to nanoparticles. The mixture is incubated overnight at 4ВєC. Centrifuge the contents at 7,000 rpm at 15ВєC for 15 minutes. Suspend the pellet in carbonate buffer and again centrifuge at 7,000 rpm at 15ВєC for 15 minutes. Decant the supernatant and dissolve the pellet in Tris-HCl buffer. Store the antibody labelled nanoparticles at 4В°C till further use. D. Construction and working of lateral flow strip Materials: All the material required for the construction of lateral flow strip, can be purchased from Milipore India Pvt. Ltd. Bangalore. Procedure: Lateral flow assays are Side view of test-strip construction 171 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance composed of a variety of materials, each serving one or more purposes. The parts overlap onto one another and are mounted on a backing card using a pressure-sensitive adhesive. Each component of the test, including membrane, backing substrate, and each of the pad materials, has a defined dimension. On conjugation pad Gold nanoparticles are coated with antigen specific antibodies.Test line is also coated with the antigen specific antibody and Control line with species specific anti-antibody for the antibody in the particulate conjugate. The sample is treated to make it compatible with the rest of the test. The treated sample migrates through this region to the conjugate pad, where a particulate conjugate has been immobilized. The sample interacts with the conjugate as both migrate into the next section of the strip, which is the membrane. Excess reagents move past the capture lines and are entrapped in the wick or absorbent pad. The control line indicates that the test developed properly and test line indicates that the test is positive. 172 Use of Lateral Flow Technique for Detecting Melamine in Milk Use of Lateral Flow Technique for Detecting Melamine in Milk Raman Seth and Anamika Dass Dairy Chemistry Division, NDRI, Karnal Introduction Monitoring of milk and milk product for quality and safety during entire food chain is of major concern to the food producers and to the consumers. In the present scenario, consumers always prefer high quality and safe foods. Dairy industry always looks forward for innovative tests to access dairy product for their quality. Therefore a holistic approach for checking the quality of any food product is an essential requirement. The Indian dairy industry is passing through a phase of adulteration in milk and milk product. Poor quality raw milk is either neutralized or preserved with different preservatives. Recently the menace of melamine addition in milk powder in order to enhance its protein content has been reported in China which caused death of many infants. Nitrogenous compounds like urea, ammonium salts can be detected by simple and rapid test but presence of melamine cannot be detected by simple test. In recent years incidence of melamine addition in infant milk formula has been reported in media especially in China. Melamine is a chemical used primarily for the production of melamine resins. Because of its high nitrogen level (66% by mass), melamine is illegally added to milk product especially to milk powder in order to compensate for protein content when estimated on the basis of total nitrogen. Ingestion of melamine at levels above the safe limit (2.5 ppm in the USA and 1 ppm in European Union for infant milk powder) can induce renal failure and even death in infants. Melamine, a non protein nitrogen substance when added to any food product increases the total nitrogen content. Adulteration of protein rich foods with melamine increases the crude protein content .This reminds us the recent scandal in China where attempts were made to increase the nitrogen content in infant food with melamine which accumulates in the body on feeding melamine contaminated milk and caused toxicity problem, there by forming solid stone deposit within kidneys or bladder which ultimately damage kidneys. Infants fed regularly with milk containing melamine were more susceptible to urinary infections. Thousands of infants were affected and several died in China due to melamine contamination in milk. However, the existing analytical methods for estimation of melamine in milk such as low temperature plasma probe combined with tandem mass spectroscopy (LTP/MS), liquid chromatographyвЂ“mass spectrometry (LC/MS), Electrospray ionization coupled with mass spectrometry (EESI-MS), Enzyme linked immunosorbent assay (ELISA) and High performance liquid chromatography (HPLC) methods involves cumbersome steps along with expensive instrumentation thus making difficult to take decision whether to accept or reject the milk for further processing into milk products. Therefore there is an urgent need to develop a simple test for detection of melamine in milk to stop unscrupulous person to adulterate milk with such harmful chemicals. Development of simple and rapid test for detection of melamine in milk and food has become a challenge for researchers. Color indicator for the presence of melamine in milk using gold nanoparticles may find important application in detecting melamine. In 2008 in China, reports appeared in media where attempts were made to increase the protein content in infant milk food using melamine .Thousands of infants were affected and several died in China. Milk protein contributes 30% of total milk solids. At present in India, the payment of milk in dairy industry is made on the basis of fat, and SNF. Milk supplierвЂ™s uses various adulterants such as urea, ammonium salts, starch, sugar, skim milk powder, maltodextrin, etc to increase the total solids in milk. Chemical tests are available to detect such common adulterants. Melamine is one of the recent adulterant which is reported in China and is used as a source to enhance the protein content in infant milk powder. Melamine contains high nitrogen level (66% by weight),easily available and is not much costlier. For such reasons melamine adulteration in milk is rampant. Melamine is commercially 173 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance available as white powder, odourless and does not impart any undesirable sensory attributes when added to milk. So it becomes very difficult to detect its presence when organoleptic and platform tests are performed at the reception dock of milk plant. Melamine Melamine is an organic base and a trimer Properties of melamine of cyanamide, with a 1,3,5-triazine skeleton. 1 Other name Cyanurotriamide , cyanurotriamine, Like cyanamide, it contains 66% nitrogen cyanuramide by mass and when mixed with resins, has 2 IUPAC Name 1,3,5 triazine 2,4,6 triamine fire retardant properties due to release of 3 Molecular formula C3H6N6 nitrogen gas when burned or charred.It has 4 Molar mass 126.12 several other industrial uses also. 1574 kg/ m3 The chemical term melamine was 5 Density 3500C coined by combining the names of two 6 Melting point german words Melam (a distillation 7 Solubility in water 3.240 g / L at 200 C derivative of ammonium thiocyanate) and amine .Melamine when combined with formaldehyde produces melamine resin, a very durable thermosetting plastic used in formica, and melamine foam, a polymeric cleaning product. Melamine resin is used in the production of dry erase boards, fabrics, glues, kitchen housewares and flame retardants. Melamine is one of the major component in pigment yellow 150, a colorant in ink and plastic Melamine is also used in the fabrication of melamine poly-sulfonate as a superplasticizer for making high-resistance concrete (www. Wikipedia. com).Sulfonated melamine formaldehyde (SMF) is a polymer used as cement admixture to reduce the water content in concrete while increasing the fluidity and the workability of the mix during its handling and pouring. It results in concrete with a lower porosity and a higher mechanical strength exhibiting an improved resistance to aggressive environments and therefore has a longer durability. The use of melamine as a fertilizer for crops had been envisaged during 1960 because of its high nitrogen content. To be effective as a fertilizer, it is essential that the plant nutrients should be made available in a manner that matches the needs of the growing crop. The nitrogen mineralization process for melamine is extremely slow, making this product both economically and scientifically impractical for use as a fertilizer. Melamine derivatives of arsenical drugs are potentially important in the treatment of African trypanosomiasis. In 1958, melamine was used as a source of Non-Protein Nitrogen (NPN) for cattle. Melamine toxicity Melamine is described as being harmful if swallowed, inhaled or absorbed through the skin. Chronic exposure may cause cancer or reproductive damage. Melamine can also affect eye, skin and respiratory system. However, the toxic dose is at par with common table salt with an LD50 of more than 3 grams per kilogram of bodyweight. Melamine and cyanuric acid can also be absorbed into the bloodstream, concentrate and interact in the urine-filled renal microtubules, then crystallize and form large numbers of round, yellow crystals, which in turn block and damage the renal cells that line the tubes, causing kidneys failure. The European Union has set a standard for acceptable human consumption of melamine at 0.5 milligrams per kg of body weight, Canada has declared a limit of 0.35 mg and the USFDAвЂ™s limit was put at 0.63 mg, but was later reduced to 0.063 mg/kg body weight daily. The amount of melamine a person could withstand per day known as the "tolerable daily intake" (TDI), is 0.2 mg per kg of body mass without incurring a major health risk. Melamine is reported to have an oral LD50 of 3248 mg/kg body weight in rats, while in rabbits it was reported to be more than 1000 mg/ kg body weight for rabbits . A melamine cyanurate commonly used as an fire retardant could be more toxic than either melamine or cyanuric acid alone. For rats and mice, the reported LD50 for melamine cyanurate was 4.1 g/kg body weight and 3.5 g/kg body weight when compared to 6.0 g and 4.3 g/kg body weight for melamine and 7.7 g and 3.4 g/kg body weight for cyanuric acid, respectively. . 174 Use of Lateral Flow Technique for Detecting Melamine in Milk Ingestion of melamine may lead to reproductive damage or bladder or kidney stones, which can lead to bladder cancer . Dogs when fed with 3% melamine in diet regularly for one year showed changes in their urine i.e. reduced specific gravity, increased urine output, melamine crystalluria, protein occult blood (WHO Report 1999). Crystals were formed in the kidneys when melamine combined with cyanuric acid was fed to dogs. In April 2007,the newspaper The New York Times reported that the addition of "melamine scrap" into fish and livestock feed gave the false appearance of a higher level of protein which became an "open secret" in many parts of China. In China, several companies were implicated in a scandal involving milk and infant formula which had been adulterated with melamine, leading to kidney stones and other renal failure especially among young children. Melamine may have been added to milk to fool government with regard to protein content test after water was added to fraudulently to dilute the milk. Because of melamine's high nitrogen content (66% by mass), it can cause the protein content of food to appear higher than the true value. About 20 percent of the dairy companies tested in China sell products tainted with melamine (Guan et. al 2009). 2.1.4 Methods for testing melamine in milk Until 2007, melamine had not been routinely monitored in food, except in the context of plastic safety or insecticide residue. This could be due to the previously assumed low toxicity of melamine and the relatively expensive method of detection. Different methods for the analysis of melamine in food and milk developed by (USFDA 2008 ,http://www.wikipedia.org/wiki/melamine) have been mentioned in Table1 Table1: different methods for the analysis of melamine in food and milk developed by (usfda 2008 ,http://www.Fsis.Usda.Gov ) Method Application Limit of detection Analogues detected GC / MS Various foods 2ppm Melamine,Ammeline Ammelide Cyanuric Acid ELISA Used for wheat gluten, moist pet food, dried pet food, milk and milk powder 10 ppm for wheat gluten, 2 ppm for moist pet food, 4 ppm for dried pet food, 2 ppm for milk and 10 ppm for milk powder Melamine HPLC/UV USFDA for meat 25 ppb Melamine / Cyanuric Acid HPLC/UV Used for wheat Gluten and rice protein 100ppm Melamine, Ammeline, and Cyanuric acid HPLC/UV Used for beverage 50 ppb Melamine HPLC/UV Used for cereal flour 5 ppm for Melamine, Ammeline, Ammelide, 90ppm for Cyanuric acid Melamine HPLC/UV Used for meat and pet food 10 ppb Melamine,Cyanuric acid Detection of melamine in milk using melamine strip Melamine strips procured from cusabiotech were used for detection of melamine in milk. Presence of melamine in milk was detected with the appearance of one pink or purple band in the test region while two pink or purple bands were observed in case of control milk. This test is very simple, rapid and could detect up to 100ppm melamine in milk .Fig 1 and 2 shows the pattern of pink bands appearing on melamine strip when prepared milk filtrate were applied. Another advantage of this test is that only 3-4 drops of sample is required and no instrument is required. 175 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Preparation of sample for melamine strip Skim Milk Powder extraction protocol: 1. Add 1ml of methanol: water mixture ( 60:40) to 1g skim milk powder sample and Vortex the tube vigorously. 2. Sonicate for 1min and then shake for 1 min. Allow it to stand for 5 min. 3. Transfer the supernatant to another tube, centrifuge at 10000 rpm for 5min. 4. Filter the supernatant through Whatman filter paper No 1, the filtrate is ready for the assay. Liquid milk extraction protocol (1:2.5) 1. Add 150Ојl of methanol : water mixture ( 60:40) to 100Ојl liquid milk sample.Vortex the tube vigorously. 2. Sonicate for 1min and then shake for 1 min. Allow it to stand for 5 min 3. Transfer the supernatant to another tube, centrifuge at 10000 rpm for 5min. 4. Filter the supernatant through Whatman filter paper No 1, the filtrate is ready for the assay. Detection procedure for melamine in milk filtrate using strip. 1. Bring the melamine test strip and samples to room temperature (25-30ВєC). 2. Add four drop the prepared sample to the sample area of the test strip. 3. Observed the formation of pink band in assay area within 5 min. Fig 1. Photograph showing pattern of pink or purple bands on melamine strip in melamine adulterated milk samples. Fig 2. Photograph showing different level of detection of melamine in milk using strip. 176 control milk and Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and Oils Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and Oils Sumit Arora Dairy Chemistry Division, NDRI, Karnal Introduction Rancimat is a modern, computer controlled analytical instrument for the comfortable determination of oxidative stability index to predict oxidation stability of oils and fats, and hence, their shelf life. It was developed by Hador and Zurcher in 1974 to replace the time consuming active oxygen method (AOM) and other such methods. Oxidative stability is an important criterion for evaluating the quality of oils, fats and fatty acid methyl esters (biodiesel). Lipid oxidation in foodstuffs is one of the most important critical factors affecting major quality parameters such as colour, flavour, aroma and nutritive value, which reduces their shelf life and influence its suitability for consumption. Therefore, it has great importance in food industry to predict the shelf life of foods especially fatty foods. Determining oxidative stability is a tedious and time-consuming process when performed at room temperature, thus it is necessary to use accelerated methods to obtain the oxidative stability in a shorter time. For this reason, several accelerated methods have been developed such as Schaal oven test, Active Oxygen Method (AOM) and Rancimat Method. AOM and Schaal oven test are non-reproducible and time-consuming methods, however, Rancimat method is comparatively more popular because of its ease of handling and reproducibility of results. The unique temperature extrapolation allows an approximate estimation of the storage stability of a product, thus saving both time and money. Advantages: вЂў Automated computer-controlled instrument, therefore, is easy to operate вЂў Conversion of induction time to other temperatures i.e. extrapolation to predict the shelf life of samples вЂў Excellent data security and reproducibility вЂў Time and money saving вЂў Evaluation can be done at two different temperatures simultaneously вЂў Independent heating blocks having individual start of each position Principle: Oil or fat sample is heated at higher temperature in a sealed reaction vessel. Stream of air is passed through the oil or fat sample which results in oxidation of lipid molecules. The volatile products formed upon oxidation are transported through the stream of air to a second vessel containing distilled water, whose conductivity increases with increase in content of oxidation products. A graph is plotted between conductivity and time which can be used to estimate the induction time or oxidative stability index of oil or fat, thus predicting the shelf life of sample. Standards The Rancimat method is included in various national and internationals standards, such as: вЂў AOCS Cd 12b-92 (Sampling and analysis of commercial fats and oils: Oil Stability Index) вЂў ISO 6886 (Animal and vegetable fats and oilsвЂ“ Determination of oxidation stability by accelerated oxidation test) вЂў 2.4.28.2-93 (Fat stability test on Autoxidation. CDM, Japan) вЂў Swiss Food Manual (Schweizerisches Lebensmittelbuch), section 7.5.4 177 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Determination of Oxidation Stability: Prepare fat/oil sample Switch on 743 Rancimat as suggested by the manufacturer Select method Start heating Insert and connect reaction vessels when temperature is reached Start determination Determination finished when stop criteria* is reached Figure 1: Flow diagram showing working of 743 Rancimat Result display Clean vessels and accessories *Stop criteria may be induction time, conductivity or end point (point at which conductivity starts increasing abruptly) RANCIMAT: A. Instrumentation: A. Heating blocks: The 743 Rancimat has two independent heating blocks that allow up to eight samples to be analyzed at one or two temperatures. Up to four Rancimats can be connected to one computer, so that the maximum number of samples that can be analyzed in parallel can be increased to 32. Each measuring position can be started individually. As soon as the measurement has been completed the measuring position is immediately ready for a new sample, which means that the instrument can be used to its full capacity. B. Reaction vessel: Weighing out the sample and assembling the reaction vessel are extremely simple and safe. Reaction vessel does not need to be expensively cleaned at the end of the measurement, thus reducing the analysis costs. C. Measuring vessel: Figure 2: Reaction Vessel 178 Figure 3: Measuring Vessel Figure 4: Conductivity cell Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and Oils Easy-to-clean polycarbonate beakers are used for the automatic conductivity measurement. Glass beakers are available as an alternative. D. Cover with built-in conductivity cell: The conductivity cell is incorporated in the measuring vessel cover. When the cover is placed in position the cell is immersed in the water. At the same time electrical contact is made to the electronics in the instrument. The use of fragile glass conductivity electrodes with lengthy connecting cables went out of fashion a long time ago. The new conductivity cell is also very easy to clean. e. Connections: In order to make operation as simple as possible, there are no controls at all on the instrument. All its functions are controlled from the computer. Apart from the power switch, the only features you will find on the instrument are the RS-232 socket for connection to a computer and a socket for connecting the Pt-100 temperature sensor. Figure 5: Connections f. Figure 6: Air inlet filter and molecular sieve Figure 7: GLP Set Air inlet filter and molecular sieve: The air used for the measurement is aspirated through a filter that prevents particles from entering the instrument. The molecular sieve removes water vapour from the aspirated air; as water contributes to the hydrolytic decomposition of the fat molecules, it could interfere with the measurement. g. Air supply line: The amount of air that passes through the sample is automatically controlled via the rotation rate of the built-in pump according to the method settings. A separate supply of compressed air is not necessary. B. Validation with the glp set: The optionally available GLP Set facilitates the validation of 743 Rancimat. It contains a certified Pt-100 temperature sensor with accessories that can be used for testing the temperature regulation of the heating block. A test plug for checking the conductivity measurement inputs is also supplied. C. Software functions: All functions of the 743 Rancimat are controlled by the Rancimat software, which excels by its userfriendliness. All the functions are clearly arranged in just a few windows, the operation is intuitive. D. Rancimat control: This is where the measuring parameters can be called up and edited. The instrument functions are controlled directly from here; the measurements are also started and shown in the live display field. The arrangement of this window corresponds to a view of the instrument from above. This means that the assignment of sample information and measuring position is perfectly clear. The timer function can be used to automatically switch on the heating blocks before the start of work, so that it is no longer necessary to wait while they warm up. 179 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance The functions in a nutshell: вЂў Individual start/stop for each position вЂў Live display вЂў Temperature display вЂў Method definition вЂў Instrument controls вЂў Calculation formulas, automatic result transformation to other temperatures вЂў Timer function E. Results: At the end of each determination, the measured data is stored in a database and can be viewed by the user in the results window. Sample information and results are shown in tabular form and can be exported in various formats. The measured curves can be shown individually or in groups. It is also possible to edit the automatic evaluation and recalculate the results. The temperature extrapolation function for estimating the storage stability is available in this section of the software. All the displayed data can be sorted or filtered and display can be adapted to meet our requirements. Results can be obtained in the following forms: вЂў Overview table вЂў Curve display: individual or multiple plots вЂў Re-evaluation: induction time, stability time and manual tangent method вЂў Report printout вЂў Temperature extrapolation (estimation of storage stability) вЂў Database functions: filtering, sorting вЂў Data export F. Applications: Determination of oxidation stability of foods: Just like the pure substances, the oils and fats contained in foods are also subject to oxidation, which contributes to their spoilage. In such cases the Rancimat can be used to determine the oxidation stability of foods containing oils and fats. Meltable foods with a high fat content, such as ghee, butter, margarine, lard or tallow, can be analyzed directly without any further sample preparation. For liquid or semi-liquid foods, such as salad dressings or mayonnaise, it is better to split the emulsion and analyze the separated fat phase. For solid, non-meltable foods it is also necessary to separate off the fat phase. In this case the fat is normally cold-extracted with petroleum ether and the isolated fat is then analyzed. Following food samples can be analysed: butter, margarine, ghee, vegetable oils, baby foods, icecream, cereals, chocolate, nuts and biscuits. G. Technical specifications: 1. Heating blocks: Two aluminium heating blocks; electrically heated; can be set to different temperatures 2. Number of samples: Eight samples (4 measuring positions per heating block) 3. Temperature control and measurement Temperature range Temperature correction 180 : 50 to 220В°C, adjustable in 1ВєC steps : -9.9 to +9.9В°C, adjustable in 0.1ВєC Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and Oils Reproducibility of set temperature Temperature variation Temperature difference between different measuring positions Instrument heating-up time from 20В°C To 120ВєC Instrument heating-up time from 20В°C to 220В°C Outer temperature of instrument Response temperature of thermal protection device steps : Typically better than В±0.2 В°C* : Typically <0.1 В°C* : Typically <0.3 В°C* : ~ 45min (to В±0.1В°C temp. stability) : ~ 60min (to В±0.1В°C temp. stability) : <50В°C (at an operating temp. 220В°C) : 260ВєC *When operating temperature has been reached, with inserted reaction vessels with an identical filling and 20 L/h air throughput. 4. Air throughput: Pump : Diaphragm pump Output range : 7 to 25 L/h 5. Conductivity measurement: Measurement range Electrodes 6. Temperature: Nominal working range Storage Transport 7. Line power Voltage Frequency Power consumption 8. Dimensions Width Height Depth 9. Weight 27.6 kg (with accessories) 10. PC requirements Processor Operating system Memory RAM Graphics resolution Interface Printer : 0 to 400 ОјS/cm : 6.0913.130 conductivity cell with double steel pin electrode built into vessel cover : +5ВєC to +40ВєC (at 20 to 80% relative humidity) : -20ВєC to +70ВєC : -40ВєC to +70ВєC : 2.743.0014/2.743.0114: 230 V (220...240 V В±10%) 2.743.0015/2.743.0115: 115 V (100...120 V В±10%) : 50 to 60 Hz : <450 VA (depending on heating power) : 405 mm : 268 mm (without accessories) 353 mm (with accessories) : 466 mm : Pentium III with 700 MHz or higher : Windows TM NT, Windows TM 2000 or Windows TM XP : 20 MB for program files, 200 MB recommended for measuring data storage : Working memory 128 MB, recommended 256 MB or higher (particularly for Windows TM XP) : min. 800 x 600, recommended 1024 x 768 or higher : 1 free RS-232C interface (COM) : All printers supported by WindowsTMt advantage 181 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Estimation of Cholesterol Content in Ghee Using a Cholesterol Estimation Kit Vivek Sharma and Darshan Lal Dairy Chemistry Division, NDRI, Karnal Principle Cholesterol is extracted in unsaponifiable matter as free cholesterol. The aliquot of unsaponifiable matter is made to react with the reagents of the cholesterol estimation kit and the color developed is measured at 505nm. The absorbance values in the sample and control are used to calculate the cholesterol content in a given sample of ghee. Materials Ghee, Enzymatic Diagnostic kit, Methanol, Potassium hydroxide, Hexane, Teflon line screw capped tubes. Equipment Water bath, Spectrophotometer, Cuvettes. Protocol for cholesterol estimation in milk fat after saponification using enzymatic diagnostic kit: Milk fat (0.1-0.15 g) in test tube with teflon lined screw cap Add 5 ml 5% methanolic KOH and mix Incubate capped tubes in water bath for 90 В°C/ 20 min with shaking every 5 min. Cool contents by tap water Add 1 ml distilled water Add 5 ml hexane Vortex the contents for 1 min 182 Estimation of Cholesterol Content in Ghee Using a Cholesterol Estimation Kit Centrifuge at 2000 rpm/ 2 min Pipette out upper hexane layer Take 0.2 ml of aliquot in dry test tube Evaporate solvent under nitrogen at 60-70В°C Add 10 Вµl of absolute ethanol to dissolve dried residue Add 1.0 ml cholesterol reagent provided in kit and incubate at 37В°C/10min Cool to room temp (28 вЂ“ 30В°C). Measure colour (pink) intensity at 505 nm Calculation: Where, 0.02 is the concentration (mg) of cholesterol in 10 Вµl of standard solution provided in the kit. 183 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Rapid Methods for Detection of Adulterants in Milk Rajan Sharma, Raman Seth and Amit K. Bauri Dairy Chemistry Division, NDRI, Karnal Introduction Addition of neutralizers and adulterants in milk has become a common feature for fulfilling the milk demands of over populated country. Now for dairy industry it seems to be difficult to run the plant without neutralization of milk. For milk vendors and shop-keepers, adulteration of milk with water to increase the quantity in order to supply milk in large number of house-holds also has become a common practice. The lack of timely action against the adulterators by the Public Health Departments and lack of easier and rapid methods for detection of adulteration further encouraged this menace. Common man i.e. consumers are not aware of the methods and chemicals used in the methods. Now in NDRI Karnal, the procedures for the detection of various adulterants and neutralizers have been simplified to be easily adopted by the house-holds. The prepared reagents as well as a KIT for the detection of adulterants and neutralizers are available in the Dairy Chemistry Division of NDRI, Karnal. Preservatives A. Test for formaldehyde Formalin (40% water solution of formaldehyde) is generally used by Public Health Departments to preserve the milk samples for chemical analysis purpose. Formaldehyde is very poisonous chemical. Though, it can preserve the milk for very long time, it should never be added to milk meant for processing due to its poisonous property. Moreover, it affects the quality of the milk products. If milk kept at room temperature (25 to 35ВєC) for longer time, did not sour, then that milk must be tested for formaldehyde by the following simple method: Method 1: Leach test 1. Take about 5 ml of milk in a test tube. 2. Add to it equal volume of Conc. HCl containing 1 ml of 10% ferric chloride solution to each 500 ml of the acid. 3. Keep the tube in boiling water bath for about 3-4 min. 4. Observe the colour of the solution in the tube. The tube containing pure sample will turns yellowish. The positive sample (i.e. containing HCHO) will turn violet to brown black. Method II: Chromotropic acid test Reagent: Saturated solution of 1,8-dihydroxynaphthalene-3,6-disulphonic acid in about 72% sulphuric acid (about 500 mg/100 ml). Light straw-coloured solution should result. 1. Take one ml of milk sample in a test tube. Add 1 ml of the Chromotropic acid reagent and mix well. 2. Appearance of yellow colour confirms the presence of formalin in the sample, whereas; control sample will remain colourless. B. Test for hydrogen peroxide Hydrogen Peroxide is a preservative, but as per PFA rule it is not permitted to be added in milk. Hence if it is found, then milk is said to be adulterated. Method I Reagent: Para-phenylenediamine solution (2%, Aq, w/v). Procedure: 1. Add to about 5 ml of milk in a test tube, an equal volume of raw milk, followed by five drops of a 2 % of para-phenylenediamine. 184 Rapid Methods for Detection of Adulterants in Milk 2. A blue colour is developed in the presence of hydrogen peroxide. Note: It is unlikely that the addition of less than 0.1% of H2O2 to milk could be detected after 24 h, owing to the action of peroxidase and catalase which stimulate its conversion into water. If moe than 0.2% H2O2 is added, some will persist for considerable long time. Owing to the fact that larger amount of H2O2 are known to destroy peroxidase, it is always advisable to add to the sample an equal volume of raw unpreserved milk and to follow with a few drops of a 0.2% solution of para-phenylenediamine. Under these circumstances a blue colour will develop immediately if H2O2 is added. Method II A method using potassium iodide and starch was standardized for the detection of hydrogen peroxide in milk. Procedure: Take one ml milk sample in a test tube. Add one ml of potassium iodide-starch reagent (mix equal volumes of 20% potassium iodide solution and 1% starch solution) to the test tube. Appearance of blue colour indicates the presence of hydrogen peroxide in the milk sample whereas control samples remain colourless. C. Detection of Neutralizers Alkali in various forms like sodium carbonate, sodium bicarbonate, sodium hydroxide and lime are used to neutralize developed acidity in milk. Detection of such neutralizers can be made by the following two tests. Method I. Rosalic Acid Test: Reagents: Ethanol (95%), Rosalic acid solution (1% in alcohol). Procedure: 1. Take in test tube about 5 ml milk and mix with 5-ml ethanol followed by 2-3 drops of rosalic acid solution. 2. Formation of rose red colouration indicates the presence of alkali as neutralizer. Pure milk produces brownish or brownish yellow colour only. Rosalic acid is an organic dye, which is used as an indicator-changing colour at pH 7.0 to 8.0. Hence, milk made even faintly alkaline by addition of neutralizers can be detected due to formation of rose red colour with rosalic acid solution. Method II. Ash alkalinity test Neutralization of milk whether with lime, soda, or caustic soda, invariably increases the ash content and the total alkalinity of the ash from a fixed quantity. Reagent: HCl (standard, 0.1 N), Phenolphthalein indicator. Procedure: 1. Pipette 20 ml of milk into a porcelain basin and evaporate to dryness on boiling water bath. 2. Remove the basin, cool to room temperature and ignite the residue by heating over Bunsen flame until gray-white ash is obtained. 3. Cool the basin to room temperature. Add to the residue 10-ml of water and disperse the ash in water by stirring with a glass rod. 4. Titrate the ash dispersate by standard HCl using phenolphthalein indicator. If the volume of 0.1 N HCl required to neutralize the ash dispersate exceeds 1.20 ml; the milk is suspected to contain neutralizers. D. Detection of starch or cereal flours Reagent: Iodine solution (1%), Dissolve 2.5 g potassium iodide in 100 ml water, add to it 1 g pure iodine crystal, shake well to give a clear solution. 185 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Procedure: 1. Take about 3 ml of well-mixed milk sample in a test tube. 2. Heat the milk to just boiling by holding the tube over flame, and thereafter cool to room time. 3. Add 1-2 drops of 1% iodine solution. 4. Observe the development of colour. Formation of blue-violet colour indicates presence of starch cereal flours. E. Detection of cane sugar Sugar or cane-sugar, is generally added to milk in order to raise the lactometer reading of the milk which was diluted with water, so that by lactometer reading, the detection of added water is prevented. In suspected samples, sugar can be easily detected by following method: Reagent: Resorcinol, conc. HCl. (or prepare sucrose detecting reagent by dissolving 0.5 g of resorcinol in about 40 ml of distilled water. Then add 35 ml of 12 N conc. HCl. Make up the volume to 100 ml using distilled water.) Procedure: 1. To about 5 ml of milk in a test tube, add 1 ml of conc. HCl and 0.1 g of resorcinol and mix. 2. Place the tube in boiling water bath for 5 min. 3. In the presence of cane sugar, red colour is produced. Note: The test can be simplified by taking 1 ml of suspected sample of milk is a test tube followed by the addition 1 ml of sucrose detecting reagent. In the presence of cane sugar, red colour is produced. F. Detection of glucose Glucose being a reducing sugar poses many problems in its detection. Moreover, it is easily available in commercial form as concentrated syrup. These days adulteration of milk with glucose is increasing. Now it has become possible to detect Glucose in milk by the following method: Reagents: 1. BarfoedвЂ™s reagent: Dissolve 24 g cupric acetate in 450 ml boiling water and immediately add 25 ml of 8.5% lactic acid to the hot solution. Shake to dissolve almost all precipitate, cool and dilute with water to 500 ml. If necessary decant of filter to get a clear solution. 2. Phosphomolybdic acid reagent: Take 35 g ammonium molybdate and 5 g sodium tungstate in a large beaker; add 200 ml of 10% NaOH solution and 200 ml water. Boil vigorously (20-60 min) so as to remove nearly whole of ammonia. Cool, dilute with water to about 350 ml. Add 125 ml conc. H3PO4 (85%) and dilute further to 500 ml. Procedure: 1. Take 1 ml of milk sample in a test tube. Add 1 ml of modified BarefoedвЂ™s reagent. 2. Heat the mixture for exact 3 min in a boiling water bath and then rapidly cool under tap water. 3. Add one ml of phosphomolybdic acid reagent to the turbid solution and observe the colour. 4. Immediate formation of deep blue colour indicates the presence of added glucose. In case of pure milk only faint bluish colour is formed due to the dilution of BarefoedвЂ™s reagent. G. Detection of nitrates (pond water) Pond water is heavier than the tap water; some unscrupulous persons for adulteration in milk usually prefer it. However, it can be easily detected by the following method. This method actually detects nitrates present in the pond water. In the pond water nitrates may come from fertilizers used in the fields. Reagent: Diphenylamine: Prepare 2% solution of diphenylamine in conc. sulfuric acid. 186 Rapid Methods for Detection of Adulterants in Milk Procedure: Take 2 ml of milk in a test tube. Rinse the tube with the milk and drain the milk from the test tube. Add two-three drops of the reagent along the side of the test tube. Deep blue colour will be formed in presence of nitrate. H. Detection of Urea in milk Urea is a natural constituent of milk and it forms a major part of the non-protein nitrogen of milk. Urea concentration in milk is variable within herd. Urea is one of the ingredients of synthetic milk along with caustic soda, detergent, sugar and foreign fats. Adulteration of natural milk with synthetic milk increases the level of urea to such an extent that on consumption of this adulterated milk causes toxicological hazards. Estimation of urea concentration in milk may serve as a tool for checking the menace of adulteration of natural milk with synthetic milk. The average urea content in milk of Karan Swiss, Karan Fries and Sahiwal cows was reported to be 28.57, 28.79 and 25.39 mg/100 ml (range 20 to 35 mg/100 ml). In buffalo milk, the average urea content was found to be 35.10 mg (range 25 to 40 mg/100 ml). The addition of urea to milk can be detected by using DMAB method. This method is based on the principle that urea forms a yellow complex with p-dimethyl aminobenzaldehyde (DMAB) in a low acidic solution at room temperature. The intensity of yellow colour is measured at 425 nm. Here only qualitative method is described Urea + DMAB Reagent: 1.6% DMAB reagent: Dissolve 1.6 g DMAB in 100-ml ethyl alcohol and add 10-ml conc. HCl. Procedure: 1. Take equal quantity of milk and equal quantity of 24% TCA in a glass stoppered test tube. Mix and filter it. 2. Take 3 ml of filtrate in a test tube and add 3 ml of 1.6% DMAB reagent in ethyl alcohol and HCl. Note the colour obtained. 3. The occurrence of distinct yellow colour indicates the presence of added urea in milk. Note: The control (milk sample containing no added urea) showed a slight yellow colour due to the presence of natural urea in milk. I. Maltodextrin To 5 ml milk sample in a test tube, 2 ml of dilute iodine solution (0.05 N) is added. Appearance of chocolate red brown colour developed indicates the presence of maltodextrin. J. Sodium chloride Take 5 ml of milk and 1 ml of silver nitrate solution (0.1 N). Mix well and add two drops of a solution of 10% potassium chromate. Yellow colour indicates the presence of added salt. Otherwise, red colour will appear. K. Ammonium salts The added ammonium salts e.g ammonium chloride, ammonium sulfate, ammonium nitrate and ammonium dihydrogen orthophosphate can be detected in milk by two methods i.e NesslerвЂ™s reagent method and turmeric paper method. Method I: NesslerвЂ™s reagent method Reagent : NesslerвЂ™s reagent: Dissolve the following chemicals separately. a. 8.0 g of mercuric chloride in 150 ml distilled water. 187 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance b. 60.0 g of sodium hydroxide in 150 ml distilled water. c. 16.0 g of potassium iodide in 150 ml distilled water. Add reagent a to reagent b and mix well. To this mixture, add reagent c, mix and dilute the contents to 500 ml. Leave this solution undisturbed and decant the clear upper layer of the solution and store in a stoppered glass bottle. Procedure: Pipette 5 ml of suspected milk sample into a test tube and add 1 ml of NesslerвЂ™s reagent. Mix the contents of the tube thoroughly. Appearance of yellowish or grey colour confirms the presence of added ammonium salts in milk Method II. Turmeric paper method This method is based on the principle that ammonium salts on addition of strong alkali liberate ammonia and the liberated ammonia turns turmeric paper to pinkish red. Reagents: вЂў Turmeric paper: Dissolve 10 g of pure turmeric powder in 100 ml distilled water and dip Whatman filter paper Grade 1 strips into it for 2 min. Dry the paper at room temperature. The dried filter paper is wetted with distilled water before use. вЂў Sodium hydroxide solution: 10% (aq.) вЂў Procedure: Pipette 5 ml of suspected milk sample in a test tube and add 1 ml of 10% sodium hydroxide solution in such a manner that should not touch the rim of the test tube while adding. Mix the contents of the tube. Place a piece of wet turmeric paper on the rim of the test tube and keep the test tube undisturbed. Observe the change in the colour of the turmeric paper. Appearance of pinkish red colour confirms the presence of ammonium salt in milk. L. Sulfate salts Presence of sulfates in milk can be detected by using barium chloride. Reagents: a. Barium chloride (BaCl2.2H2O) solution: 5% (w/v, aq.) b. Trichloroacetic acid (TCA): 24% (w/v, aq.). Procedure: Take 10 ml of milk in a 50 ml stoppered test tube and add 10 ml of TCA solution. Filter the coagulated milk through Whatman filter paper Grade 42. Take 5 ml of clear filtrate and add few drops of barium chloride solution. Formation of milky-white precipitates indicates the presence of added sulfates like ammonium sulfate, sodium sulfate, zinc sulfate and magnesium sulfate etc. to milk M. Detection of refined oil in milk This method is based on the principle that BR reading of milk fat is comparatively lower than that of most of the foreign fats/oils. Its adulteration with vegetable and/or animal body fats/oils significantly increases the BR reading/ For taking BR reading of the milk fat the milk fat is isolated from the specially designed butyrometer which has both ends open. Milk fat after centrifugation is taken with the help of a capillary and BR reading is noted at 40В°C. A correction factor is added to the observed BR reading. This is done to eliminate the inherent hydrolytic effect of H2SO4. Actual BR at 40В°C = Observed BR at 40В°C + (0.08X observed BR at 40В°C) References: Manual in Dairy Chemistry, NDRI, Karnal. IS:1479 (Part II) вЂ“ 1961 Methods of test for Dairy Industry-Part II Chemical analysis of milk. 188 Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches Darshan Lal, Vivek Sharma, Arun Kumar and Amit Kumar Dairy Chemistry Division, NDRI, Karnal Introduction The menace of adulteration in food products has reached an alarming stage in recent years. Even the milk (most sacred food) has not been spared. Milk fat, the costliest edible fat, increasingly catches the attention of the unscrupulous elements for an easy adulteration with far cheaper oils and fats of vegetable and animal origin. Under the circumstances, the dairy industry is in dire need for some rapid and simple methods to check the menace of adulteration in milk and milk products. Earlier, ghee used to be adulterated with foreign oils and fats, and accordingly several methods were developed for detection of adulteration in ghee. These methods were based on differences in the nature and contents of major/minor components of ghee and adulterant fats/oils. Now days, a new trend of addition of foreign fats/oils directly into milk has been gaining momentum. Unfortunately, the tests, which are applicable for detecting adulteration in ghee, cannot be directly applied to milk because milk is not a single-phase emulsion. Rather, it is an oil-in-water type emulsion. Therefore, the fat phase of milk has to be separated from its aqueous phase before applying any test for checking the adulteration of milk fat. Moreover, since no single test can detect all types of adulterants (oils and fats), therefore, often more than one tests have to be employed to confirm the purity of milk fat. Methodology There are two approaches for the detection of adulteration of milk fat. First approach is based on the classical methods like B.R reading, R.M value, P. value, Phytosterol acetate test, Gas вЂ“ liquid chromatographic analysis. Second approach is based on some innovative and rapid methods like furfural test for vanaspati, Opacity test, crystallization test, color based test for vegetable oil detection, apparent solidification time test and complete liquification time test. In all the cases, tests are applied on the extracted fat, except the modified Gerber test, where especially designed dual purpose Gerber butyrometer is used and B.R reading of the isolated fat is measured. Hence, the first step is to isolate the fat and then apply the test (Kumar et al, 2002). A) Detection of foreign oils and fats in milk: Keeping in view the need for a rapid test which can be applied to milk for detecting the adulteration right at the platform where the milk is to be either accepted or rejected, the approach suggested by Lal et al (1998) involves the isolation of fat from milk followed by determination of B.R. reading of the isolated fat. This test is specifically useful for detection of vegetable oils in milk. Isolation of fat from milk Isolation of fat from milk can be done by any of the three methods: вЂў Solvent extraction method вЂў Heat clarification method вЂў Modified Gerber method. Solvent extraction method Take 100 ml of milk sample in a 500 ml flask. Add 15 ml of NH4OH, and shake thoroughly. Add 50 ml ethyl alcohol, 100 ml solvent ether and 100 ml petroleum ether and shake thoroughly after each addition. Allow to stand for half an hour. Decant the ethereal layer in another conical flask of 250 ml capacity. Add about 50 g of anhydrous Na2SO4 to remove the traces of moisture from the ethereal layer. Collect the ether extract and add 1 or 2 glass beads. Evaporate ether extract to dryness on boiling water bath taking care to prevent bumping and then transfer in oven maintained at 102ВєC. 189 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Heat clarification method Obtain about 50g of cream by separation using cream separator or by centrifuging the milk at 4000 rpm for 10 min. Convert the cream into ghee by heat clarification. Modified gerber method Isolate the fat from milk by Gerber method using specially designed dual purpose milk butyrometer, which is open at both ends. Close the stem side opening with a good quality acid resistant silicon cork. From the neck side, add 10 ml of 90% H2SO4, 10.75 ml milk and 1 ml amyl alcohol. Close the neck side with lock stopper; mix the contents and centrifuge for 5 min to get clear fat in the column. Remove the silicon cork and take out the fat from the stem of butyrometer with the help of a capillary tube or a syringe (Lal et al, 1998). B) Detection of foreign oils and fats in ghee: Available tests: 1. Detection of animal body fats and vegetable oils/fats by the opacity test Melt the sample of fat (5 gm) isolated by heat clarification method at 50 +1oC in a test tube and maintain for 3 min to equilibrate. Then transfer the test tube at 23 + 0.2oC water bath and record the opacity time (Time taken by fat sample to acquire either O.D. at 570 nm between 0.14-0.16 or Klett reading using red filter between 58-62 after adjusting the instrument to 100% transmittance). The opacity time of pure buffalo ghee is 14-15 min, cow ghee is 18-19 min and that of ghee from cotton tract area is 11-12 min. The opacity time of buffalo ghee adulterated at 10% level with vanaspati is 10-11 min, with pig body fat is 8-9 min, with buffalo body fat is 2-3 min, with cow body fat is 3-4 min and with refined oils is 20-25 min (Singhal, 1980). 2. Detection of vanaspati in ghee Isolate the fat from milk by heat clarification method as described above. Take about 5 g of the melted fat in a test tube. Add 5 ml of concentrated HCl. Add 0.4 ml furfural solution (2% in alcohol) and shake the tube thoroughly for 2 min. Allow the mixture to separate. The development of pink or red colour in the acid layer indicates presence of vanaspati. Confirm by adding 5 ml distilled water and shaking again. If the colour in acid layer persists, vanaspati is present. If the colour disappears, it is absent [SP:18 (1987)]. 3. Detection of vegetable oils byButyro-Refractometer (B.R.) Reading Clean the prisms of the Butyro-refractometer with petroleum ether. Allow the ether to evaporate to dryness. Maintain temperature of the prisms at 40ВєC by circulating water. Calibrate the B.R. apparatus by applying a drop of fluid of known B.R. and adjusting B.R. by moving the adjustment screw. Clean the prisms. Apply a drop of sample of clear fat obtained by any of the three methods between the prisms. Wait for 2 min before taking the reading so that sample should attain the constant temperature of about 40ВєC. B.R. reading decreases and increases with the rise and fall of temperature, respectively. Normally, the temperature of observation should not deviate by more than 2ВєC. A correction of 0.55 is added to the observed B.R. reading for each degree above 40ВєC or subtracted for each degree below 40ВєC to get corrected B.R. reading of the sample. If fat is isolated by the Gerber method, B.R. is depressed due to hydrolytic effect of H2SO4 on the fat. Therefore, observed B.R. reading is corrected as follows: Corrected B.R. = 1.08 x observed B.R. B.R. reading of milk fat isolated by any one of the above mentioned methods should be consistent with the values given for ghee as per PFA requirement. Any deviation from the standard value indicates adulteration of milk with vegetable oils. However, this method has limitation of detection of adulteration with two oils i.e. coconut oil and palm oil whose values are close to that of milk fat (Arora et al, 1996). 190 Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches 4. Detection of animal body fats and vegetable oils by crystallization test Isolate the fat from milk by heat clarification method as described above. Take 0.8 ml of melted fat in a stoppered test tube (10 x 1.0 cm internal diameter). Add 2.5 ml of solvent mixture consisting of acetone and benzene (3.5:1.0). Mix the contents slowly. Place the test tube in a water bath maintained at 20ВєC for 3 min to equilibrate the temperature. Then transfer the tube in another water bath maintained at 17 В± 0.2ВєC till the onset of crystallization. Note the time for occurrence of crystallization. The crystallization time of pure buffalo ghee is 18-20 min and that of cotton tract ghee is 10.5-12.5 min, whereas that of buffalo ghee adulterated at 10% level with pig body fat is 11.5-12.5 min, with cow body fat 4.5-5.5 min and buffalo body fat 3.0-4.0 min, and with vegetable oils is 26 to 36 min (Panda, 1996). 5. Detection of adulteration of vegetable oils in ghee by Iodine value Iodine value, which is a measure of extent of unsaturation of fat, can be determined by the WijвЂ™s method as described in SP:18 (Part XI)1981. This property is particularly useful for detection of adulteration in ghee with vegetable oils, as these oils have higher iodine values than milk fat and body fats. It can be measured, as follows: Accurately 0.4 g of sample is weighed in a clean and dry iodine flask and is dissolved in 15 ml of carbon tetrachloride. Then 25 ml of the WijвЂ™s reagent are added and the flask is stoppered. The contents are then mixed and kept in dark for one hour. After one hour, 20 ml of 10 per cent potassium iodide solution and about 150 ml of distilled water are added to the iodine flask and mixed. The contents are titrated against 0.1 N sodium thiosulphate solution using starch solution as an indicator. A blank test is also carried out using the same quantities of the reagents. From this, the iodine value is calculated as follows: Iodine Value = 12.69 (B вЂ“ S) N / W Where; B = Vol. (in ml) of standard sodium thiosulphate solution required for the blank S = Volume (in ml) of standard sodium thiosulphate solution required for the sample N = Normality of the standard sodium thiosulphate solution, and W = Weight (in g) of the sample taken for the test The iodine value for cow and buffalo pure ghee ranges between 30.12 to 40.26. Any deviation from these values indicates adulteration (Kumar, 2008). 6. Detection of adulteration by apparent solidification time (AST) test The apparent solidification time (AST) of the fat sample is defined as the time taken by the melted fat sample to get solidified apparently at a particular temperature. The test can be carried out as: Take 3.0 gm of completely melted fat sample in a test tube (10 Г— 1.0 cm ID) and maintain at 60ВєC for 5 min. Transfer the test tube in a refrigerated water bath maintained at 18 В± 0.2ВєC and simultaneously start the stop watch. Observe the test tube constantly till the apparent solidification of the fat sample takes place which is confirmed by non- movement of fat sample on tilting the test tube. At this stage, stop the stopwatch and record the time taken for the apparent solidification of the fat. Pure ghee sample of both cow and buffalo shows AST in the range of 2 min 31 sec to 3 min 25 sec. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2009) 7. Detection of adulteration using dry fractionation technique coupled with AST By employing dry fractionation technique, the different fractions enriched with body fats or vegetable oils are obtained and subsequently used to estimate AST. The aim is to enrich the solid fraction with animal body fats and liquid fraction with vegetable oils. Vanaspati, if added, will also be fractionated along with animal body fats. Take 100 gm of clarified melted fat and keep it in a BOD incubator maintained at 20 В± 0.1ВєC. After about 1.50 to 1.75 h of incubation, approximately one third of the whole fat gets solidified. Separate the solid fraction (S20) from the remaining liquid portion by filtration inside a BOD incubator maintained at 191 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 20 В± 0.1В°C. Further fractionate the liquid portion thus obtained in another BOD incubator maintained at 18 В± 0.1В°C. for 2 hr so as to obtain another solid (S18) and liquid (L18) fraction by filtering inside a BOD incubator maintained at 18 В± 0.1В°C. Analyze S20, S18 and L18 fractions of ghee for AST as described above. S20, S18 and L18 fractions of pure ghee of both cow and buffalo show AST values of 1 min 40 sec to 2 min 50 sec; 2 min 30 sec to 3 min 40 sec and 2 min 50 sec to 3 min 50 sec, respectively. Any deviation from these values gives an indication of adulteration (Kumar, 2003). 8. Detection of adulteration by complete liquification time (CLT) test The complete liquification time (CLT) test of the fat sample is defined as the time taken by the solidified fat sample to get melted completely at a particular temperature. The test can be performed, as follows: Take 3.0 gm of completely melted fat sample in a test tube (10 Г— 1.2 cm) and maintain at 60В°C for 5 min. Keep the test tube containing fat sample in a refrigerator (6- 8ВєC) for 45 min for solidification of the melted fat sample. Transfer the test tube in a water bath maintained at 44 В± 0.1ВєC and simultaneously start the stop watch. Observe the test tube constantly till the fat sample is completely liquefied. At this stage stop the stopwatch and record the time taken for complete liquification of the fat. Pure ghee sample of both cow and buffalo shows CLT in the range of 2 min 12 sec to 3 min 15 sec. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2008). 9. Detection of adulteration using solvent fractionation technique coupled with CLT and Iodine value Using solvent fractionation technique, the different fractions enriched with body fats or vegetable oils can be obtained and used subsequently to estimate CLT. Here also, the aim is to concentrate animal body fats in to solid fraction and vegetable oils into liquid fraction. Vanaspati, if added, will also be concentrated in solid fraction along with animal body fats. Take 30 gm of melted ghee sample in a 100 ml graduated glass tube, and then add 60 ml acetone and mix well to dissolve the fat. After mixing, keep the sample at 40В°C for equilibration for 5 min. Then subject the sample in a refrigerated water bath to three temperatures/time combinations, viz., 16 В± 0.1В°C/25 min, 8 В± 0.1В°C/25 min and 4 В± 0.1В°C/60 min, successively, after filtration at each stage of time/ temperature combination. After about 25 min at 16 В± 0.1В°C, approximately one-fourth of the whole fat gets solidified. This first solid fraction (S16) obtained at 16 В± 0.1В°C is separated from the remaining liquid portion (L16) of the whole fat by filtration through ordinary filter paper. The remaining liquid portion (L16) thus obtained after filtration is further fractionated at 8 В± 0.1В°C. in refrigerated water bath. After about 25 min, it gets partitioned into two fractions, one solid (S8) and one liquid (L8), which can be separated by filtration through ordinary filter paper. At last, L8 fraction is further fractionated at 4 В± 0.1В°C for 60 min and filtered to get two fractions, one solid (S4) and one liquid (L4). Finally at the end of fractionation, three solid fractions (S16, S8 and S4) and one liquid fraction (L4) are obtained from ghee sample containing a mixture of adulterants. Solvent from liquid fraction is removed by using rotary evaporator at about 40ВєC, followed by nitrogen flushing to evaporate solvent completely from the liquid fraction. To get rid of entrapped acetone, respective solid fractions are heated to 110ВєC for about 2 hr in an oven. (a) Analysis of first fraction (S16) for CLT at 46ВєC Analyse S16 fraction for CLT at 46 В± 0.1oC (instead of 44В± 0.1oC used for CLT of whole fat) as described above. CLT values of S16 fraction at 46oC range between 4 min 5 sec to 9 min for both cow and buffalo pure ghee. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2008). 192 Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches (b) Analysis of last fraction (L4) for Iodine value Analyse L4 fraction for iodine value as described above. The iodine values for L4 fraction of pure cow and buffalo ghee are found to vary between 37.85- 46. 48. Any deviation from these values gives an indication of adulteration of milk fat (Kumar, 2008). 10. Detection of mineral oil in ghee Isolate the fat from milk by heat clarification method as described above. Take 1 g of fat in a standard joint test tube and add 5 ml of 0.5 N ethanolic KOH solution and reflux by heating in boiling water bath, using condenser for 10 min. or more till saponification process is complete. Add about 5 ml of distilled water to the hot saponified solution. Appearance of turbidity indicates the presence of mineral oil. 11. Rapid color based test for detection of vegetable oils One ml of clear molten fat was dissolved with 1.5 ml of hexane in a tightly capped test tube. To this was added 1.0 ml of color developing reagent (distilled water, Sulphuric acid - Sp.gr.1.835 and Nitric acid - Sp. gr. 1.42 in the ratio of 20:6:14), shaken vigorously and kept undisturbed till it is separated into two layers. The appearance of a distinct orange tinge in the upper layer indicates the presence of vegetable oils / fats including vanaspati (Sharma et al, 2007). 12. Detection of adulteration of rice bran oil in ghee Rice bran oil contains gamma oryzanol, which can be used as a marker for the detection of its addition to ghee. It can be done by thin layer chromatographic method as well as colorimetric method. a) Thin layer chromatographic method A simple thin layer chromatographic method can be employed to detect the adulteration of ghee with rice bran oil, as follows: Gamma oryzanol is extracted from 10.0 gm of molten fat using 20.0 ml of a solvent system consisting of methanol: water (9:1). The contents are vortexed for 2 min and centrifuged at 2000rpm. / 10 min. The alcohol layer is drawn. Extraction protocol is repeated thrice and all the alcoholic extracts are combined and evaporated at 60 вЂ“ 70 В°C in a rotary evaporator. The residue is finally dried. The dried residue is redissolved in 0.5 ml of developing solvent (toluene: ethyl acetate: methanol 90:8:2; v/v) and 5-10 Вµl were applied on silica gel TLC plate and plates are developed in the developing solvent. Properly developed plates are removed from the chamber and air dried followed by spraying with color developing reagent (50% sulfuric acid) and heating at 120В°C/ 10 -15min. Presence of the gamma oryzanol band confirms the adulteration of rice bran oil in milk fat. Addition of rice bran oil in ghee at 5% level is easily detected by this method. (Kumar, et al, 2008). b) Colorimetric method Take 1ml of melted ghee sample in a dry test tube. Add 1.5 ml of hexane to dissolve the fat. Then, in sequence, add 0.5 ml of dilute (25%) hydrochloric acid and 0.5 ml of 5% sodium nitrite solution and mix, followed by the addition of 1 ml of 10% sodium hydroxide solution. Rice bran oil produces orange-red color while other vegetable oils produce no color. Hence, this method is specific for the detection of rice bran oil in ghee. As low as 2% rice bran oil added in ghee, can be detected by this method. 193 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Standards of ghee under PFA rules Sr. No. Name of the State & U.T. 1. Bihar, Chandigarh, Delhi, Punjab, Haryana (Areas other than cotton tract areas), West Bengal (Areas other than Bishnupur sub-division), Sikkim, Jharkhand. 2. Manipur, Meghalaya, Mizoram, Arunachal Pradesh, Orissa, Uttaranchal, Nagaland, Tripura, Assam, Goa, Kerala, Himachal Pradesh, U.P., J & K, Rajasthan (Areas other than Jodhpur Divn), Haryana (Cotton tract areas), Lakshadweep, Maharashtra(Areas other than cotton tract areas). BR Reading at 40ВєC RM value (Min) % of FFA (as Oleic acid) (Max) % of Moisture (Max) 40-43 28 3 0.5 40-43 26 3 0.5 3. Karnataka (Belgaum district), Madhya Pradesh (Areas other than cotton tract areas), Pondicherry, Chhatisgarh. 40-44 26 3 0.5 4. Andhra Pradesh, Daman & Diu, Dadar & Nagar Haveli, Karnataka (Areas other than Belgaum distt.) 40-43 24 3 0.5 5. Andaman & Nicobar Island, Tamil Nadu. 41-44 24 3 0.5 6. Gujarat (areas other than cotton tract). 40-43.5 24 3 0.5 7. Gujarat (cotton tract areas), Madhya Pradesh (Cotton tract areas), Maharashtra (cotton tract areas), Rajasthan (Jodhpur sub division), West Bengal (Bishnupur sub division). 41.5-45 21 3.0 0.5 Baudouin test shall be negative By cotton tract is meant the areas in the state where cotton seed is extensively fed to the cattle and so notified by the State Govt. concerned. Usually such cotton tract areas ghee has low RM value and high BR reading compared to other areas Ghee may contain BHA not more than 0.02% as antioxidant. References: Singhal, O.P. (1980). Adulteration & Methods for detection. Indian Dairyman, 32: 771-774. Arora, K.L.; Lal. D, Seth. R and Ram, J. (1996). Platform Test for detection of refined mustard oil adulteration in milk. Indian J. Dairy Sci., 49(10): 721-723. Panda, D.K. (1996). Detection of adulteration of foreign fats in milk fat. M.Sc. thesis, submitted to N.D.R.I. Deemed University, Karnal. Lal, D.; Seth, R.; Arora, K.L. and Ram, J. (1998) Detection of vegetable oils in milk. Indian Dairyman., 50(7): 17-18. Kumar.A; Lal.D; Seth.R and Sharma.R (2002) Recent trends in detection of adulteration in milk fat вЂ“ A Review. Indian J. Dairy Sci., 55 (6): 319 - 330. Sharma. V; Lal, D and Sharma. R. (2007) Color based platform test for the detection of vegetable oils/fats in ghee. Indian J. Dairy Sci. 60,1: 16 вЂ“ 18. Kumar. A; Sharma. V and Lal.D (2008) Development of a thin layer chromatography based method for the detection of rice bran oil as an adulterant in ghee. Indian J. Dairy Sci. 61,2: 113 вЂ“ 115. Kumar. A; Ghai, D. L; Seth, R and Sharma, V (2009) Apparent solidification time test for detection of foreign oils and fats adulterated in clarified milk fat, as affected by season and storage. International J . Dairy Tech. 62: 33 вЂ“38. Kumar. A; Lal, D.; Seth, R and Sharma, V (2010) Detection of milk fat adulteration with admixture of foreign oils and fats using a fractionation technique and the apparent solidification time test. International J . Dairy Tech. 63 (3): 457 вЂ“462. Kumar. Amit; (2008) Detection of adulterants in ghee. Ph. D thesis submitted to NDRI, Karnal (Deemed University). ISI (1981). Handbook of Food Analysis. IS: SP:18, Part XI. Dairy Products. Bureau of Indian Standards, New Delhi. Lal, D.; Seth, R and Sharma, R; Kumar. A. (2005) Approaches for detection of adulteration in milk fat-An overview. Indian Dairyman 57(10): 31-43. 194 Determination of Total Polyphenolic Content in Fruit Enriched Dairy Product Determination of Total Polyphenolic Content in Fruit Enriched Dairy Product Rajesh Kumar and Richa Singh Dairy Chemistry Division, NDRI, Karnal Introduction: Polyphenols are plant secondary metabolites commonly found in herbs and fruits, such as berries, apples, citrus fruit, cocoa, grapes, vegetables like onions, olives, tomatoes, broccoli, lettuce, soybeans, grains and cereals, green and black teas, coffee beans, propolis, and red and white wines. Many of these polyphenols are responsible for the attractive colour of leaves, fruits and flowers. Further, polyphenolics are classified as:- Simple phenols: Phenol acids are phenols that possess one carboxylic acid functionality such as the hydroxycinnamic and hydroxybenzoic acid; Flavonoids: Polyphenol possessing at least two phenol subunits and Tannins: Polyphenol possessing three or more phenol subunits. The quantification of polyphenol content in foods and beverages is critical for understanding the potential health benefits of polyphenols. Principle: The polyphosphotungstates are colorless in the fully oxidized 6+ valance state of the metal, and the analogous molybdenum compounds are yellow. They form mixed heteropolyphosphotungstates- molybdatesthey exist in acid solution as hydrated octahedral complexes of the metal oxides coordinated around a central phosphate sequence of reversible one or two electron reductions lead to blue species such as ( PMoW11O40)4- . In principle, addition of an electron to a formally nonbonding orbital reduces nominal MoO4+ units to вЂњisostructuralвЂќ MoO3+. Tungstate forms are considered to be less easily reduced but more susceptible to one electron transfer. Molybdates are considered to be reduced more easily to blue forms. Mixed complexes as in Folin-Ciocalteu reagent are intermediate. Blue products of phosphomolybdate reduction can have Mo6+ to Mo5+ ratios of 9.6 to 0.6. The 4 e- reduced species is the most stable blue form and develops readily from mixture of Mo6+ and Mo5+. Folin: Mo(VI) (yellow) + e- (from AH) в†’ Mo(V) (blue) Reagents: a) Folins CiocalteuвЂ™s reagent: (0.2N): The Folin-Ciocalteu reagent (FCR) is a mixture of phosphomolybdate and phosphotungstate used for the colorimetric assay of polyphenols and polypolyphenols antioxidants. 2N Folin-CiocalteuвЂ™s phenol reagent (SRL) is diluted with distilled water in the ratio 1:10. b) Sodium carbonate solution: (7.5% (w/v) 7.5 g of sodium carbonate is dissolved in distilled water and make-up the Volume to 100ml using volumetric flask. c) Sample: Two gm of fruit fortified dahi sample was placed in 10ml volumetric flask and diluted with distilled water and subjected to centrifugation at 4000g for 10 min at 4В°C and the supernatant was collected. d) Gallic acid stock solution (1mg/ml) 1g of Gallic acid (Sigma) was dissolved in 10ml ethanol and made up the volume to 1000 ml with distilled water using volumetric flask. Procedure: a. Take 400Ојl of appropriately diluted sample/gallic acid standard in a test tube. b. To it add 2000Ојl of diluted Folin-CiocalteuвЂ™s reagent and mix with vortex mixer. 195 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance c. After 3 minutes add 1600 Ојl of sodium carbonate solution and incubate under dark at room temperature for 30 min. d. For blank preparation take 400Ојl of distilled water instead of sample. e. Measure the absorbance of the samples against blank at 765nm using SPECORD-200 double beam spectrophotometer (Analytical zena). C. Standard curve preparation: Standard curve is prepared by using 10-100 Ојg/ml concentration of gallic acid solution. D. Results: Express the results in terms of Ојmol gallic acid equivalent (GAE) /g of fruit pulp. 196 Separation and Identification of Low Molecular Weight Proteins Using Tricine SDS-PAGE Separation and Identification of Low Molecular Weight Proteins Using Tricine SDS-PAGE Neelima Sharma1, Rajan Sharma1 and Y. S. Rajput2 1 Dairy Chemistry Division, 2Animal Biochemistry Division, NDRI, Karnal The purpose of SDS-PAGE is to separate proteins according to their size. SDS-PAGE is the most widely used method for analyzing protein mixture quantitatively. It is particularly useful for monitoring protein purification and, because the method is based on the separation of proteins according to size, it can be used to determine the relative molecular mass of proteins. SDS (CH3-(CH2)10-CH2OSO3-Na+) is an anionic detergent and when proteins are treated with SDS in presence of a reducing agent like ОІ-mercaptoethanol or dithiothreitol, SDS binds to hydrophobic regions of protein molecule and provides net negative charge on protein molecule. The binding of SDS to per unit length of protein molecules is almost constant for large number of different proteins and this brings charge-to-mass ratio almost constant for most proteins. The electrophoretic movement of protein in acrylamide gel is determined by molecular weight of proteins. Lower molecular weight proteins move faster than high molecular weight proteins. Glycine-SDS-PAGE (also known as Laemmli-SDS-PAGE) and Tricine-SDS-PAGE, based on glycine-Tris and Tricine-Tris buffer systems, respectively are the commonly used SDS electrophoretic techniques for separating proteins. Tricine-SDS-PAGE is commonly used to separate proteins in the mass range 1-100 kDa. It is the preferred electrophoretic system for the resolution of proteins smaller than 30 kDa. Tricine, used as the trailing ion, allows a resolution of small proteins at lower acrylamide concentrations than in glycineSDS-PAGE systems. A superior resolution of proteins, especially in the range between 5 and 20 kDa, is achieved without the necessity to use urea. The omission of glycine and urea prevents disturbances which might occur in the course of subsequent amino acid sequencing. Requirements (A) Reagents 1. Acrylamide solution (49.5% T, 3%C) вЂў Acrylamide : 48 g вЂў N, NвЂ™- Methylene-bis-acrylamide : 1.5 g вЂў Dissolved in distilled water to a final volume of 100 ml. Filter the solution and refrigerate (7-10В°C). Gentle warming may be required for complete dissolution after refrigeration. вЂў %T = Total acrylamide percentage of both monomers (acrylamide and the crosslinker bisacrylamide) вЂў %C = Percentage concentration of the crosslinker relative to total concentration 2. Gel buffer (3X) вЂў Tris : 36.34 g вЂў SDS : 0.3 g вЂў HCl вЂў Dissolve in 60 ml water. Adjust the pH to 8.45 with concentrated HCl. Make up the final volume upto 100 ml with water. Store at 20 вЂ“ 25В°C. 3. Cathode buffer (1X) вЂў Tris : 12.11 g вЂў Tricine : 17.92 g 197 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance вЂў SDS : 1g вЂў Dissolve in distilled water and make volume upto 1 L. The pH of the solution should be approx 8.2. Do not correct the pH. 4. Anode buffer вЂў Tris 6.05 g вЂў Dissolve in 50 ml. Adjust pH upto 8.9 with conc. HCl/ 1N HCl and then makeup volume up to 500 ml with dist water. 5. Sample buffer (4x) вЂў SDS (12%, w/v) : 12 ml of 20% SDS вЂў Glycerol (30%, w/v) : 6g вЂў Mercaptoethanol (6%.v/v) : 1.2 ml вЂў Coommassie blue G 250 (0.05%) : 0.01g вЂў Tris/HCl (pH 7) (150 mM) : 3 ml of 1 M Tris-HCl вЂў Make up the volume upto 20 ml. 6. Marker (2.5Вµl/well) вЂў Take 3.5Вµl marker and add 10Вµl sample buffer (1.33x). For 1.33x sample buffer, dilute 1ml of 4x sample buffer with 2 ml distilled water. 7. Ammonium persulfate вЂў Dissolve 100 mg of ammonium persulfate in 1 ml of distilled water immediately before use. 8. Separating gel solution (16%) вЂў Acrylamide solution : 5 ml вЂў Gel buffer : 5 ml вЂў Glycerol : 1.5 ml вЂў Water : 3.5 ml вЂў APS : 30 Ојl вЂў TEMED : 10 Ојl вЂў TEMED - N,N,NвЂ™,NвЂ™-Tetramethylethylenediamine. вЂў APS вЂ“ This is the last to be added in the solution. 9. Stacking gel solution (4%) вЂў Acrylamide solution : 1 ml вЂў Gel buffer : 3 ml вЂў Water : 8 ml вЂў APS : 60 Ојl вЂў TEMED : 10 Ојl 10. Fixing solution вЂў 10% TCA (Trichloroacetic acid) 11. Staining solution (0.025% Coommassie brilliant blue g250 in 10% acetic acid) вЂў Dissolve 25 mg of the dye in 100 ml of 10% acetic acid. 12. Destaining solution вЂў 10% Acetic acid. Destain the gel twice. Each incubation should last for 15-60 min. Then transfer the gel to distilled water. вЂў 198 (B) Mini vertical gel electrophoresis unit. Separation and Identification of Low Molecular Weight Proteins Using Tricine SDS-PAGE Method 1. Gel preparation вЂў Prepare gel plates of the size 8 x 10 cm in casting stand for gel electrophoresis. вЂў Prepare the separating gel (16.5%) was, pipette it down into each of the gel cassettes to a height of 4 cm. вЂў Overlay the gel mix with water or butanol to cuy oxygen action and to give a flat gel surface for flat sample bands. вЂў After polymerization carefully remove water with the help of blotting paper. вЂў Then overlay stacking gel solution over it. вЂў Insert preparative comb into the stacking gel solution to make troughs and wells and keep the whole system undisturbed (1 -2 hours) for the setting of gel. 2. Sample preparation вЂў Dissolve 3 mg sample in 500 Вµl of Tris buffer (150 mM, pH 7.0) - Solution A. вЂў Take 3 x 15 Вµl of Solution A and 3 x 5 Вµl of 4x buffer and load 10 Вµl in each well. Each well would contain 45 Вµg of protein. вЂў Then take 100 Вµl of the Solution A and mix with equal volume of Tris buffer (150 mM, pH 7.0). Now again take 3 x 15 Вµl of this sol in 3 x 5Вµl of 4x buffer and load 10 Вµl in each well. Each well would contain 22.5 Вµg of protein. вЂў Incubate samples and marker at 37В°C for 15 min 3. Electrophoresis вЂў Place the gel sandwich after removing the comb in the mini vertical gel electrophoresis unit. вЂў Clamp the sandwich in place. вЂў Load 15 Вµl of protein samples and molecular weight markers to these wells. вЂў Fill the lower buffer chamber with anode buffer. Check that the lower electrode is completely submerged. вЂў Fill the upper buffer chamber with cathode buffer and also layer it over the applied samples carefully. Place the safety lid on the unit. вЂў Run the experiment at 10В°C by keeping the whole assembly in the refrigerator. вЂў Carried out electrophoresis at constant current of 20 mA till the sample crosses the stacking gel. Then the increase the current to 25 mA and maintain throughout the remainder of the run until the marker dye was within 1 cm of the anodic end of the gel. вЂў Remove the gel carefully and then transfer it to the fixative solution. Keep it over an orbital shaker for 60 min. вЂў Stain the gel with staining solution for twice the length of time used for fixing again using orbital shaker. вЂў Transfer the gel to the destaining solution till bands become visible against light background renewing the solution every 30 min. References Schagger (2006 )Nature Protocol, 1 (1): 16-22. Shagger, H. and Jagow, G.V. (1987) Tricine-Sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. 166:368-379. 199 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Identification of Proteins Through Western Blotting вЂ“ Practical Neelima Sharma1, Amit K.Barui1 and Y.S. Rajput2 1 Dairy Chemistry Division, 2Animal Biochemistry Division, NDRI, Karnal Introduction The technique of Western blotting refers to identification of specific proteins, which are first separated on acrylamide gel using electrophoresis and then subsequently transferred to nitrocellulose membrane and identified. The identification of protein (antigen) is carried out by performing antigen-antibody (first antibody) reactions on the membrane itself. Second antibodyenzyme conjugates were then allowed to interact with immobilized first antibody and then using appropriate substrate, protein bands are detected. Although, antigen-antibody interactions are widely employed in Western blot, other kind of interactions such as glycoprotein-lectin and biotinavidin have allowed research workers to employ this technique for other applications including carbohydrate staining of glycoprotein, protein sequencing etc. During 1979-80, this technique was described simultaneously by many workers but the method described by Towbin et al. (1979) is most cited. The technique of Western blotting involves two distinct techniques viz. (i) SDS-PAGE and (ii) electrophoretic transfer of protein from gel to membrane and immuno-detection of proteins. For Western blot, SDS-PAGE is carried out in mini-gel units. The separation of protein in minigel unit is similar to large-gel unit. In mini-gel units, volumes and separation times are considerably reduced. The resolution in mini-gel is adequate for most routine applications. Electrophoretic transfer of proteins from gel to membrane Mini-trans blot assembly (Bio-rad), power pack, orbital shaker, tris, glycine, methanol, nitrocellulose membrane, Whatman No. 3 paper. Transfer buffer (25 mM tris, 192 mM glycine, 20% methanol, pH 8.3)3.03 g tris and 14.4 g glycine are dissolved in distilled water. 200 ml methanol is then added. Volume is made up to 1 litre with distilled water. The pH of buffer will range from 8.1 to 8.4 depending on quality of tris, glycine and methanol. Methanol should be analytical grade as metallic contaminants in low grade methanol will plate on the electrode. The pH of buffer is not adjusted with acid or base. ProcedureвЂў Membrane and gel are handled only after wearing gloves. вЂў After completion of SDS-PAGE, spacer gel is removed. A small cut on top left side in running gel is made to remember the orientation of gel. вЂў The running gel is equilibrated with transfer buffer for 30 min. to remove salts and SDS. Transfer buffer is changed at least once during equilibration. Membrane of appropriate size is cut from sheet. A small cut on top left side of membrane (glossy side facing worker) is made to remember orientation of the membrane. вЂў While the gel is equilibrating, nitrocellulose membrane is activated by placing it in transfer buffer at an angle of 450. Also, fiber pads and pre-cut filter papers (Whatman No. 3) are immersed in transfer buffer. Air bubbles trapped in fiber pads and filter papers are removed. вЂў Gel holder cassete is opened and placed in glass vessel so that the gray panel is flat on the bottom of the vessel and clear panel rests at an angle against wall of the vessel. вЂў Gel holder cassette is assembled in following sequence : gray panel (cathode), fiber pad, filter paper, gel, nitrocellulose membrane (glossy side facing the gel), filter paper, fiber pad, 200 Identification of Proteins Through Western Blotting вЂ“ Practical clear panel (anode). For easy remembrance of orientation, cut portions of gel and membrane is aligned. This arrangement allows transfer of proteins on membrane where well position remains the same as that in acrylamide gel. While assembling, care is taken not to allow trapping of air-bubbles. This is achieved by assembling cassette under buffer and when each layer is added, all air pockets are removed by rolling clean test tube over the layer. Nearly adhesive contact is essential between the membrane and gel otherwise swirled or missing transfer patterns and overall high background will be observed. вЂў Buffer tank is filled with transfer buffer (4ВєC). Bio-freeze cooling unit containing ice is placed in buffer tank. вЂў Gel holder cassette is closed and placed in the buffer tank such that gray panel of the cassette faces the gray cathode electrode panel. The whole of blotting assembly is then placed over the magnetic stirrer. вЂў Electrophoretic transfer is carried out at constant voltage of 30 V overnight at 4ВєC. The starting current should be around 40 mA. At the end of transfer, the current should be 90 mA. In case final value of current is less than 90 mA, a constant voltage of 100 V is additionally applied for 1 h. вЂў After run, nitrocellulose membrane is stained with different reagents for visualization of proteins or antigens. For ascertaining transfer of proteins from gel, the gel is also stained with coomassie brilliant blue as described in earlier section. Detection of transferred protein on nitrocellulose membrane In Western blot, molecular weight markers and protein (antigen) samples are loaded in separate lanes in SDS-PAGE. Whereas, methods used for staining of molecular weight markers are based on non-specific reaction of dye with protein, antigenic proteins are detected employing antigen-antibody interaction. Therefore, after electrophoretic transfer, the membrane-portion containing molecular weight marker is cut from rest of membrane containing protein antigens. The molecular weight markers can be stained by Ponceau S or congo-red dye. The proteins (antigens) are stained using primary antibody and secondary antibody-enzyme conjugates. Visualization of molecular weight markersPonceau S StainingStock Ponceau S dye solution is prepared by dissolving 200 mg Ponceau S in 10 ml of 3% trichloroacetic acid. The stock dye solution can be stored at room temperature. The stock solution is diluted ten fold with distilled water before use. The membrane is added slowly to vessel containing diluted dye solution so that membrane absorbs dye uniformly. The membrane is then sub-merged for 5 to 10 min with mild shaking. After staining, the membrane is then rinsed with water or PBS until a clear contrast between the bands (pink) and background (white) is observed. Staining of proteins with Ponceau S is reversible. Congo-red StainingStock Congo-red solution is prepared by dissolving 1 g Congo-red in 100 ml distilled water. This solution is stable at room temperature. The working congo-red solution is prepared just before use by diluting 1 ml of stock dye solution with 9 ml of 0.2 M acetate buffer, pH 3.5. The membrane is submerged in working congo-red solution for 5 min. at room temperature. The destaining is carried out by immersing the membrane in distilled water until brown bands become visible against light pink background. During staining and destaining, mild shaking is employed. Visualization of Protein (Antigen)- ReagentsPrimary antibodies directed against antigen and raised in rabbit, secondary antibody enzyme conjugates such as goat anti rabbit immunoglobulin-peroxidase goat, anti rabbit immunoglobulin201 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance alkaline phosphatase, diamino benzedine, hydrogen peroxide, bovine serum albumin, nitro blue tetrazolium (NBT) bromochloroindolyl phosphate (BCIP), dimethyl formamide (DMF). Visualization of antigen using secondary antibody peroxidase conjugateAll steps are carried out at room temperature. вЂў Membrane is washed with PBS (3x10 min.) вЂў The membrane is treated with blocking solution (3% BSA prepared in PBS) for 1 h. вЂў The membrane is treated with diluted rabbit antiserum for 1 h. The antiserum in rabbit is raised against the antigen. The dilution is decided by antibody litre in immune serum and is carried out in 1% BSA вЂ“ PBS- (0.05%) Tween вЂ“ 20. The membrane is washed with PBS -0.05% Tween 20 (3x10 min.). вЂў The membrane is treated with goat anti-rabbit immunoglobulin-peroxidase conjugate (1:1000 diluted with 1% BSA вЂ“ PBS вЂ“ Tween 20) for 1 h. The dilution of conjugate is done as per instruction from manufacturer. вЂў The membrane is washed with PBS (4 x 10 min.). вЂў The membrane is immersed in enzyme substrate DAB - H2O2 (6 mg diaminobenzidine in 10 ml of 0.05 M Tris-HCl buffer, pH 7.6 containing 100 Вµl of 3% H2O2 ) till brown bands become visible. The membrane at that stage is washed with distilled water and air-dried. вЂў Membrane strips containing molecular weight markers and proteins (antigens) are aligned and photographed. Visualization of antigen using secondary antibody-alkaline phosphatase conjugate The method is similar to the method described using secondary antibody-peroxidase conjugate except the followings. вЂў Appropriately diluted secondary antibody-alkaline phosphatase conjugate is used instead of antibody-peroxidase conjugate. вЂў Instead of DAB-H2O2, the enzyme substrate used is BCIP-NBT. Stock solutions of nitroblue tetrazolium (NBT) and bromochloro indolyl phosphate (BCIP) are prepared and stored at вЂ“200C. Stock NBT is prepared by dissolving 30 mg NBT in 1 ml of 70 per cent DMF. Stock BCIP is prepared by dissolving 15 mg BCIP in 1 ml of DMF. The working substrate solution is prepared by addition of 200 Вµl of stock NBT and 200 Вµl of stock BCIP to 20 ml of 100 mM Tris-HCl, pH 9.5 containing 100 mM NaCl and 5 mM MgCl2. When membrane is treated with enzyme substrate, light violet colour blots become visible against light background. Helpful-hints вЂў The one major problem in Western blot is incomplete transfer of protein from gel to nitrocellulose membrane. Transfer efficiency is improved by decreasing gel concentration which leads to more porous gel. In more porous gel, the resolution of proteins is decreased. Gel containing low molecular weight proteins should not be excessively washed after SDS-PAGE and before transfer to avoid removal of these proteins in washing. вЂў Methanol in transfer improves binding of SDS-proteins to nitrocellulose membrane but it causes acrylamide gel pores to contract resulting in fixation of large molecular weight proteins within the gel matrix. In case of poor transfer of large molecular weight proteins, one can try transfer in transfer buffer containing reduced concentration of methanol. вЂў Gel and membrane must make good contact. Thus excess moisture in the gel-membrane interface should be removed by rolling test tube over membrane while gel holder cassette is assembled. вЂў Poor transfer can occur if the protein is basic (ie pI > 9) as protein will have net positive charge at the pH of transfer buffer (pH 8.5). 202 Identification of Proteins Through Western Blotting вЂ“ Practical вЂў Lower concentration of methanol (< 15%) does not facilitate removal of SDS from the gel and proteins. вЂў Nitrocellulose membrane is compatible with enzyme immuno assay. Blocking of free protein binding sites is easy and thus background problems are not observed. No activation of the membrane is required. However, some proteins (<20 KD) may be lost during post transfer washes. вЂў Zeta-Probe positively charged nylon membrane allow binding of SDS protein complexes in absence of methanol. These membranes are of choice when elution of high molecular weight protein or protein having high negative charge is required. Small proteins bind tightly. The capacity of Zeta-Probe nylon membrane (480 Вµg/cm2) is much higher as compared to nitrocellulose membrane (80-100 Вµg/cm2). Blocking of membrane (Zeta-Probe) is difficult and results in high background. References Kurien, B.T and ScoWeld, R. H. (2006) Western blotting. Methods: 38 (2006) 283вЂ“293. Towbin, H.; Stachelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Nat. Acad. Sci. USA. 76: 4350-4354. 203 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Typing of Milk for A1 and A2 beta Casein Sachinandan De, C. M. Hari Kishore, Ayan Mukherjee and Rupinder Kaur Animal Biotechnology Centre, NDRI, Karnal Milk contains numerous components of nutritional and health benefit. Calcium is one example. Milk is also a significant source of dietary fat. An additional risk factor present in some bovine milk related to the beta casein has been discovered. Initially, three variants of beta casein were discovered and denoted as A, B and C. It was later found that the A variant could be resolved into A1, A2 and A3 by gel electrophoresis. The beta casein variants now known are A1, A2, A3, B, C, D, E and F, with A1and A2 being present in the milk in the highest proportions. The debate about A1 and A2 milk types has been in the public arena for more than ten years. There have been lots of claims and counter claims about whether вЂ�ordinary milkвЂ™, which is a mixture of A1 and A2 milk, is linked to a range of disease conditions, and whether selecting for cows that produce only A2 milk can avoid these problems. We have successfully developed a method for typing DNA from cells available from the milk. We are also in the process of detecting A1 A2 beta casein variants from the milk sample. This is an innovative process for the isolation of DNA from milk and milk products. The DNA samples obtained from the milk and milk products were used for differentiation of A1 and A2 beta-casein by simple PCR technique. CowsвЂ™ milk b-casein contains 209 amino acids. The A1 and A2 variants differ only at position 67, which is histidine in A1 or proline in A2 milk. (Another variant B b-casein also has histidine at positive 67. It is less frequent than A1 or A2 in the milk of cows of European origin.) A bioactive sevenamino-acid peptide, b-casomorphin-7 (BCM-7) can be released by digestion in the small intestine of A1 b-casein with pepsin, leucine aminopeptidase and elastase but the alternative proline at position 67 prevents a split at this site. Tyr60-Pro61-Phe62-Pro63-Gly64-Pro65-Ile66-His67 b-casomorphin-7 (BCM-7) BCM-7 has opioid and cytomodulatory properties. Synthetic BCM-7 can inhibit responses of lymphocytes to stimulants in vitro (Elliott, 1992; Elliott et al, 1997). Elliott et al (1997) reported that NOD mice fed A1 b-casein did not develop diabetes if they were also given naloxone (the morphine antagonist). The antibody response to ovalbumin was prevented in NOD mice if they were also given injections of (synthetic) BCM-7; this prevention did not happen in Swiss mice. They suggested that appearance of diabetes in genetically susceptible NOD mice fed A1 bcaseinвЂ” not those fed A2 b-caseinвЂ”might be due to release from A1 b-casein of the bioactive peptide, BCM-7 which had a strong inhibitory effect on immune function. Some 75% of the worldвЂ™s 300 million strong dairy herd produces milk that contains the protein beta casein A1. There is a somewhat controversial claim, backed by 16 years of research, that this milk, which is drunk by most people in the western world, could be a cause of diabetes, heart disease, autism and schizophrenia in people with immune deficiencies. It is also claimed that the protein beta casein A2 is benign in this respect. Cows in the well-known dairy breeds can produce either or both of the beta casein proteins. They can be A1/A1, A1/A2, or A2/A2. Genotyping has shown that about 80% of Indian (Bos indicus) cows produce only beta Casein A2. In Australia, A2 milk was launched (A2 Corporation) quietly into the world marketplace. A2вЂ™s backers believe it will help prevent disease and make them fortunes. A1 proponents argue that the evidence against ordinary milk has not been proved and that they are the victims of a scare campaign. The New Zealand Medical Journal published a paper in 2003 entitled вЂ�The influence of consumption of A1 Гџ-casein on heart disease and Type 204 Typing of Milk for A1 and A2 beta Casein 1 diabetesвЂ™, (http://www.nzma.org.nz/journal/116-1168/295/) by Murray Laugesen, and Robert B Elliott. We all know the well documented and proven benefits of drinking milk which is a mixture of A1/A2. The general view is that there may be quite some way to go before the hypothesis can be proved by evidence of cause and effect. A PCR based method was developed to detect the A1 and A2 beta casein variant forms in cattle and buffalo milk. Buffalo milk is of A2 type so far the numbers of samples are tested in our laboratory. Different proportions of A1 and A2 alleles are found in Indian cattle milk. This A1 allele is represented in heterozygous A1A2 type as well as in A1A1 type. Some animals are homozygous for example bovines that are A1A1 for Beta casein and those A2A2 for beta casein. In bovine, a mutation in the DNA sequence coding for the beta casein protein at nucleotide position 200 has resulted in the replacement of a cytidine base with an adenine base. Thus, the triplet codon affected by this change codes for histidine (CAT) rather than for proline (CCT) at amino acid position 67 of the protein. Thus, the histidine at position 67 results in the cow producing beta casein A1 type while the proline results in the cow producing beta casein A2 type. A high proportion of the common domestic cattle breeds, such as Holstein, express the beta casein A1type. It was estimated that in the late 1980s more than 70% of the Californian Dairy herd carried the A1 allele. If the hypothesis of undesirable role of A1 betacasein is confirmed, consumers may wish to reduce or remove this allele from their diet. In this way, we systematically try to monitor the frequency of beta-casein alleles in bulls and indirectly in cows. 205 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Enzyme-Linked Immunosorbent Assay-Practical Suman Kapila and Rajeev Kapila Animal Biochemistery Division, NDRI, Karnal Enzyme-linked immunosorbent assay, commonly known as ELISA is a heterogeneous EIA based on the same principle as the radioimmunoassay but depends on an enzyme rather than a radioactive label. An enzyme conjugated with an antibody reacts with a colorless substrate to generate a colored reaction product. Such a substrate is called a chromogenic substrate. A number of enzymes are being used for ELISA like alkaline phosphatase, horseradishperoxidase and ОІ-galactosidase. The specificity, sensitivity and ease to perform these techniques have made these methods popular. A number of variations of ELISA have been developed. Indirect ELISA Coat well with Addition of specific Ag Ab Addition of secondary Ab (Enzyme -conjugated) Addition of substrate measure color Sandwich ELISA Coat well with Addition of Ag Ab Addition of secondary Ab (Enzyme -conjugated) Addition of substrate measure color Competitive ELISA Incubation of antibody with the Ag 206 Addition of Ag-Ab mixture Addition of secondary Ab(Enzyme -conjugated) Addition of substrate measure color Enzyme-Linked Immunosorbent Assay-Practical Assay for immunoglobulins in colostrums/milk/serum by sandwich ELISA Reagents: Coating buffer: 50mM Carbonate-Bicabonate Buffer, pH 9.6 Washing buffer : 0.05 percent Tween in PBS (PBS/T). Blocking solution : 1 percent BSA (fraction V) in PBS/T. Coating antibody : Sheep anti-Bovine IgG Standard : Bovine reference serum Detection antibody : Sheep anti-Bovine IgG HRP conjugate Substrate : TMB/ H2O2 (0.02%) substrate Stop solution : H2SO4 (2M) Procedure Coating 1. Dilute capture antibody at a ratio of 1:100 with coating buffer and add 100ul of diluted capture antibody to coat each well. 2. Incubate for at least 1h at room temperature 3. After incubation, aspirate the solution of each well and wash the wells three times with washing buffer. Blocking 1. Add 200ul of blocking solution to each well 2. Incubate for at least 1h at room temperature. 3. After incubation, aspirate the solution of each well and wash the wells three times with washing buffer. Reacting Standards and Samples For preparation of sample, take 20ml of milk/colostrums, warm it and add 0.5ml of rennet solution (0.5%). After 10 minutes, filter the coagulated sample using Whatman 42. Take filtrate for quantification of antibodies. 1. Dilute the standards and samples in blocking solution at 1:2 serial dilutions 2. Transfer 100ul of standard or sample to assigned wells. 3. Incubate for at least 1h at room temperature. 4. After incubation, aspirate the solution of each well and wash the wells five times with washing buffer.. Detection Antibody 1. Dilute the detection antibody in blocking solution. 2. Add 100ul per well and incubate for 1h at room temperature. 3. After incubation, aspirate the solution of each well and wash the wells five times with washing buffer. Colour reaction 1. Add 150ul of substrate solution containing 50ul TMB and 100ul H2O2 to each well. Mix well by shaking slightly. 2. After incubation for 10-15 minutes at room temperature add 50ul stop solution 3. Using a microtiter plate reader, read the plate at 450nm. 207 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Evaluation of Biological Activity of Milk Protein Ingredients Bimlesh Mann, Prerna Saini, Prabhakar Padghan, Anuradha Kumari Dairy Chemistry Division, NDRI, Karnal With the growing popularity of high protein dairy products among health conscious consumers, many dairy manufacturers are looking for ways to boost the protein level of foods such as yoghurt, dairy beverages and frozen desserts. Milk protein ingredients which include sodium caseinate, whey protein concentrate (WPC), whey protein isolates (WPI) and milk protein hydrolysates, not only improve the nutritional profile of dairy foods, but also provide the functionality. From a nutritional perspective, all the milk ingredients are complete, high quality protein with all the essential amino acids required for the human nutrition. From functional perspective, WPC and WPI are highly soluble over a wide pH range and contribute emulsifying, water binding, thickening, foaming, gelling, and film forming properties to food and beverages system. While the milk protein hydrolysate are fully soluble and less likely to gel at high concentration in the high protein beverages compared to intact milk proteins. From the biofunctional point of view, milk proteins are the potential sources of bioactive peptides with antimicrobial, ACE- inhibitory, cholesterol lowering, antioxidant, immunomodulatory and opioid properties. These peptides are inactive within the protein sequence and require enzymatic proteolysis for their release. Bioactive peptides usually contain 3-20 amino acid residues per molecule. These milk derived bioactive peptides are considered as prominent ingredients for various health promoting functional foods targeted at heart, bone and digestive system health as well as improving immune defense, mood and stress control. 1) Antioxidant activity:Free radicals are generated through normal reactions within the body during respiration in aerobic organisms, particularly vertebrates and humans. In addition to the physiological production of oxidants and their secondary reactions, there are other sources for production of oxidants. Oxidation of fats and oils during processing and storage of food products worsen the quality of their lipid content and nutritive values. Consumption of these potentially toxic products can give rise to several diseases. Under normal conditions, antioxidant defense systems can remove reactive species through enzymatic antioxidants like superoxide dismutase and glutathione peroxidase and non-enzymatic antioxidants such as proteins and peptides, antioxidant vitamins, trace elements, coenzymes and cofactors. The milk derived bioactive peptides show antioxidant activity by sequestering free radicals, chelating metal and regulating the level of antioxidant enzymes in body. Principle: Based on the principle of interaction of antioxidant with chemically generated ABTSЛ™ (blue coloured) oxidant by persulfate oxidation of 2, 2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS2-) indicated by decrease in absorbance at 734nm with concomitant decrease in blue colour of the oxidant. Sample preparation: 5% solution of whey protein concentrate preheated at 65В°C /30 min is hydrolyzed by using alcalase at 65В°C for 5 hrs by maintaining pH at 8.5. The hydrolysate is centrifuge at 10000 rpm/30 min and supernatant is collected. 208 Evaluation of Biological Activity of Milk Protein Ingredients Reagents: a) Potassium persulphate solution (140 mM) b) ABTS [2, 2вЂ™-azinobis (3 ethyl benzothiazoline)-6-sulfonic acid] stock solution Dissolve 19.2 mg of ABTS in 5 ml of double distilled water; add 88 Вµl of 140 mM potassium persulphate and keep the solution in an amber colour bottle in dark for 12-16 hours. c) Phosphate buffer saline (pH 7.4) PBS was prepared by dissolving 8.0 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4 and 0.24 g of KH2PO4 in 800 ml distilled water, adjusted pH to 7.4 with 1 N HCl and made the volume to 1 liter with distilled water. d) ABTS working solution Dilute 1 ml of ABTS stock solution with phosphate buffer saline (approx 1:90) till it gives an absorbance of 0.70В±0.02 at 734 nm. The stock solution of ABTS is stable upto 2 days for analytical purpose. e) Trolox solution (5 mM) Dissolve 12.5 mg of Trolox [6-hydroxy. 2, 5, 7, 8 вЂ“ tetramethyl chroman-2-carboxylic acid] in 10 ml of ethanol. Dilute with distilled water to varying concentrations (25 - 250ВµM). Procedure: вЂў Pipette out 3 ml of ABTS working solution in 3 ml cuvette вЂў Pipette out 3 ml of phosphate buffer saline in another cuvette вЂў Insert the curette into the respective slots in the double beam spectrophotometer вЂў Add 10 Вµl of appropriate diluted sample / Trolox to both reference and ABTS solution вЂў Mix the contents for 10 seconds вЂў Measure the decrease in the absorbance at 734nm over a period of 10 minutes at 10 sec interval. вЂў Plot the standard curve with concentration (ВµM) of Trolox (X-axis) vs % inhibition (Y-axis) вЂў Express the results as trolox equivalent antioxidant capacity (TEAC) values i.e. ОјM trolox equivalent / mg of protein using standard curve. 2) Antihypertensive activity:Angiotensin I converting enzyme (ACE; kinases II peptidyldipeptide hydrolase, EC 3.4.15.1) is important for blood pressure regulation. In the event where decreased blood volume or decreased blood flow to the kidneys is sensed, renin acts on angiotensinogen to form angiotensin I. ACE then catalyses the hydrolysis of the inactive prohormone angiotensin I (decapeptide) to angiotensin II (octapeptide). The result is an increase in blood pressure through vasoconstriction, via increased systemic resistance and stimulated secretion of aldosterone resulting in increased sodium and water resorption in the kidneys. ACE also inactivates the vasodilating peptide bradykinin (nonapeptide) and endogenous opioid peptide Met-enkephalin. Biologically active peptides derived from milk proteins are having an affinity to modulate blood pressure by inhibit ACE activity. Principle: The method is based on the liberation of hippuric acid from hippuryl-L-histidyl-L-leucine (HHL) catalyzed by ACE. Sample preparation: 5% solution of whey protein concentrate preheated at 65В°C /30 min is hydrolyzed by using alcalase at 65В°C for 5 hrs by maintaining pH at 8.5. The hydrolysate is centrifuge at 10000 rpm/30 min and supernatant is collected. 209 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Reagents: Hippuryl- histidyl-leucine (HHL) (5 mM) 10.74 mg of HHL (Sigma, U.S.A) was dissolved in 5 mL of 0.1 M sodium borate buffer (pH 8.3) with 0.3 M NaCl, pH 8.3 Sodium Borate buffer (0.1 M, pH 8.3) containing 0.3 M NaCl Sodium tetra borate 3.81 g and NaCl 1.75 g were dissolved in 80 mL of distilled water, pH was adjusted to 8.3 and finally volume was made to 100 mL with distilled water. Angiotensin converting enzyme (ACE) ACE from rabbit lung (Sigma, U.S.A) 1 unit was dissolved in 5 mL of distilled water and stored at -20ВєC. Procedure: 1. Add 20 Ојl of sample to 110 Ојl of substrate (in 5 mM HHL in 0.1 M borate buffer) 2. Add 20 Ојl ACE (4 mU), mix and incubate the mixture at 37ВєC for 30 min. 3. Add 250 Ојl of 1M HCl to terminate the reaction 4. Extract the hippuric acid formed with 1.5 ml ethyl acetate centrifuging at 3000 g for 10 min 5. Dry one ml of upper organic layer by heating at 95ВєC for 20min and redissolve in 1 ml of distilled water 6. Measure the absorbance at 228nm 7. Prepare positive control with distilled water in place of sample 8. Prepared blank with substrate and water (ACE volume is replaced by equal amount of water) 9. Calculate % ACE = Express the results as peptide concentration required to inhibit 50 percent of the original ACE activity (IC50). 3) Caseinophosphopeptides as mineral binding peptides:Caseinophosphopeptides(CPPs) are casein derived peptides contains phosphorus bound via monoester linkages to seryl residues. They contain a common motif i.e. a sequence of three phosphoseryl groups followed by two glutamic acid residues Ser (p)- Ser (p)- Ser (p)- Glu- Glu. These peptides are highly negatively charged structures and soluble at pH 4.6. The highly anionic phosphorylated regions and the a.a. sequence around this hydrophilic region part play a significant role in mineral binding and absorption in body. These peptides are able to bind macroelements such as Ca, Mg and Fe along with trace elements such as Zn, Ba, Cr, Ni, Co and Se. Principle: CPPs are soluble at pH 4.6 and they are aggregated with divalent cation such as calcium at neutral pH and precipitated by using ethanol. Procedure: вЂў Prepare 5 % casein suspension by mixing casein on a magnetic stirrer вЂў Adjust the pH to 7 using 0.5 N NaOH. вЂў Add enzyme tripsin at Enzyme: substrate ratio of 1:25 вЂў Hydrolysis is carried out by mixing the suspension using electric stirrer in water bath at 37ВєC for 4 hours вЂў The pH of solution is kept constant at 7.0 by addition of 0.1N NaOH solution 210 Evaluation of Biological Activity of Milk Protein Ingredients вЂў After complete hydrolysis remove the mixture from water bath вЂў Adjust the pH of casein hydrolysate to 4.6 using 2N HCl вЂў Centrifuge at 3000 rpm for 10 min to remove the unhydrolyze protein. вЂў Collect the supernatant and adjust pH to 7.0 using 2.0 N NaOH. вЂў Add calcium chloride at 1% level to the supernatant and allow it for 1 hour at room temperature. вЂў Add Ethanol 50%(V/V) вЂў The precipitate is collected by centrifugation at 6000 rpm for 10 min. вЂў The CPPs thus obtained is lyophilized. Flow Diagram for Isolation of CPPs: Whole casein Hydrolysis with enzymes at 37ВєC Adjustment of pH to 4.6 with 2N HCl Removal of unhydrolyze protein by centrifugation at 3000 rpm /10min Adjustment of pH to 7.0 using 2N NaOH Calcium chloride aggregation and ethanol extraction by Centrifuging at 6000 rpm/10min Enriched CPPs 211 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Purification of Bioactive Proteins from Milk Neha Mishra1, Rajesh Kumar2 and Jai K Kaushik1 1 Animal Biotechnology Centre, 2Dairy Chemistry Division, NDRI, Karnal Colostrum secretion in the mammary gland during the first few days after parturition provides the calves with nourishment and passive immunity. Differences between relative protein concentration in colostrum and milk reflect differences in immunoglobin transfer. It is a source of nutrients and contains many kinds of bioactive molecules which are essential for specific functions. The major whey proteins are ОІ-lactoglobulin, О±-lactalbumin, lactoperoxidase, lactoferrin and immunoglobins etc. Lactoferrin and immunoglobin G are two of the most important bioactive components in colostrum and both are contained in over 10 fold higher concentrations in colostrum as compared to normal milk. Several proteins with antimicrobial activity, such as immunoglobulins, Оє-casein, lysozyme, lactoferrin, haptocorrin, ОІ-lactalbumin, and lactoperoxidase, are relatively resistant against proteolysis in the gastrointestinal tract. Lactoferrin is nearly 80-kDa glycoprotein belonging to transferin family with characteristic red color due to iron binding. Apart from being present in high concentration in colostrum, lactoferrin is also an important component of many external secretions such as saliva, tears, semen, mucosal secretions and neutrophilic granules of leucocytes. Membrane separation and chromatography are commonly used techniques for isolation of high purity lactoferrin. Compared with other chromatographic methods, ion-exchanger is an advantageous technique due to its low cost, reduced number of steps and easy to scale up. Lactoferrin is subjected to cation exchanger by taking advantage of its basic nature, as LF has isoelectric point of ~ 9, while major whey proteins alphalactalbumin and Гџ-lactoglobulin have pI values of 4.2 and 5.4, respectively. Therefore, by employing weak cation exchanger at neutral pH, lactoferrin is allowed to bind to the resin followed by elution using a linear gradient of NaCl. Materials and method Fresh buffalo or cattle colostrum, 7 gms CM-sephadex per liter colostrum, Tris-HCl - 50mM, pH8.0 equilibration buffer, Tris-HCl (50mM, pH 8.0) + 0.2M NaCl washing buffer, Tris-HCl (50mM, pH 8.0) + 0.5M NaCl elution buffer, Tris-HCl (50mM, pH-8.0) +1M NaCl. Glass column of ca 1.5-2.5 cm diameter and 50 cm in height can be employed at the first step of purification of lactoferrin in a batch mode. High resolution purification requires prepacked cation-exchanger like CM-sepharose or MonoS (GE Biosciences) connected with a medium pressure protein purification system, e.g. AktaPrimer or Akta Explorer (GE Biosciences). The cation exchanger column and purification system from other suppliers may also be used without any effect on purification; however in our lab, the protocol for high resolution purification of lactoferrin has been optimized on HiLoad 16/10 SP-Sepharose high performance cation exchange column from GE Biosciences. Procedure CM-Sephadex (7g/litre) ion exchanger resin is equilibrated with 2 volume of Tris-HCl 50mM, pH 8.0. 2 liters of fresh colostrum is defatted by centrifuging at 3-5000 rpm for 15 mins. Fat layer can be removed from centrifuge bottles by spatula followed by filteration of the defatted milk through a double layered cheese cloth. The skimmed milk is then resuspended in 2-3X volume of 50 mM Tris-HCl pH 8.0. Pre-equilibrated CM-sephadex matrix (50 mM Tris-HCl pH 8.0) is then added and lactoferrin and other cationic proteins are allowed to bind to the matrix by continuous manual stirring for 2-3 hours. Mixture was left overnight on the magnetic stirrer at 4 ВєC for effective binding which was observed by change in color of the gel. Stirring is stopped and the matrix gel is allowed to settle in the bottom of the vessel. Whey can be decanted carefully without disturbing the gel. The settled gel is then washed with 3-4 volumes of Tris-HCl 50mM, pH 8.0 until whey has been completely removed 212 Purification of Bioactive Proteins from Milk from the matrix, which can be packed in the column. Lactoperoxidase and immunoglobins are eluted by washing the matrix with Tris-HCl 50mM, pH 8.0 + 0.2M NaCl. Lactoperoxidase is eluted as a blue-greenish layer. This is followed by elution of lactoferrin with 0.5M NaCl with Tris-HCl 50 mM at pH 8.0. Isolated lactoferrin is then dialyzed in 50mM Tris-HCl pH 8.0 to remove the NaCl, followed by concentration by using 30kDa ultrafiltration devices (4000rpm for 30 mins) like Centricon from Millipore or equivalent from other manufacturers. Highly purified lactoferrin can be obtained by loading it into SP-Sephrose column equilibrated with 0.4M NaCl + 50mM Tris-HCl, pH 8.0 and eluted through a linear gradient of 0.4M NaCl -0.7M NaCl with 50 mM Tris-HCl pH 8.0. Level of purity of the sample can be analyzed by SDS-PAGE. Flow diagram of purification of lactoferrin from colostrum Fresh colostrum Centrifuged at 4000 rpm (250-500 ml bottle fixed rotor) Remove fat by filtering through cheese cloth Dilute whey 2-3 times with 50 mM Tris-HCl, pH 8.0 Add CM-Sephadex C-50, pre-equilibrated with 0.05M Tris- HCl, pH 8 Stir the gel in the colostrums manually for 2-3 hours, leave it O/N with stirring Decant the whey, and wash the settled gel with 0.05M Tris HCl pH 8.0 Gel washing followed by decantation is repeated at-least thrice Proteins like LP and Ig are washed from gel with 0.05 M Tris-HCl / 0.2 M NaCl (pH 8.0) The lactoferrin is eluted as a red solution with 0.05 M Tris-HCl/ 0.5 M NaCl (pH 8.0). Lactoferrin eluted at 0.5 M NaCl is pooled, ultrafiltered and passed through Hiload SP-Sephrose column equilibrated with 0.4 M NaCl/ 50mM Tris-HCl (pH 8.0) Run SDS-PAGE for evaluating the quality of purified lactoferrin The purified sample can be desalted for biochemical, biophysical or structural analysis work or storage at -20ВєC 213 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Immunological Method to Detect Buffalo Milk in Cow Milk Archana Verma Dairy Cattle Breeding Division, NDRI, Karnal Introduction Since buffalo milk constitutes a major share of total milk production in our country, sale of watered down buffalo milk in the name of cow milk is commonly practiced. Due to pricing policy in most states, liking for cow milk by a specific group of users and also for manufacturing some quality products from cow milk it has to be made sure that there is no admixing of buffalo milk in the milk /products. If buffalo milk is manipulated in terms of fat percentage and addition of pale yellow coloration, it is very difficult to distinguish the milk with regards to its species of origin by any physicoвЂ“chemical method. The answer to the problem of such manipulations or admixing of milk from different species lies with a test known as the вЂ�Hansa TestвЂ™ named after the mythological bird вЂ�hansвЂ™, which detects the admixing of buffalo milk in cow milk. This is based on the principle of antigen-antibody reaction. The antiserum produced after immunizing rabbit with buffalo casein, gives visible reaction only with buffalo milk. This is the вЂњHansa Test SerumвЂќ specific to buffalo milk. The test may also be applied to some of the milk products after reconstitution. Material required вЂў Rabbits (Adult, healthy and preferably male). вЂў Centrifuge- High speed upto 12000 rpm. вЂў Laboratory (upto 5000 rpm). вЂў Autoclave. вЂў Homogenizer. вЂў General laboratory items and chemicals (centrifuge tubes, beakers, conical flasks, Scalpel blade, xylene, saline, phenol, slides, pipettes, cotton, tooth-picks, adrenaline 1:50000 I.U etc.). вЂў Syringes (2 ml and 5 ml)-needles (21G and 23G). вЂў Source of pure cow and buffalo milk. вЂў Pure cow casein. Procedure The test is carried out in following three steps: Preparation of antigen вЂў Take 50 ml of pure buffalo milk in polypropylene tubes and centrifuge at 3000 rpm for 30 minutes. вЂў Pierce the top layer of fat to pour skimmed milk in a beaker. вЂў Centrifuge the skim milk at 12000 rpm for 30 minutes. вЂў Remove the clear whey and scrap out the packed casein in a clean glass beaker containing distilled water. вЂў Homogenize in a mechanical homogenizer and make the final volume equal to the quantity of skim milk used. вЂў Filter through several layers of muslin cloth and store in a refrigerator under clean sterilized condition and may be used for one week. вЂў Casein, thus prepared, acts as an antigen to produce antibodies against it. 214 Immunological Method to Detect Buffalo Milk in Cow Milk Immunization of rabbits вЂў Select adult and healthy rabbits for immunization. with buffalo casein according to a definite schedule for a specific period of time (Table). вЂў Intra-peritoneal injections are administered taking care that needle(21G) does not pierce the viscera. вЂў Intra-venous injections and blood collection are done through marginal vein of the ear using 23G needle. вЂў The injections should be very slow and always use one year for injections and other one for blood collection. вЂў A period of 3 to 6 weeks of immunization is required to get the antisera of desired titre. Blood collection and testing the titre вЂў After immunizing the rabbits for two consecutive weeks, the blood is collected from each rabbit on the first day of 3rd week, before injection and the serum is separated. вЂў Dilute cow and buffalo milk 1:10 with water. вЂў Place one drop of diluted milk on a clean slide. Add one drop of serum to be tested and mix thoroughly with toothpick. вЂў Observe the agglutination giving swirling movement to the slide (Figure). Those rabbits, whose sera give good titre, further immunization is stopped and blood is collected to the maximum extent to get the antiserum. For other rabbits, injections are continued. In case, any rabbit does not show titre, suspend immunization after 6 weeks. вЂў Sometimes, due to cross- reacting antibodies in cow and buffalo caseins, the titre might be seen in both the species. In such case, cow casein component of the antisera is absorbed using dried cow casein, leaving the test valid only for buffalo milk. Preservation of serum The anti-serum is preserved without getting its efficacy affected by adding 5% solution of phenol @ 3% of the volume of the serum. Precautions вЂў For casein (antigen) preparation, utmost care should be taken to use only pure buffalo milk to get anti-serum specific to buffalo milk adulteration. вЂў Intravenous injections should be administered very slowly to avoid shock to the animal. If the animal shows any sign of shock, 1 ml of adrenaline (1:50000 I.U.) should be given intramuscularly. вЂў Store serum at 4ВєC. вЂў Repeated freezing and thawing of the serum should be avoided. вЂў While testing the titre, use separate pipettes for cow milk, buffalo milk and the serum. вЂў Homogenize milk products thoroughly before testing. Benefits of the technology вЂў Adulteration of buffalo milk in cow milk (or any other milk) can be detected with accuracy. вЂў The test is very fast i.e. less than 30 seconds for one lot of milk. вЂў Only one drop of antiserum is required to test whole lot of milk. вЂў Benefits of pricing policy may be obtained by cow breeders. вЂў Test may be performed with equal efficacy with the formalin preserved milk also. вЂў Good and acceptable quality products may be manufactured using pure cow milk whenever required. 215 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance вЂў Test is equally effective for milk products as well. вЂў The technology is applicable to detect admixing of milk of any species provided the antigen i.e. casein is injected from that species. Table: Immunization Schedule Week of the Immunization *Dose of antigen in a week (ml) **1st Day 2nd Day 3rd Day I 0.5 0.5 1.0 II 1.0 1.0 1.5 III 1.5 1.5 2.0 IV 2.0 2.0 2.5 V 2.5 2.5 3.0 VI 3.0 3.0 3.5 *The three days should be 3 consecutive days of the week and the same schedule should be followed for all the weeks of immunization. **All the injections are intravenous except the 1st day of week II to week VI, which are intra-peritoneal. 216 Figure: observations using hansa test a) Agglutination reaction means Positive Test i.e. the sample is either buffalo milk or admixed with buffalo milk b) Clear solution means Negative Test i.e. no admixing of buffalo milk. Conjugated Linoleic Acid and Its Estimation Conjugated Linoleic Acid and Its Estimation A. K. Tyagi, A. Hossain, A. Tyagi Dairy cattle Nutrition, NDRI, Karnal Introduction Conjugated linoleic acid: CLA refers to mixture of positional and geometric isomers of LA (cis-9, cis-12 octadecadienoic acid) with a conjugated double bond system, instead of the usual methylene-separation. Each double bond can be of cis or trans configuration giving rise to possible CLA isomers (Kelly et al., 1998). Conjugation of double bond occurs as part of free radical mediated oxidation of LA. CLA is a true isomer of LA, in that it does not possess additional oxygen (Vandenberg et al., 1995). The presence of fatty acid with conjugated double bond was first demonstrated in food products derived from ruminants by Booth et al. (1935) who observed that fatty acids obtained from summer butter differed from those obtained from winter butter by exhibiting a much stronger spectrophotometric absorption at 230 mm. It was subsequently concluded that the absorption at this wavelength was due to a conjugated double bond pair (Moore, 1939). Parodi (1977) was the first to identify cis-9, trans-11 octadecadienoic acid as a fatty acid in milk fat that contained the conjugated double bond pair. The discovery of вЂњrole of CLA as a functional foodвЂќ occurs decade ago when ground beef contained anti-carcinogen factor that consisted of a series of conjugated dienoic isomers of LA (Pariza et al., 1979 and Ha et al., 1989). Isomers of CLA: Numerous isomers of CLA have been identified and these differ by position or geometric orientation of the double bond pair (Fig. 2.1). CLA includes more than 28 positional and geometrical isomers of which only cis-9, trans-11 and trans10, cis-12 have thus far been proven to have biological activities (Banny and Martin 1994; Park et al., 2003). Of the two physically important isomers, c-9, t-11 is the most prevalent, comprising 80-90% of the total CLA in food products from ruminants where as t-10, c-12 is present in small amounts at 3-5% of total CLA (Parodi, 2003). The trivial name вЂњRumenic AcidвЂќ (RA) has been proposed for cis-9, trans-11 CLA due to its unique relationship to ruminants (Kramer et al., 1998). Other isomer of CLA are present at low concentration, generally representing less than 0.5 percent of the total CLA in ruminant fat. Sources of CLA: CLA is present in a great variety of feeds, although usually in residual quantities (Chin et al., 1992). Food products from ruminants (Table 1) are the major dietary sources of CLA for humans. The highest CLA concentration was found in adipose tissue (38 mg/g fatty acid) of kangaroo (Engelke et al., 2004). Potential health benefits of CLA: вЂў Anticarcinogenic вЂў Antiatherogenic вЂў Altered nutrient partitioning and lipid metabolism вЂў Antidiabetic (type II diabetes) вЂў Immunity enhancement вЂў Improved bone mineralization 217 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Table 1. Total CLA (mg/g fat) content of different types of selected foods Category of food Total CLA (mg/g fat) Percent of cis-9, trans-11 isomer Category of food Dairy products Total CLA (mg/g fat) Percent of cis-9, trans- 11 Isomer Meat (fresh) Homogenized Milk 5.5 92 Fresh Ground Beef 4.3 85 Butter 4.7 88 Beef Round 2.9 79 Sour Cream 4.6 90 Veal 2.7 84 Plain Yogurt 4.8 84 Lamb 5.6 92 Non-fat Yogurt 1.7 83 Pork 0.6 82 Ice-cream 3.6 86 Poultry (fresh) Cheddar Cheese 3.6 93 Chicken 0.9 84 Cottage Cheese 4.5 83 Vegetable oils Mozzarella 4.9 95 Soybean 0.6 25 Sunflower 0.4 38 Seafood (fresh) Salmon 0.3 вЂ” Mustard 0.3 42 Shrimp 0.6 вЂ” Corn 0.2 39 Source: Chin et al. (1992) Biosynthesis of CLA: Kepler et al. (1966) had identified CLA as the first intermediate of linoleic acid biohydrogenation in the rumen by Butyrivibrio fibrisolvens. Griinari and Bauman (1999) concluded that CLA synthesis occurred in the rumen only. CLA found in milk and meat of ruminants originates from two sources. One source is CLA formed during ruminal biohydrogenation of linoleic acid. The second source is CLA synthesized by animal tissues (mammary gland epithelial tissue) from trans-11 C18:1 or TVA, another intermediate in the biohydrogenation of unsaturated fatty acid. Hence, the uniqueness of CLA in ruminant edible products relates to incomplete biohydrogenation of dietary unsaturated fatty acids in the rumen. Estimation of conjugated linoleic acid in milk a) Extraction of fat Fat is extracted from milk by the method of Ha et al. (1989). Fresh milk (3ml) is vortexed with 3 ml of methanol and 1.5 ml of chloroform. The mixture is vortexed with 1.5 ml chloroform for an additional 2 min. The homogenate is centrifuged at 2200 rpm for 10 min. The upper (methanol-water) layer is removed through aspiration and the bottom layer (chloroform layer) is passed through anhydrous sodium sulphate on Whatman filter paper No.1.The filter paper is rinsed with 3 ml of chloroform and the extract is evaporated to dryness under vacuum and then under the stream of nitrogen. b) Hydrolysis of fat Extracted fat is hydrolyzed with 1 ml of 1N methanolic sodium hydroxide in a boiling water bath for 15 minutes and then cooled to room temperature for 5 minutes. 1 ml Hydrochloric acid (2N) and 2 ml chloroform are added to the tube containing methanolic sodium hydroxide and vortexed for 4 minutes, followed by centrifugation for 10 minutes at 2200 rpm. The organic layer (lower layer) is collected and evaporated to dryness under vacuum and then under the steam of nitrogen. c) Preparation of standard A stock solution of CLA (1mg/ml) in acetonitrile is prepared. A working standard solution is prepared by adding (500ml) stock solution to 2000 ml of acetonitrile and it gives 4mg of CLA in 20ml of standard to be injected. 218 Conjugated Linoleic Acid and Its Estimation d) High performance liquid chromatography (HPLC) HPLC conditions: Column : C18 micro Bondapack Flow rate : 1.5 ml per minute Wave length : 234 nm 20 Вµl. Inject volume : Eluent used for the separation of CLA consists of acetonitrile containing 0.12 per cent glacial acetic acid (v/v) and double distilled water in the ratio of 70:30. The peak of CLA is eluted at 13 to 18 min. The retention time of samples are compared with that of standard CLA (Sigma Chemical Co., St. Louis, MO, USA). CLA estimation by Gas chromatography (GC) Estimation of CLA and other fatty acids in feedstuffs, plasma, ruminal liquor, milk and muscle are analyzed as per direct transestrification method of OвЂ™Fallon et al. (2007) with slight modification using GC fitted with flame ionization detector. For the methyl ester formation 1 g feedstuff, 1.5 ml plasma, rumen liquor, milk and 1.5 g muscle samples are taken. Preparation of standard A stock solution of CLA (1mg/ml) in acetonitrile is prepared. A working standard solution is prepared by adding (500Вµl) stock solution to 2000 Вµl of acetonitrile and it gives 4Вµg of CLA in 20Вµl of standard to be injected. Conditions Oven temperature : Initial 15В°C, Final 24ВєC FID : 26ВєC Injector : 24ВєC Flow rate : 30 ml/min. Attenuation : 1 Split ratio : 1:10 Inject volume : 0.5 Вµl Helium can be used as a carrier gas at constant inlet pressure (205 kPa). Conjugated linoleic acid is identified by comparing its retention time with that of standard CLA and concentration of CLA is calculated considering the peak area. Afterword The evident beneficial potential of CLA along with other PUFAs augmented interest in its enhancement in milk and meat products as a consequence. This has caused a great deal of effort to be expended toward increasing the concentration of CLA in the milk and tissues of ruminant foods because these are the predominant source of CLA in human diets. Among more than a dozen isomers of CLA detected in foods of ruminant origin, c-9, t-11, t-10 and c-12 are the ones with known physiological importance. While c-9, t-11 comprises 80 to 90% of total CLA and the major source of its occurrence is endogenous synthesis via desaturation of VA by О”9-desaturase. , t-10, c-12 comprises 3 to 5% of the total. As has been shown in many studies reported in the limited review above, there are several ways to increase CLA levels in milk and meat products from ruminants, hence, products with enhanced CLA content which can effectively discharge their beneficial role in humans can be 219 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance designed, however, To date, statements about health promoting effects of CLA are mainly based on animal trials and remain to be proven largely in humans. In human trials synthetic CLA supplements are usually used and these do not reflect natural isomer composition in foodstuffs. Whether natural CLA sources (meat and milk from ruminants) have a similar impact on human health warrants further research. Refrences Kelly ML, Kolver E S, Bauman DE, Van Amburgh ME, Muller LD (1998) Effect of intake of pasture on concentrations of conjugated linoleic acid in milk of lactating cows. J Dairy Sci 81:1630вЂ“1636 Booth RG, Kon SK, Dann WJ & Moore T (1935) A study of seasonal variation in butter fat. A seasonal spectroscopic variation in the fatty acid fraction. Biochem J 29, 133-37. P. Parodi, Conjugated Linoleic Acid: an anticarcinogenic fatty acid present in milk. Australian Journal of Dairy Technology 49 (1977), pp. 49-93. Pariza PW, Ashoor SH, Chu FS & Lund DB (1979) Effects of temperature and time on mutagen formation in panfried hamburger. Cancer Lett 7, 63-69. Ha YL, Grimm NK, Pariza MW (1989) Newly recognized anticarcinogenic fatty acids: identification and quantification in natural and processed cheese. J Agric Food Chem 37:75-81 Parodi, P., 2003. Conjugated linoleic acid in food. In J. Sebedio, W.W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2, pp: 101-121. AOCS Press, Champaign, IL. Banny, S and Martin, J.C. 1994. Conjugated Linoleic Acid and metabolites in trans fatty acids in human nutrition, The oily Press, Dundee, Scotland : 261-302. Park, S.J., Park, C.W., Kim, S.J., Kim, J.K., Kim., Y.R. Kim, Y.S and Ha, Y.L. 2003. Divergent cytotoxic effects of Conjugated Linoleic Acid isomers on NCI-N87 cells, ACS Symp. Series, 85:1113-118. Chin, S.F., Liu, W., Storkson, J.M., Ha, Y.I. and Pariza, M.W. 1992. Dietary sources of conjugated dienoic isomers of linoleic acid, a newly recognized class of anticarcinogens. J. Food Composition Analysis, 15: 185-197. Kepler, C.R., Hirons, K.P., McNeil, J.J. and Tove, S.B. 1966. Intermediates and products of the biohydrogenation of linoleic acid by Butyrivibrio fibrisolvens . J. Biol. Chem. 241: 1350вЂ“1354. Griinari, G.M. and Bauman, D.E. 1999. Biosynthesis of conjugated linoleic acid and its composition, incorporation in to meat and milk in ruminants. Advance in CLA research. AOCS Press, Champaign,II. Pp: 180-200. OвЂ™Fallon, J.V., Busboom, J.R., Nelson, M.L. and Gaskins, C.T. 2007. A direct method for fatty acid methyl ester synthesis: Application to wet meat tissues, oils and feedstuffs. J. Anim. Sci. 85: 1511-1521. Vandenberg, J.J., Cook N.E. and Tribble, D.L. 1995. Reinvestigation of the antioxidant properties of Conjugated Linoleic Acid. Lipids, 30: 599-605. Moore, T., 1939. Spectroscopic changes in fatty acids. VI. General. Biochem. J. 33: 1635-1638. Kramer, J.K.G., Parodi, P.W., Jensen, R.G., Mossoba, M.M., Yurawecz, M.P., and Adlof, R.O. 1998. Rumenic acid: A proposed common name for the major conjugated linoleic acid isomer found in natural products. Lipids. 33: 835. Engelke, C.F., Siebert, B.D., Gregg, K., Wright, A.D.G. and Vercoe, P.E. 2004. Kangaroo adipose tissue has higher concentration of cis-9, trans-11 conjugated linoleic acid than lamb adipose tissue. J. Anim. Feed Sci., 13: 689-692. 220 Importance and Estimation of Vitamins A & E In Value Added Dairy Products Importance and Estimation of Vitamins A & E in Value Added Dairy Products Harjit Kaur Dairy Cattle Nutrition Division, NDRI, Karnal Vitamin A, or retinol, is a colorless, alcohol compound. It is essential to the immune system, providing antioxidants that benefit growth, healing, reproduction and skin. If this vitamin is deficient, the epithelium becomes keratinized and cracks occur, giving easy access to bacteria and viruses, resulting in infectious diseases. Vitamin A plays an important role in the chemical processes which occur in the eye and are essential for vision. This vitamin combines with proteins in the retina of the eye and forms the pigment called visual purple. These cells, together with the lens pigment, are responsible for vision in dim light. During this process, some of the vitamin A is excreted and has to be replenished from the blood, if normal vision is to be maintained. Vitamin A affects bone development through its effect on bone metabolism. Essentially, Vitamin A deficiency results in unchecked bone growth that in turn manifests as malformed bones and joints. Vitamin A directly affects immunity through both production of antibodies and through maintaining an adequate barrier to infection with healthy epithelial cells. Its deficiency also affects reproduction by interfering with the production of sperm in males, and by causing resorption of the foetus in females. The symptoms of vitamin A deficiency are scouring, low resistance to bacterial infection, stiffness of joints and uncoordinated movements, lesions around the eyes and dull watery eyes followed by night blindness at more advanced stages. Excess vitamin A has been demonstrated to have toxic effects in most species. VITAMIN E: Vitamin E has very strong antioxidant properties and is involved in the mammalian antioxidant defense system where it stimulates the immune response. For certain purposes, the antioxidant functions of vitamin E can be performed by Se, which is present in glutathione peroxidase and decomposes peroxides. Most species hydrolyze dietary tocopheryl esters effectively at the mucosal surface of the small intestine. Vitamin E is absorbed as the free alcohol, tocopherol. The vitamin is insoluble in the aqueous environment of the intestinal lumen. Its enteric absorption, like that of other fat-soluble nutrients, therefore is dependent upon its micellar solubilization. Consequently, impairment of pancreatic function or bile production results in impaired absorption of vitamin E. The efficiency of absorption of tocopherols is relatively low at 20 to 40 percent. Absorption is increased by mediumchain triglycerides and is decreased by high levels of linoleic acid. In mammals, absorbed tocopherol is transported by chylomicrons via the lymphatic circulation to the liver and subsequently to the general circulation in very low density lipoproteins (VLDL). Most species show normal plasma О±-tocopherol concentrations in the range of 1-5 Ојg/ml. The dietary requirements for vitamin E are estimated in the range of 5 to 50 IU/kg of diet for most animal species. Vitamin E is generally considered to be one of the least toxic of the vitamins. Dietary intakes of at least 20 times the nutritionally adequate levels should be well tolerated by most species. Estimation of vitamins A and E by HPLC Evaluation of vitamin A in dairy products is highly required because of its important roles in vision, maintenance of epithelial lining and immunity in man and animals. Vitamin E (О±-tocopherol), another non enzymatic antioxidant, is involved in maintenance of immunity status Due to the critical role of these vitamins, their quantitative analysis is very important to know their content in the diet as well as to know the changes in their concentration under different storage and processing conditions. High performance liquid chromatography is extensively used for measuring vitamins in milk and milk products. Earlier methods of vitamin estimation such as, colorimetric lack the ability to 221 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance differentiate between the vitamin congeners with varying activity. In milk, vitamin A occurs mainly as a mixture of fatty acid retinyl esters. ОІ-carotene, the provitamin A, is the predominant form of vitamin A in the milk. Evaluation of vitamin A and ОІ-carotene together enables the evaluation of total vitamin A activity of the milk. The major form of vitamin E in the milk is О±-tocopherol. Vitamins A, ОІ-carotene and vitamin E are fat soluble vitamins and are found in the fat fraction of the milk. It is therefore necessary to extract the vitamins from the sample. Saponification (alkaline hydrolysis) provides an effective means of removing the preponderance of neutral lipids (mainly triglycerides) from the sample. Saponification involves refluxing the sample with ethanolic KOH solution and added antioxidant for 30 min. The hydrolysis attacks ester linkages and releases the fatty acids from the glycerol moiety of glycerides and phospholipids and from esterified sterols and carotenoids. Hence ester forms of the vitamins are hydrolysed to their respective alcohols which allow the estimation of total vitamin content in the sample. 1. HPLC method for simultaneous estimation of retinol (Vitamin A), ОІ-carotene and О±-tocopherol (Vitamin E) (Chawla and Kaur, 2001) Principle The sample is saponified with ethanolic potassium hydroxide solution and vitamins A, ОІ-carotene and vitamin E are extracted into petroleum ether. The petroleum ether is removed by evaporation and the residue is dissolved in mobile phase. The vitamins A, ОІ-carotene and vitamin E concentrations are determined simultaneously by reverse-phase liquid chromatography. 1. Reagents : Potassium hydroxide solution, 60%, Ethanol, 95 % , Petroleum ether, boiling range 40Вє C to 60Вє C, 0.5 N potassium hydroxide, All-trans-retinol, vitamin A alcohol, О±-tocopherol, ОІ-carotene, Water, HPLC grade,Methanol, HPLC grade,Acetonitrile, HPLC grade, Tetrahydrofuran, HPLC grade, Ascorbic acid, Whatman phase separator filter paper, Inert gas, nitrogen. Preparation of Standards: Prepare stock solutions of О±-tocopherol (300 Вµg/ml) and retinol (30 Вµg/ ml) in 100 % ethanol. Prepare stock solution of ОІ-carotene (30 Вµg/ml) in chloroform. Take requisite aliquots of individual stock solutions in amber coloured tubes and dry under nitrogen at room temperature. Reconstitute the dried standards in mobile phase (mobile phase is prepared by mixing acetonitrile, tetrahydrofuran and HPLC water in the ratio of 47: 42:11). Prepare a working standard solution containing 100Вµg/ml О±-tocopherol, 10Вµg/ml retinol and 10 Вµg/ml ОІ-carotene, at the time of use. Store all the vitamin stock standards at вЂ“20ВєC. Extraction of samples: Take 2-3 ml milk in a 50 ml stoppered test tube. Add 5 ml of absolute ethanol containing 0.1% (w/v) ascorbic acid or 1% pyrogallol (w/v) and 2ml of 50% KOH. The tubes are agitated carefully and placed in a water bath at 80ВєC for 20 min. After saponification, cool the tubes with running water and place in an ice water bath. Add 10 ml petroleum ether (40-60ВєC) and shake for 15 minutes. Transfer the upper ether layer in another tube. Repeat the extraction thrice and collect the ether portion. Transfer the combined ether extract to a separating funnel, wash with 10 ml of 0.5 N KOH and subsequently with distilled water (2-3 times) to remove excess alkali. Pass the ether extract through phase separator filter paper to remove water, if any. Evaporate the ether extract under nitrogen in a water bath maintained at 37В°C. Perform all the extractions under subdued incandescent light using amber coloured glassware. HPLC system and procedure: The HPLC system consists of a model 510 pump, UV visible absorbance detector 486, rheodyne injector with 20 Вµl loop, using multiwavelength detector. A reverse phase Discovery C-18 (15 cm x 4.6 mm) column is used. The flow rate is 1.5ml/minute. The programme for the separation of retinol, О±-tocopherol and ОІ-carotene using millennium software method is given in Table 1. 222 Importance and Estimation of Vitamins A & E In Value Added Dairy Products Fig. 1 Chrotomatogram of standard Retinol, О±-Tocopherol and ОІ-Carotene Table 1. Program for HPLC analysis of Retinol, О±-Tocopherol and ОІ-Carotene Vitamin Wavelength (nm) Change Time (min) Retention time (min) Retinol 325 0.00 1. 73 О±-tocopherol 290 2.5 3.37 ОІ-carotene 450 4.5 5.67 Reconstitute the residue in the mobile phase prior to injection on HPLC. Filter the reconstituted extract through a 0.45-Вµm filter and inject 20 Вµl into the HPLC column. The run time is 6 minutes per sample. Measure the area of the retinol, О±-tocopherol and ОІ-carotene peaks. Determine their concentrations in the extracted sample with reference to the peak area of respective standards. 2. Simultaneous estimation of vitamins A and E in milk by HPLC Follow the same procedure as mentioned above (for simultaneous estimation of О±-tocopherol, retinol and ОІ-carotene) upto extraction of samples. Prepare mobile phase by mixing methanol and Fig. 2 Chromatogram of standard retinol and О±-tocopherol water in the ratio of 95:5 and filter through a membrane filter. Separation of Vitamins A and E Reconstitute the dried residue in Table 2: Program for HPLC analysis of retinol and О±-tocopherol the mobile phase and filter through 0.45Вµ membrane filter for injection Vitamin Wavelength Change Time Retention time (nm) (min) (min) on HPLC column. Inject 20 Вµl of sample extract onto the column of the Retinol 325 0.00 1.98 liquid chromatograph. A programme 4.00 7.35 О±-tocopherol 290 for the separation of retinol and О±-tocopherol at different wavelengths simultaneously is presented in Table 2. The chromatographic separation of vitamins A and E is shown in Fig. 2. 223 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Calculate the mean peak area from replicate injections of the sample extract and determine the retinol and О±-tocopherol concentrations of the extract by reference to the mean peak area found from replicate injections of standards. Table 3 shows the average values of vitamin A and E in the milk of different species. Table 3. Vitamin A and E content of milk /serving (244 g) Vitamin Cow Milk, 3.25% fat Cow, Skim milk Goat Sheep Buffalo A, ug 68 149 139 108 129 E, mg 0.15 0.02 0.17 ND ND Reference Chawla, Rajiv and Harjit Kaur (2001). Isocratic HPLC method for simultaneous determination of carotene, retinol and tocopherol in feeds and blood plasma. Indian J. Dairy Sci., 54: 84 - 90. 224 Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products Veena Mani Dairy Cattle Nutrition, NDRI, Karnal By atomic absorption spectrophotometer, the metals in water /organic sample can be analyzed. It is the highly sensitive technique highly useful for the determination of the presence and concentrations (even at very low levels) of metals in liquid samples. Thus, prior to the estimation the solid samples should be accurately weighed and then dissolved often using strong acids. Metals include Ca, mg ,Fe, Cu, Al, Pb, Zn, Cd and many more. Typical concentrations range in the low mg/L (ppm) range. As the elements in the sample to be analyzed are not in the free state but are combined with other elements invariably to make a so-called molecule. For the analysis the combination must be cut off by some means to free the atoms. This is called atomization. The most popular method of atomization is dissociation by heat. Samples are heated to a high temperature so that molecules are converted into free atoms. This method is classified into the flame method, in which a chemical flame is used as the heat source; and an electro thermal atomization method, in which a very small electric furnace is used The technique is designed to determine the amount (concentration) of an object element in a sample, utilizing the phenomenon that the atoms in the ground state absorb the light of characteristic wavelength passing through an atomic vapour layer of the element of interest and attain excited states. During excitation element being analyzed is dissociated from its chemical bond and is placed in an unionized state. This is normally achieved by aspirating the sample into the flame or graphite furnace. Each metal has a characteristic wavelength that will be absorbed. . The AAS instrument looks for a particular metal by focusing a beam of UV light at a specific wavelength through a flame and into a detector. The instrument measures the change in intensity As a result of absorption, the intensity of light decreases, which is proportional to the number of the examined atoms being present. The more concentrated the solution, the more light energy is absorbed! In atomic absorption, the method is based on the attenuation (weakening) of a beam of nearly monochromatic light as a consequence of its interaction with and partial absorption by the ground state atoms of the element being analyzed. The amount of light absorbed at the characteristic wavelength increases with the number of atoms of the selected element in the light path. By comparison with suitable standards, the concentration of the element in the sample can be inferred from the amount of light absorbed. A computer data system converts the change in intensity into an absorbance. Quantitative analysis by Atomic absorption depends on: 1)accurate measurement of the intensity of the light ,2) the assumption that the radiation absorbed is proportional to atomic concentration Instrumentation There are six basic components of an atomic absorption spectrometer 1. A light source(hollow cathode lamp), which emits a beam of radiation of a wavelength characteristic of the element to be determined. 2. An "absorption cell" or atomizer section for atomizinig the sample, in which the sample solution is reduced to a cloud of ground state atoms, for example a flame or graphite furnace. 3. A monochromator to select the wavelength that is being absorbed by the element to be measured. 4. A photomultiplier tube ,which is a detector for converting the light into an electrical signal. Thus, it detects and measures the intensity of the resultant beam of radiation. The PMT determines the intensity of photons of the analytical line exiting the monochromator 225 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance 5. An amplifier and associated electronics to amplify and process the signal from the photomultiplier tube. 6. A display and/or a recorder which shows the measured signal after it has been processed. Hollow cathode lamp To produce the proper monochromatic light necessary for the AAS, so calledвЂњhollow cathode lampsвЂќ are used which is situated in the centre of the lamp and is normally composed of either the pure form of the element or an alloy of the element It means that different Schematic Diagram for atomic absorption lamps are used for the determination of each element spectrophotometer (source :http://www. thebritishmuseum.ac.uk/science/techniques/ sr-techaas.html) It is named after the cylindrical shape of the cathode that gives direction to emerging beam, and helps re-deposit sputtered atoms back on cathode. The hollow cathode lamp for the light source consists of a hollow cathode and an anode(made of tungsten) enclosed in a glass (quartz) tube and neon or argon gas is filled at around 10 Torr. in pressure in it. Being made up of the element to be measured or its alloy, it emits the light its wavelength is equal to that absorbed by the atoms of the sample. These lamps are available for about 70 elements. They are generally reliable and most have operating lives well in excess of 5000 mA hours. The life of lamps with cathodes constructed of alloys of volatile elements such as arsenic or selenium is shorter. Multi-element lamps are also available and can be useful both from the point of view of economy in lamp numbers and also in reduced warm-up time. Absorption Cell/Nebulizer It sucks up liquid sample at a controlled rate. Create a fine aerosol spray for introduction into the flame. It mixes the aerosol and fuel and oxidant thoroughly for introduction into the flame The following atomization methods are known: 1) Flame atomization 2) Graphite furnace atomization Flame: The source of atoms is usually flame (вЂњflame atomisationвЂќ). Metals could be measured at ppm concentration (part per million, that is mg kg-1 or mg dm-3 in case of dilute solutions). The most commonly employed technique in atomic absorption spectrometry is that in which the sample, either as a liquid or in solution, is sprayed into a flame as a mist of droplets. The liquid or solution is reduced to mist by being drawn through a pneumatic nebulizer which normally employs an impact bead. Once in the flame, the liquid droplets are dried to give solid particles which are then decomposed to give molecules in the gaseous phase. The molecules then dissociate to give free atoms. Only about 10% of the solution actually reaches the flame. This is one reason for the limited sensitivity of flame techniques. The other important reason for the limited sensitivity is the rather short residence time of free atoms in the flame (and especially in the light path).The sensitivity, however, could be increased when the light travels for longer in the flame. Therefore most of the burners are about 5-10 cm long. The air/acetylene flame is the most used type of flame which provides a temperature high enough for the determination of many elements. There is no considerable ionization in the flame (with the exception of the alkali elements) and almost no absorption at wavelengths above 230 nm. Furthermore light emission by this flame is rather low. The nitrous oxide/acetylene flame with its high temperature is recommended for the determination of elements which need a high energy for dissociation (that is, formation of free atoms). For those elements, this flame provides suitable chemical, thermal and optical conditions. Background emission, however, is rather high at certain wavelengths and the high temperature leads to a considerable risk of ionization for certain elements. The air/propane or air/ hydrogen flames are mainly recommended for the analysis of alkali elements since the temperature is low enough to prevent larger ionization effects. The hydrogen/argon-diffusion flame is especially suitable for the determination of arsenic and selenium, since its absorption at wavelengths below 200 nm is much smaller than absorption of other flame types. Due to its low temperature, chemical 226 Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products interferences must be expected. Fuel gas Oxidant Flame temp. (ВєC) Graphite furnace atomisation The graphite Fuel Gas Oxidant Flame Temp. (ВєC) furnace AAS (GFAAS), a more recent technique is Hydrogen Argon/ air(diffusion) 400 (350-1000) even more sensitive than the traditional, cheaper Propane Air 1930 AAS using flame. Measurements could be done at Hydrogen Air 2000-2050 ppb level (part per billion, ppb = 10-3 ppm, that Acetylene Air 2100-2400 is Вµg kg-1 or Вµg dm-3 in case of dilute solutions!). Nitrous oxide 2650-2800 Since the presence of toxic heavy metal i.e as Acetylene contaminants even in very low concentration may be of concern from human health point of view, therefore the technique has the importance with this reference. In graphite furnace AAS, a heatable graphite tube as atomization device is located in the ray path. A droplet of the sample is pipetted into the graphite tube, where it dries through electrical heating and the residues are ashed. The temperature of the tube can be increased in a stepwise fashion such that in the first stage, the tube will be heated to a relatively low temperature in order to vaporize the solvent. In the second stage, the temperature will be increased by increasing the current such that the solid residue is dry ashed without the loss of analyte. Finally, the tube is rapidly heated to a temperature of up to 3000В°C in order to atomize the analyte. The heated graphite furnace provides the thermal energy to break chemical bonds within the sample held in a graphite tube, and produce free ground state atoms. Ground-state atoms then are capable of absorbing energy, in the form of light, and are elevated to an excited state. The amount of light energy absorbed increases as the concentration of the selected element increases.The atomic absorption signal is then measured at this stage. A purge gas of argon or nitrogen is passed through the tube during the drying and ashing stages but normally the flow of inert gas will be stopped during the atomization stage so that the free atoms will remain in the absorption cell for a longer period. It is important to control the drying and ashing stages such that drying comes about without spitting or spreading of the sample and that ashing occurs in such a way as not to interfere with the final atomization stage. The use of automatic background correction is essential when using a graphite furnace, since the level of non-specific background absorption is much more significant than is the case with the flame atomization. Matrix effects can be compensated for by the method of standard additions and/or by the addition of matrix or analyte modifiers. The addition of analyte modifiers usually decreases the volatility of the analyte so that it is not lost during the ashing stage or increases the volatility of the matrix making it more readily removable Matrix modifiers, on the other hand, decrease the volatility of interfering compounds and contribute to time resolved analyte/background signals. Monochromator: the main purpose of monochromator is to isolate the absorption lines from the background light due to the interferences. Comparison of Flame and Electrothermal atomization method Thus, monochrometer Flame Atomization Electrothermal Atomization is used for selecting the ppm level in the solution ppb level in the solution analysis wavelength of Sensitivity about 1mL for one analysis 5 - 50 ВµL for one analysis the target element, and Sample Volume a detector for converting Atomizing efficiency about 10% More than 90% the light into an electrical Matrix effect Small large signal. Thus,it Isolate the 10 - 30 sec. For one sample 2 - 5 min. for one sample analytical line photons Time for analysis passing through the flame and remove scattered light of other wavelengths from the flame In doing this, only a narrow spectral line impinges on the PMT. 227 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Photomultiplier tube (PMT) This is the detector. The PMT determines the intensity of photons of the analytical line exiting the monochromator. The PMT is the most commonly used detector for atomic absorption spectroscopy. They consists of a photocathode and a series of dynodes in an evacuated glass enclosures. However, solid state detectors are now replacing conventional vacuum-type photomultipliers. High tech electronics amplify, filter, and process the electrical signal, using a series of chips and microprocessors, transmitting the result to an internal or external computer which handle all data-handling and display Analysis of minerals in milk and milk products using Atomic absorption spectrophotometer They can be divided into macro minerals (major elements) and micro minerals (trace elements). The macro minerals such as sodium, potassium, magnesium, calcium and phosphorus are required by the body in amounts greater than 100mg per day whereas the micro minerals such as iron, copper, zinc and manganese are required in amounts less than 100mg per day. Sampling and processing of samples The processing of milk/ products samples for mineral analysis can be done dry ashing or wet digestion, since milk is not totally homogenous therefore, it is utmost important that bulk sample should be sufficiently homogenized to ensure that the aliquot/sub-sample which is taken for analysis is representative of the whole. The size of the sample should be proportional to the bulk. Thorough mixing of sub-samples from a large bulk is preferred in representative sampling (a) Dry Ashing Generally, 5 to 25 ml sample (depending upon the concentration of the desired mineral) is taken in a silica crucible and weighed. For powdered milk/product, 1-2 gm sample is taken. Then, the sample is placed in the muffle furnace and the temperature is brought to 550ВєC and held for 4 hr. After cooling, the ash obtained is dissolved in dilute HCl (6M) and then made upto suitable volume. The resulting solution is used in mineral element determination. Advantages and Disadvantages: Dry ashing is a convenient and versatile method using relatively large sample size for the sample preparation. It also minimizes the contamination due to reagents. Because ,the ashing is usually done between 400-600ВєC, therefore, some elements such as Se, Pb, As and Hg, are lost through volatilization or by adsorption on the walls of the crucible. Other metals such as, tin may form un-soluble refractory compounds during ashing (b) Wet digestion: Wet digestion procedure requires the use of strong oxidizing acid mixture of nitric, sulphuric and perchloric acid. A mixture of HNO3 and HClO3 is useful for many routine applications. The use of mixtures containing H2SO4 is particularly useful when sample containing fats are to be oxidized. The addition of H2SO4 increases speed of wet oxidation process as it raises the temperature of digestion. Extra care should be taken to avoid charring of samples when elements like As, Se or Hg are to be determined. It is essential that HNO3 should be in excess at all time during digestion. Even H2SO4 and HNO3 mixture can be used, but complete digestion of fat may take hours. Generally, milk (10-20ml) or 1-2 g milk product is taken in 60 ml test tubes/ kjeldahl flask and weighed. To this, 10 ml triacid mixture (HNO3: HClO4: H2SO4:: 3 : 2 : 1) is added. Tubes are heated till the contents become clear and perchloric acid fumes cease to come out. The volume is made to 25 ml with double distilled water. Advantages/ Disadvantages: When compared with dry ashing, this method gives better recovery for most of the elements as there is less danger of loss of volatile elements (Pb, Cd, As). But the chances of contamination are high as relatively large volumes of reagents are required to be added. The other drawback with this method is that it is suitable only for small size samples. Analysis HCl extract or wet digested samples after suitable dilution are used for the estimation of major and trace elements by atomic absorption spectrophotometer. 228 Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products вЂў Take 1 ml of digested sample / HCl extract in a clean test tube. вЂў For Ca estimation, add 1 ml 2% SnCl2 to 1ml of digested sample to eliminate interfering elements (such as Al, Be, P, Si, Ti) and make the volume to 10 ml with doubled distilled water. The concentration of 0.2% Sn is required in the test sample as well as in standards. This sample is ready for estimation on AAS at 422.7 nm wavelength using acetylene as fuel and air as an oxidant. вЂў For Mg estimation, add 1 ml 2% SnCl2 to 1ml of digested sample to eliminate interfering elements (such as Al, Be, P, Si, Table 1 Conditions for various minerals Ti) and make the volume to 10 ml with doubled distilled water. Mineral Wavelength Lower range Upper range (nm) (ppm) (ppm) The concentration of 0.1% Sn is required in the test sample as Calcium 422.7 1.8 18 well as in standards. This sample Magnesium 285.2 0.06 0.6 is ready for estimation on AAS 589 0.26 2.6 at 285.2 nm wavelength using Sodium acetylene as fuel and air as an Potassium 766.5 0.24 2.4 oxidant. Iron 248.3 0.5 8 вЂў вЂў For other mineral the estimations Copper 324.7 are carried out in the and suitably 213.9 diluted digested sample. The Zinc conditions for the estimation Manganese 279.6 and range for preparation of standards of different minerals are given in Table 1. 0.08 8 0.5 5 0.58 5.8 Plot the standard curve for a particular mineral and find out the concentration in the unknown sample from the standard curve considering dilution factor. Express the concentration as percent in case of Ca and Mg and ppm for other minerals. The samples and standards are often prepared with duplicate acid concentrations to replicate the analyte's chemical matrix as closely as possible. Acid contents of 1% to 10% are common. High acid concentrations help keep all dissolved ions in solution. Preparation of standards for some trace minerals of nutritional significance Zinc standard stock solution, 1 mg/ml - Take 0.25 g pure zinc metal in 250 ml volumetric flask add about 50 ml distilled water and then add 1 ml sulphuric acid. Heat to dissolve Zn. Dilute to volume and store in pyrex bottle. Or dissolve 4.3984 g ZnSO4.7H20 in 0.1N HCl and dilute to 1 liter. This solution will give 1000 ppm concentration. Make working stock solution of 100 ppm and then prepare working standards. Cu Standard stock solution,1 mg/ml - Dissolve 1.9645 g CuSO4.5H2O in distilled H2O and dilute to 500 ml. One ml of the solution contains 1 mg Cu. Make further dilutions with double glass distilled water. Fe Standard stock solution, 100 Вµg/ml - Dissolve 0.7022 g (FeSO4 (NH3)2 SO4.6H2O in 100 ml water. Add 5 ml concentrated H2SO4, warm it slightly and add potassium permanganate solution (0.1 N) until solution shows slight pink colour. Make volume to 1 liter. It will give 100 Вµg/ml solution of Fe. Make serial dilutions to get standards in the range Mn Standard solution ,100 Вµg/ml - Dissolve 0.5756 g dry KMnO4 in 50 ml water. Add 40 ml conc. H2SO4 and reduce the permanganate by careful addition of sodium metabisulphite solution until Mn solution is colorless. Oxidise excess of H2SO4 in hot solution by addition of little HNO3. Cool, and transfer the contents to 2 liter volumetric flask. Make volume upto the mark. This solution contains 0.1 mg of Mn/ ml. Solution must be protected from light. Make further dilutions. Standard calcium solution вЂ“ Dissolve 100.1 mg of dry calcium carbonate in 30 ml of 0.1 N HCl and dilute to 200 ml with water. This solution contains 20 mg of calcium per 100 ml. Further dilutions are made to get required working standards 229 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Pesticides: Their Analysis in Milk Using High Performance Liquid Chromatography Chander Datt and Monica Puniya Dairy Cattle Nutrition Division, NDRI, Karnal Pesticides are defined as the substances intended to repel, kill or control any species designated as pest including weeds, insects, rodents, fungi, bacteria or other organisms. The family of pesticides includes herbicides, insecticides, rodenticide, bacteriocide, nematocide etc. Pesticides that may contaminate feeds originate from most of the major groups including organochlorine, organophosphate and carbamates. Although the residues of pesticides are potentially toxic to farm livestock, the primary focus of concern is centered on residues in animal products destined for human consumption. Organochlorine pesticides residues (OCP) are lipophilic in nature and relatively stable. Most of the OCPRвЂ™s and their metabolites are readily excreted in milk. Unlike organochlorines, organophophate pesticide (OPP) compounds are readily decomposed by physico-chemical and enzymatic processes in plant and animal systems, therefore, these are less persistent but could lead to acute toxicity if consumed beyond toxic levels. Normally, the milk and milk products get contaminated with OPPR if the animals are given a feed which is treated with pesticides during storage or the feed is manufactured from the plant material treated during its cultivation. The other sources of contamination of feeds, milk and milk products can be- direct treatment of animals against parasites, control of flies/insects in the milk processing area and use of contaminated water for drinking of animals and for processing of milk. The carry over rate of these pesticides from feed to milk varies from 20 to 80% depending upon the nature and stability of the pesticide, method of its application, duration of exposure and metabolism within the animal The OCPRвЂ™s damage the peripheral nerves, cause blindness and sometimes show tumerogenic effects. In addition, an induction of liver enzymes, hydrolases and mixed function oxidases also occurs. A negative influence on the reproductive functions is also observed. The toxicity of these compounds leads to cardiac and respiratory impairment due to disorders of autonomous nervous system. Some of the OPPR,s induce myopathy in exposed human beings and animals, which is characterized by muscle cell degeneration and respiratory muscles are affected. Human erythrocyte cholinesterase activity is inhibited and pathological alterations are observed in several tissues. Acute poisoning leads to respiratory distress, nervousness, convulsions, paralysis and death. During the past few years, there has been a drastic reduction in the level of residues of organochloro pesticides in feeds as well as in milk. For the protection of consumers, Codex Committee on Pesticide Residues of Codex Alimentarius Commission of FAO/WHO takes care to establish the MRL for different pesticides for animal feeds and foods of animal origin. In India, there is an urgent need to monitor the level of pesticide residues in milk with special reference to organophosphates. Though methods for multiresidue analysis of pesticide residues have been developed but these have not been tried for simultaneous analysis of most commonly used OPP and OCP compounds in India. Therefore, a technique (Singh and Chhabra, 2004) has been evolved in DCN Division for simultaneous determination of commonly used OCP and OPP compounds. Methodology Requirements 1. Pesticide standards (Sigma-Aldrich): Eighteen OPP including acephate (ACP), chlorpyrifos (CPP), chlorpyrifos-methyl (CPP-me), diazinon (DZN), dichlorvos (DCV), dicrotophos (DCP), dimethoate (DMT), fenitrothion (FTN), malaoxon (MOX), malathion (MTN), monocrotophos (MCP), paraoxon-ethyl (POX), parathion-methyl (PTN), phorate (PRT), phosphamidon (PMD), 230 Pesticides: Their Analysis in Milk Using High Performance Liquid Chromatography profenophos (PFP), quinalphos (QNP), tetrachlorvinphos (TCV) and 10 OCP namely aldrin (ADR), dieldrin (DER), endosulfan (ESF), endrin (EDR), heptachlor (HCR), lindane (LDN), 2,4 DDE, 2,4 DDT, 4,4 DDD and 4,4 DDT. 2. HPLC system: Waters HPLC with binary gradient solvent delivery module, injector, C18 ВµBondaPak column (300 mm x 10 mm i.d.; particle size: 10 Вµ) with heater to provide column temperature of 39ВєC, UV-VIS absorbance detector, Millennium 32 chromatography software. 3. Acetonitrile, toluene, methanol, water (all HPLC grade) and sodium sulphate (anhyd.) 4. Solvent filtration apparatus with membrane filters (47 mm dia.) viz., aqueous HVLP 04700 and organic FHLP 04700 (Millipore India Pvt. Ltd., Bangaluru), Whatman filter paper No. 41, Solid phase extraction (SPE) cartridge 5. Other equipments: Analytical balance, mixture/blender, vortex mixture, solvent evaporatory apparatus, vacuum manifold and vacuum pump HPLC conditions for analysis Gradient programme A gradient programme has been developed for separation of various pesticides at 200 nm detection wavelength with column temperature of 39ВєC. All the pesticides are separated within a run time of 60 min., however, for proper cleaning the total duration is increased to 86 min, The subsequent sample can be injected at or after 90 min. of run. Acephate is the first pesticide to be eluted while aldrin is the last one. Limit of detection (LOD) LOD is the minimum concentration of each pesticide that produces a response which is equal to twice the short term noise at 200 nm. For each pesticide, it was worked out from the average response/ area of 4 injections of standard pesticide mixture. The LOD was calculated by keeping a min. area of 1000 units for each pesticide. Linearity Linearity for each pesticide is determined by injecting upto 5 times different concentrations of mixed standard pesticide solution. From the area units and concentration for each pesticide, the correlation coefficients are calculated. The correlation coefficient for most of the residues was about 0.99. Repeatability For validation, area units for individual pesticides, 5 samples of standard mixture run during the entire analysis period are randomly selected for the determination of coefficient of variation (CV). The CV values for different OPP and OCP ranges from 0.86 to 8.13 and 1.24 to 19.2%, respectively. Extraction, drying and clean up procedures for sample preparation for injection in HPLC Extraction: Milk sample (25 ml) is mixed with 100 ml of acetonitrile at high speed for 5 min. It is then mixed with 10g and 20g anhydrous sodium sulphate each time for 2 min. in 2 steps. The sample is kept undisturbed for 2 min. Supernatant is filtered through Whatman No. 41 and kept overnight in a dark place. For determination of per cent recoveries, 1 to 5 ppm of individual pesticides are added to 25 ml milk sample and after mixing, it is kept overnight in dark before carrying out the extraction with solvent as explained above. Drying: A 50 ml portion of the extract is taken in 500 ml solvent evaporatory apparatus and dried under a stream of N2 gas and vacuum in 500 ml capacity beaker containing water at 45-50ВєC. Then 5 ml of acetonitrile was added to flask and contents were mixed using a vortex mixture. Acetonitrile is evaporated to dryness. 231 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Clean up using SPE cartridge: Fresh SPE cartridges were conditioned over vacuum manifold assembly using 3 ml methanol thrice followed by acetonitrile (3 ml thrice). When acetonitrile phase was just near to the level of sorbent, the individual valves of the vacuum manifold assembly were closed. The dried sample extract was dissolved in 1.0 ml acetonitrile and transferred to preconditioned cartridge. Subsequent rinsing twice with 0.5 ml acetonitrile was also transferred to SPE cartridge. Then a flask was kept below SPE cartridge in vacuum manifold assembly. The contents were collected in the flask after addition of methanol twice. The sample is then evaporated to dryness and the residue is dissolved in 1.0 ml acetonitrile. After filtering it through membrane filter, it is injected in HPLC system or stored in a refrigerator until used. Likewise, pesticide standards are run in order to know the concentration of each pesticide in unknown samples. 232 Estimation of Microbial GOS by High Performance Liquid Chromatography Estimation of Microbial GOS by High Performance Liquid Chromatography Vikas Sangwan and Sudhir Kumar Tomar Dairy Microbiology Division, NDRI, Karnal Introduction Galacto-oligosaccharides belong to the group of non-digestible oligosaccharides (NDO), which can be regarded as soluble dietary fibres because they are completely soluble and are fermented by specific bacteria present in the colon, resulting in the production of short-chain fatty acids (propionate, acetate and butyrate). Their chemical formula is (Galactose)n - Glucose, with n ranging from 1 to 4. The galactose-galactose linkage is a ОІ-(1-3), ОІ-(1-4), ОІ-(1-6) linkage, with the ОІ-(1-4) being predominant: the galactose-glucose linkage is mainly ОІ-(1-4). Some disaccharides are also present in GOS (e.g. allolactose and galactobiose). GOS have a high solubility and a relative sweetness about 35 % that of sucrose. They are more viscous than high-fructose corn syrups, decrease the water activity and freezing point, and show good moisture retention capacities. They also have remarkable stability at high temperatures and variable pH levels. In particular, the stability of GOS in acidic and high-temperature conditions enables them to be applied without decomposition in a wider variety of foods. GOS remain unchanged after treatment at 160ВєC for 10 min at pH-2, where about a half or more of the sucrose is degraded. Even in acidic conditions at room temperature, GOS tend to be stable during long-term storage. Galacto-oligosaccharides (GOS) are carbohydrate-based food ingredients that can enhance health- related physiological activities, which can provide protection from infection; decrease the number of potentially pathogenic bacteria; facilitate the normal functions of the gut; stimulate the absorption of some minerals and decrease blood lipids content (Dias and others 2009). Production of GOS GOS molecules (for example, Gal (ОІ1в†’4) Gal (ОІ1в†’4) Glc) are typically synthesised by the enzymatic activity of ОІ-galactosidase on lactose in a reaction known as transgalactosylation (Gosling and others 2010). ОІ-D-Galactosidases (ОІ-D-galactoside galactohydrolase, EC 3.2.1.23), which are also referred to as lactases, hydrolyze the ОІ(1в†’4) linkage of lactose (galactosyl ОІ(1в†’4) glucose) to glucose and galactose and transfer the galactose formed from lactose cleavage onto the galactose moiety of another lactose to yield galacto-oligosaccharides (Park and others, 2009). The use of lactic acid bacteria (LAB) as producers of ОІ galactosidase enzymes offers substantial potential for the production of GOS. First, LAB are known to be good producers of extracellular ОІ-galactosidases that enable GOS production from lactose. Second, LAB have a safe tradition in food Fig. 1. Production of GOS Fig 2. Schematic diagram of HPLC fermentations and exhibit rapid anaerobic growth on agricultural substrates including waste products such as whey. Therefore, GOS may be produced from crude cellular extracts without costly downstream processing. Moreover, GOS may be produced in situ during food fermentations or by using whey to produce food-grade GOS preparations. 233 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Detection of GOS by High Performance Liquid Chromatography (HPLC) High performance liquid chromatography is basically a highly improved form of column chromatography. Instead of a solvent being allowed to drip through a column under gravity, it is forced through under high pressure that makes it much faster. Flow Scheme for HPLC Liquid chromatography involves a sample being dissolved in a mobile phase (liquid, acetonitrile: w1ter, 80:20, in case of GOS). The mobile phase is then forced through an immobile, immiscible stationary phase. The stationary phases are chosen such that components of the sample have different solubility in each phase. A component, which is quite soluble in the stationary phase, will take longer to travel through it than a component, which is not very soluble in the stationary phase but very soluble in the mobile phase. As a result of these differences in mobility, sample components will become separated from each other as they travel through the stationary phase. Figure 3 represents a chromatogram Fig. 3. HPLC chromatogram of GOS sample: Glc: glucose, Gal: galactose, Lac: lactose, a(1вЂ“6) for GOS obtained in HPLC. galactobiose, DP: degree of polymerisation. Detection limits of substances using HPLC in general are largely dependent on the compound being analyzed as well as the sensitivity of detector used. Whereas the RI detector is not the most sensitive, for example being 100 to 1000 less sensitive than UV detectors, its suitability with detection range of micrograms per milliliter (Ојg/mL) is convenient enough for GOS detection and analysis (Otieno, 2010) Materials of chromatographic separation Different types of materials can be used as a solid phase for chromatographic separation. The stationary phase is the key element in a chromatography system. Separation is enhanced by using stationary phases that present the shortest possible diffusion pathways to the solutes, have low resistance to mass transfer, reasonably narrow particle size distribution, and are uniformly packed in the column. The most frequent materials used in sugar separation are: a) Active carbon In sugar industry, the most used adsorbent is active carbon, because is the cheapest and does not require a difficult pretreatment. Use of active carbon for the separation of GOS has shown that the carbon has higher affinity for oligosaccharides and low affinity for monosaccharides (glucose and galactose). b) Ion exchange materials Cation exchange resins have been used HPLC program for GOS detection extensively in the sugar industry for different Acetonitrile: Water (80:20) types of separation. The use of cation-exchange Mobile phase Amino (NH2) column resins together with water as the mobile phase Column resulted in a better separation of saccharides Detector Refractive Index Detector than when anion exchangers were used. Use Run time 20 min of a method for the separation of sugars on the Flow rate 0.4 ml/min cation-exchange resin Dowex 50W-X4 (K+), Column temperature 800C using water as the eluent separate various sugars including oligosaccharides, hexoses, pentoses, acetals, methyl-О±-D-glycosides and other sugar derivatives, with recoveries of greater than 95%. Fractionation The separation of carbohydrates plays an important role in food production and in cosmetic and pharmaceutical industries. Also, 90% of the cost in food production is related with separation processes. 234 Estimation of Microbial GOS by High Performance Liquid Chromatography Liquid chromatography offers high selectivity, efficiency and loading capacity of the stationary phase and speed of process. Purification of GOS is important because by removing monosaccharide and lactose from GOS, there is a decrease in sweetness and calorie value. Different techniques are being used for the fractionation of oligosaccharides including вЂў Diafiltration вЂў Yeast treatment, вЂў Activated charcoal treatment вЂў Size exclusion chromatography (SEC) (Hernandez and others 2009). Other methods of detection Quemener and others (1997) developed a method based on high performance anion-exchange chromatography with pulsed amperometric detection (HPAE-PAD) to measure GOS in food and feed products. A few years later, de Slegte (2002) organized collaborative study of this method in which galactose and other sugars were separated on a CarboPacTM PA1 column and detected by pulsed amperometric detection (PAD) using a triple potential waveform. Thin layer chromatography (TLC) and spectrophotometric (UV spectra) methods are also used for GOS detection. TLC is only qualitative and less sensitive as compared to HPLC. The UV method together with chemometric models of calibration is an acceptable analytical method for a fast, simple and inexpensive monitoring of total GOS production in a predefined fermentation process, allowing to promptly verifying if the fermentation is running as expected, or if some correction action is needed, which is crucial when an industrial GOS production is envisaged, being a possible alternative to the standard analytical methods usually used (Dias and others 2009). Conclusion Liquid chromatography has been largely used depending on the matrix from which GOS is to be extracted and analyzed. However, HPAE-PAD has been found to be more superior in the detection of GOSs than high-performance liquid chromatography with RI detection. Nevertjeless, in the event that HPAE-PAD is not available for use, HPLC-RI can be reliably used instead. Concerning the chemometric methods analyzed, in general, the ANN multiple is robust and present the best global prediction performance. However, further studies are needed in order to obtain better results with these chemometric models. Although the RI detector has several limitations, namely the dependence of sensitivity on changes in solvent composition, temperature, and pressure, it however remains the most useful tool so far in the determination of sugar concentrations in foods. References de Slegte J. 2002. Determination of trans-galactooligosaccharides in selected food products by ion-exchange chromatography. J AOAC Int 85:417вЂ“23. Dias LG, Veloso ACA, Correia DM, Rocha O, Torres D, Rocha I, Rodrigues LR, Peres AM. 2009. UV spectrophotometry method for the monitoring of galacto-oligosaccharides production. Food Chemistry 113:246вЂ“252. Gosling A, Stevens GW, Barber AR, Kentish SE, Gras SL. 2010. Recent advances refining galactooligosaccharide production from lactose. Food Chemistry 121:307вЂ“318. Hernandez O, Matute AIR, Olano A, Moreno FJ, Sanz ML. 2009. Comparison of fractionation techniques to obtain prebiotic galactooligosaccharides. International Dairy Journal 19:531вЂ“536. Morales V, Sanz ML, Olano A, Corzo N. 2006. Rapid separation on activated charcoal of high oligosaccharides in honey. Chromatographia 64:233вЂ“238. Otieno DO. 2010. Synthesis of ОІ-Galactooligosaccharides from Lactose Using Microbial ОІ-Galactosidases. Comprehensive Reviews in Food Science and Food Safety 9:471-482. Park AR, Oh DK. 2009. Galacto-oligosaccharide production using microbial ОІ-galactosidase: current state and perspectives. Appl Microbiol Biotechnol. 235 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Estimation of Trehalose Production by Propionibacteria Poonam and Sudhir Kumar Tomar Dairy Microbiology Division, NDRI, Karnal Introduction Trehalose also known as mycose, is a non reducing disaccharide in which two glucose molecules are linked together in a 1,1-glycosidic linkage. Although there are three possible anomers of trehalose, that is, О±,ОІ-1,1, ОІ,ОІ-1,1, and О±,О±-1,1, only the О±,О± -trehalose (Figure 1) has been isolated from and biosynthesized in living organisms. This naturally occurring disaccharide is widespread throughout the biological world with the first tentative report being in ergot of rye. Trehalose is found naturally in insects, plants, fungi, and bacteria, the major natural dietary source is mushrooms. It is implicated in anhydrobiosisвЂ”the ability of plants and animals to withstand prolonged periods of desiccation. It has high water retention capabilities and is used in food and cosmetics. The sugar forms a gel phase Fig. 1. Structure of naturally occurring isomer of as cells dehydrate, which prevents disruption of trehalose, О±,О±-1,1 trehalose internal cell organelles by effectively splinting them in position. Rehydration then allows normal cellular activity to be resumed without the major, lethal damage that would normally follow a dehydration/ rehydration cycle. Trehalose has the added advantage of being an antioxidant. Trehalose is a naturally occurring reducer of cell stress, protecting these organisms from extremes in heat shock and osmotic stress (Crowe, 2002). It acts by altering or replacing the water shell that surrounds lipid and protein macromolecules. It is thought that its flexible glycosidic bond allows trehalose to conform to the irregular polar groups of macromolecules. In doing so, it is able to maintain the 3-dimensional structure of these biologic molecules under stress, preserving biologic functions. Furthermore, trehalose is very promising as a sugar substitute in food: it is repeated as being anti-cariogenic and can be considered as a dietetic sugar since it is only partially digested in the human intestine (Neta et al., 2000). These properties place trehalose in the category of compounds known as nutraceuticals, defined as foods and food components with benefits for human and animal health (Hugenholtz et al., 2002). Trehalose production by propionibacteria Dairy Propionibacteria are important starter organisms involved in typical flavor and eyes formation in Swiss-type of cheeses and in the production of other dairy products. Besides their technological role, these bacteria can also be used as cell factory for the production of a variety of biomolecules like vitamin B12, folate, riboflavin and propionic acid. They also have been recognized as potential probiotics in recent years. In cheese manufacturing and during other applications, Propionibacteria are subjected to different kind of stress conditions and a part of this defense system involves the intracellular accumulation of trehalose. Pathways for trehalose biosynthesis At least four pathways for the synthesis of trehalose in biological system have been reported thus far: (i) the OtsAвЂ“OtsB pathway, the most common route, involves the transfer of glucose from UDPglucose to glucose 6-phosphate to yield trehalose 6- phosphate, which is subsequently converted to trehalose (ii) the TreS pathway, Trehalose synthase (TS) catalyses an intramolecular arrangement of maltose, in order to convert the glycosidic bond О±-(1-4) of this disaccharide to the О± -(1-1) trehalose bond (iii) the TreYвЂ“TreZ pathway, a two-step reaction involving maltooligosyl-trehalose synthase (TreY) catalyzing the conversion of maltodextrines to maltooligosyl-trehalose and subsequently the maltooligosyl-trehalose trehalohydrolase (TreZ) breaks this intermediate to generate trehalose and 236 Estimation of Trehalose Production by Propionibacteria (iv) a single-step pathway involving trehalose glycosyltransferring synthase, that catalyses the reversible conversion of glucose and NDP-glucose into trehalose. Pathways leading to trehalose accumulation in Propionibacteria freudenreichii have been studied (Cardoso et al., 2007). P. freudenreichii uses the OtsAвЂ“OtsB pathway for trehalose synthesis, whereas trehalose catabolism proceeds via TreS. Maltose derived from TreS activity can be processed by amylomaltase, releasing glucose which is further catabolized via glycolysis (Figure 2). Given the beneficial properties of trehalose, there is a need to estimate the level of trehalose accumulated by different Propionibacteria strains so that high trehalose accumulating strains can be selected which will act as robust cheese starter and can be Fig.2. Proposed scheme of trehalose metabolism in P. freudenreichii. used for enhanced trehalose production at industrial level. 1, Glucokinase; 2, trehalose-6- Estimation of trehalose production phosphate synthase; 3, trehalose-6phosphate phosphatase; 4, trehalose synthase; 5, amylomaltose; PolyP, polyphosphate; G, glucose. Different types of methods are available for estimation of trehalose production by Propionibacterium strains. All these methods include growth of culture in YELA medium, extraction of intracellular trehalose from the cells and then estimating the level of trehalose. Growth conditions For investigating trehalose biosynthesis, culturing of the cells is required in Erlenmeyer flasks (500mL). At the beginning of the experiment, a 3% inoculums (v/v) is introduced in 200 mL of YELA (Yeast extact lactae agar) medium and strieedd at 50 rpm in a water bath at 30 ВєC. To establish anaerobic conditions, the medium is aseptically gassed with argon during the 15-min preceding inoculation. A culture grown until exponential phase is used as inoculum to obtain an initial optical density of about 0.06. Trehalose extraction from the cell Trehalose extraction using ethanol extraction: Cells are centrifuged (13800 g, 10 min) and washed in an isotonic solution. The cell pellets are transferred into a glass tube with 80 % ethanol and stirred by vortex for 30 min at ambient temperature. They are evaporated to dryness by means of a rotary evaporator. The residues obtained are then dissolved in the 1.5 ml of acetonitrile : water (70:30) and directly taken up for HPLC analysis. (Ferreira et al., 1996). Trehalose extraction using TCA: The cell pellet obtained is mixed with 3 volumes of TCA 0.5 M for 1hr at room temperature. Then the suspension is centrifuged at 20000 g for 10 min. The supernatant is neutralized before trehalose conc. Measurement (Cola et al., 2010). Trehalose extraction using hot water: The cell pellet obtained is washed with 1 ml of water. Cells are resuspended in 0.2 ml of water and transferred to a boiling water bath, followed by incubation for 10 min to extract intracellular compounds. After centrifugation of the boiled sample, the supernatant is obtained and used for measuring the trehalose content (Mahmud et al., 2010). Trehalose extraction using Bead mill: The test tubes are directly taken up from the freezer and immersed in boiling water for 10 min. followed by cooling on ice. Glass beads are added to tubes and cells are disintegrated in the bead mill for 30 min. Cell debris are removed by centrifugation and supernatant is taken for further analysis (Schulze et al., 1995). Estimation of trehalose from the cell extract HPLC method: Trehalose concentration in the supernatant obtained is measured using a HPLC system equipped with refractometer detector and a silica-amino column (250x4 mm i.d.) coupled to a guard-column (10x4 mm i.d.). Mobile phase used is acetomitrile : water (70:30) at 1mL. min (Deborde 237 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance et al., 1996) Enzymatic (Trehalase) method: Trehalose can also be determined by incubating the cell free extracts with a stable trehalase preparation. Extracts (100 Вµl) plus 25 Вµl trehalase are incubated overnight (14 h) at 40ВєC. The resulting glucose is assayed with glucose oxidase by adding to the spectrophotometer cell (2.0 ml final volume), the following reagents: 1% odianisidine, prepared by diluting in 0.1 M phosphate buffer pH 6.0; digested trehalose sample; peroxidase, 200 lg/ml in distilled water (1.5 U/ ml of the assay mixture); and glucose oxidase (1 mg/ml in distilled water, to obtain 21 U/ml in 2 ml of the assay mixture). Absorbance changes are measured in the spectrophotometer at 460 nm and 25ВєC and compared to a glucose standard curve (Gonzalez-Hernandez et al., 2005). Anthrone method: Trehalose extracts are submitted to the reaction with anthrone and the colour formed measured at 620 nm, according to the procedure described by Brin (1966). Quantification is achieved using trehalose as external standard. NMR method: After overnight ethanol extraction, the samples are dried in a desiccator for at least 48 h. Dried samples are resuspended in D2O (Aldrich Chemical) and analyzed by NMR spectroscopy using a Bruker AMX300 spectrometer with a 5-mm inverse detection probe head, 32 K data points, a 90j flip angle and a repetition delay of 42.7 s. The water resonance is suppressed with a pre-saturation pulse. The trehalose peak is identified against that of the pure substance. (Cardoso et al., 2004). Megazyme kit method: The trehalose content in the supernatant can also be measured using a enzymatic assay kit from Megazyme International Ireland Ltd. (Wicklow, Ireland). The basic principle includes hydrolysis of trehalose to D-glucose by trehalase and then D-Glucose released is measured by phosphorylating with enzyme hexokinase (HK). Cell protein determination: For expressing the trehalose content in the cell, the total protein in the cell is determined by the method of Lowry et al. (1951) after cell lysis with 1 M NaOH (85ВєC, 5 min), and using bovine serum albumin as a standard. Trehalose content of the cell is expressed in terms of protein content of the cell (Cardoso et al., 2004). References Brin, M. (1966). Transketolase: clinical aspects ed. In. S. P. Colowick & N. 0. Kaplan, Methods in Enzymology, 9, Academic Press, pp. 506514. Cardoso, F. S., Castro, R. F., Borges, N., Santos, H. (2007). Biochemical and genetic characterization of the pathways for trehalose metabolism in Propionibacterium freudenreichii and their role in stress response. Microbiology, 153, 270вЂ“ 280. Cardoso, F. S., Gaspar, P., Hugenholtz, J., Ramos, A., Santos, H. (2004). Enhancement of trehalose production in dairy Propionibacteria through manipulation of environmental conditions. International Journal of Food Microbiology, 91, 195вЂ“ 204. Colla, E., Pereira, A. B., Hernalsteens, S., Maugeri F., Rodrigues, M. I. (2010). Optimization of trehalose production by Rhodotorula dairenensis following a sequential strategy of experimental Design. Food Bioprocess Technol, 3, 265вЂ“275. Crowe, L. M. (2002). Lessons from nature: the role of sugars in anhydrobiosis. Comp Biochem Physiol AMol Integr Physiol, 131, 505вЂ“13. Deborde, C., Coree, C., Rolin, D. B., Nadal, L., de certaines, J. D., Boyaval, P. (1996) Trehalose biosynthesis in dairy Propionibacterium. Journal of magnetic resonance analysis, 2, 297-304. Ferreira, J. C., Paschoalin, V. M. F., Panek, A. D., Trugo, L. C. ( 1997). Comparison of three different methods for trehalose determination in yeast extracts. Food Chemistry, 60(2), 251-254. Gonzalez-Hernandez, J. C., Jimenez-Estrada, M. (2005). Comparative analysis of trehalose production by Debaryomyces hansenii and Saccharomyces cerevisiae under saline stress. Extremophiles, 9, 7вЂ“16. Hugenholtz, J., Hunik, J., Santos, H., Smid, E. (2002). Nutraceutical production by propionibacteria. Lait, 82, 103вЂ“ 112. Mahmud, S. A., Hirasawa, T., Shimizu, H. (2010). Differential importance of trehalose accumulation in Saccharomyces cerevisiae in response to various environmental stresses. Journal of Bioscience and Bioengineering, 109 (3), 262вЂ“266. Neta, T., Takada, K., Hirasawa, M. (2000). Low-cariogenicity of trehalose as a substrate. Journal of Dentistry, 28, 571вЂ“ 576. Schulze, U., Larsen, M. E., Villadsen, J. (1995). Determination of intracellular trehalose and glycogen in Saccharomyces cerevisiae. Analytical Biochemistry, 228, 143-149. 238 Spore Based Biosensor as A Quality Control Tool in Dairy Industry Spore Based Biosensor as A Quality Control Tool in Dairy Industry Naresh Kumar, Raghu H. V. and Avinash Dairy Microbiology Division, NDRI, Karnal The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare (Irudayaraj, 2009). Improving food and water safety and security depends on the ability to detect, identify, and trace food and water pathogens. As milk is a compulsory part of daily diet and being nutritious food for human beings, also serves as a good medium for the growth of many microorganisms which cause spoilage of milk and milk products. Earlier for detection of pathogens conventional methods which rely on specific media to enumerate and isolate viable bacterial cells in food were used, and are considered as gold-standard for their detection. These methods are very sensitive, inexpensive and can give both qualitative and quantitative information and involve the basic steps: pre-enrichment, selective enrichment, selective plating, and biochemical screening and serological confirmation. Hence, a complete series of tests are often required before any identification can be confirmed (Mandal et al., 2011) Although methods are powerful, error-proof, and dependable but are lengthy, cumbersome and are often ineffective because they are not compatible with the speed at which the products are manufactured and the short shelf life of products. To overcome these challenging criteria of time and sensitivity rapid methods which include nucleic acid, fluorescent antibody or immuno-based techniques have been developed which gives instant or real time results but requiring additional expensive devices and equipments (Ivnitski et al., 1999). Biosensor based tools offer the most promising solutions and address some of the modernday needs for fast and sensitive detection of pathogens in real time. Biosensors are defined as analytical devices integrating biological elements and signal transducers. The biological elements interact specifically with an analyte, producing a signal that the transducer recognizes and converts into measurable parameters as shown in fig.1 (Rasooly and Herold, 2006). Currently biosensor is defined as a sensor that integrates a biological element with a physiochemical transducer to produce an electronic signal proportional to a single analyte which is then conveyed to a detector. Biosensor achievements have revolutionized the detection method and provide us with simple to use device, cost-effective, rapid and appropriate detection method that give immediate and accurate results comparable to or better than the conventional analytical systems in terms of performance i.e. reliability, sensitivity, selectivity, specificity and robustness and can identify the contaminants much faster, more efficient and can give effective real time monitoring of pathogens and most importantly ensuring customer safety (Scott, 1998). History of biosensor: In 1956, Leland C Clark Jr., who is known as the father of Biosensors and he published his definitive paper on the oxygen electrode. In 1962, he Fig. 1. Diagrammatic representation of Biosensor and its described "how to make electrochemical working principle sensors more intelligent" by adding Source:www.realtimebiosensor.com (Mattias Rudh, 2007) "enzyme transducers as membrane enclosed sandwichesвЂќ. The year wise development in the field of biosensor is as follows: 1922: First glass pH electrode;1956: Invention of the oxygen electrode;1962: First description of a biosensor- an amperometric enzyme electrode for glucose; 1969: First potentiometer biosensor- Urease 239 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance immobilized on an ammonia electrode to detect urea; 1972/5: First commercial biosensor-Yellow Springs Instruments glucose biosensor;1975: First microbe-based biosensor, First immunosensorovalbumin on a platinum wire, Invention of the pO2/pCO2 optode; 1982: First fibre optic-based biosensor for glucose; 1983: First surface plasmon resonance (SPR) immunosensor; 1984: First mediated amperometric biosensor: ferrocene used with glucose Oxidase for the detection of glucose; 1996: Glucocard launched; 1998: Launch of LifeScan Fast Take blood glucose biosensor; 2001: LifeScan purchases Inverness Medicals glucose testing business for $1.3 billion. Types of biosensors: 1. Optical biosensors: Technique used in this biosensor is based on surface plasma resonance. 2. Electrochemical sensing biosensors: Technique used in this biosensor is based on amperometric sensing, Conductometric sensing. In amperometric sensing, increasing potential is applied to the cell until oxidation of the substance to be analysed occurs. This in turn increases the cell current and gives a peak current. The height of this peak current will be directly proportional to the concentration of electroactive substances or molecules. In conductive sensors substrate concentration is measured using relationship between conductance and concentration of ionic species. 3. Enzymatic biosensors: This type of sensors is widely used as they are easy to use. For example glucose biosensors. In glucose biosensor enzyme acts as a biorecognition element and recognizes only the glucose molecule. These enzymes are present in the electrode surface. When enzyme recognizes the glucose molecule it act as biocatalyst and produces gluconic acid and hydrogen peroxide using glucose and oxygen from the air. This reaction leads to the flow of electrons from hydrogen peroxide/oxygen coupling. This flow of electron is directly proportional to the number of glucose, molecules present in the biological fluid such as blood. Classification of biosensor: It may be classified according to the biological specificity conferring mechanism or to the mode of signal transduction, or alternatively a combination of both (Belluzo et al., 2008). Classification based on bioreceptors: A Bioreceptor is a biological molecular species or a living biological system that utilizes a biochemical mechanism for recognition (Tantilipikara, 2005). Depending upon the mechanism of biochemical interaction between the receptor and the analyte the biosensor can categorised into two types: 1. Biocatalytic sensors: They are based on the recognition and binding of an analyte followed by a catalyzed chemical conversion of the analyte from a non-detectible form to detectible form which are detected and recorded by a transducer. This includes: i) Monoenzyme, multienzyme ii) Microorganisms (such as bacteria, fungi, yeast), or sub cellular organelles and particles (mitochondria, cell walls); iii) Animal / plant tissue slice 2. Bioaffinity sensors: They are based on the interaction of the analyte with biological components, such as antibodies, nucleic acid, lectins, cell membrane receptor or harmone receptor (Rogers, 2000). Classification based on transduction system: The transducing element of a biosensor is used to convert the biological recognition step into the measurable signal that can be detected and displayed. It is further classified into following types: a) Electrochemical : Electrochemical detectors measure changes in electron transfer caused by an oxidation/reduction reaction involving the analyte at the surface of a suitable electrode (Thevenot et al., 2001). It further includesi) Amperometric : It detects the changes in current as a function of concentration of electro active species e.g. - Solid electrolyte gas sensors, electronic noses. ii) Potentiometric : It depends on changes in potential of a system at constant current (I=0) or it detects the change in distribution of charge. e.g. - Ion-selective electrodes (such as pH 240 Spore Based Biosensor as A Quality Control Tool in Dairy Industry meter), Ion-selective field effect transistors, LAPS. iii) Conductometric : It measures the change in conductance of the biological complex situated between electrodes. or it involves the measurement of changes in conductance due to the migration of ions. e. g.-Optical fibers, surface plasmon resonance, absorbance, luminescence. b) Optical : In optical biosensors, the optical fibers allow detection of analyte on the basis of absorption, fluorescence or light scattering (Chauhan et al., 2004) e.g.-Surface plasmon resonance c) Piezoelectric: The change in frequency is proportional to the mass absorbed material or Sensitive to changes in mass, density, viscosity and acoustic coupling phenomena e. g. Surface acoustic wave sensors d) Calorimetric : Many enzyme catalyzed reactions are exothermic, generating heat which may be used as a basis for measuring the rate of reaction and, hence, the analyte concentration. Whole-cell bacterial biosensors Bacteria can be used as biosensors to demonstrate the toxicity of a variety of environmental media including soil, sediment, and water by coupling bacteria to transducers that convert a cellular response into detectable signals (Biran et al., 2003). These bacterial biosensors are engineered by pairing a reporter gene that generates a signal with a contaminant-sensing component that responds to chemical or physical change, such as exposure to a specific analyte. When the biosensor is exposed to such a change, the sensing component stimulates the reporter gene through a biochemical pathway in the cell. The reporter gene then produces a measurable response, such as emitting visible light, which is indicative of the degree of chemical or physical change (Biran et al., 2003; Tauriainen et al., 2000, Turpeinen et al., 2003; Daunert et al., 2000). Several biosensors have been developed that indicate toxicity of any chemical or physical change; new biosensors are being developed to respond to particular analytes. Such biosensors have been developed for heavy metals and metalloids including arsenic, cadmium, mercury, and lead (NRC, 2003). Biosensors measure the bioavailability concentration for the contaminant they are designed to detect (Tauriainen et al., 2000). To test the measurements made by biosensors, a chelating agent known to decrease bioavailability of lead was added to a lead solution. Measurements of the lead solution containing chelating agents were taken and compared to measurements of the lead-only solution. A decrease in the biosensors luminescence matched a decrease in bioavailability concentration of lead in the solution. This demonstrates that biosensors are sensitive to the bioavailability fraction of the contaminant and their luminescence reflects the bioavailability concentration (Tauriainen et al., 2000). Spores based biosensor: Bacterial spores appears to have great potential for their application as bio-sensor as they have the ability to sense environmental changes and to respond using explosive molecular mechanisms that transform dormant spores into rapid growing cells. There are a great number of bacterial species which produce spores for example; genus Bacillus (widely dispersed in soil, plant matter, and air) may be readily grown in the laboratory to form spores: B. cereus, B. licheniformis, B. megaterium, B. sphaericus, B. stearothermophilus, B. subtilis, and B. thuringiensis. They can also survive in a very harsh condition. For the development of bacterial spore as a biosensor, it is a prerequisite to have a complete or descriptive knowledge regarding their germinants (carbohydrates, nucleotides, amino acids etc.) which by their action on the dormant spores convert them into vegetative cells. The germination process of a whole population of spore may be completed in a very short duration of time (15-30min) followed by a sequence of metabolic reactions and synthesis of enzymes resulting in outgrowth of vegetative cells. After germination de novo acetyl esterase is released from the core of the spore which act upon DAF and its hydrolysis results in flouroscence and the signal can be captured using optical device to quantify the presence of target analyte (Rotman, 2001). Characteristic features of spores: Bacillus species have inherent characteristics to produce 241 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance endospore. These are the dormant form of life having no metabolic activity. They are resistant to environmental stress like heat, desiccation, irradiation and chemical compounds and can be stored in a medium for long time even in the absence of nutrients. Spores are resistant due to the Calciumdipicolinate present in the spores that stabilize and protects the DNA from denaturation. DNA-binding proteins helps in protecting the DNA from heat, drying, chemicals, and radiations. While dehydration process that is the loss of water provides them resistance toward heat and radiation. And finally during the germination process damaged DNA they get repaired by DNA repair enzymes (Setlow, 2003). Sporulation: Spore formation, sporogenesis or sporulation, normally commences when growth ceases due to lack of nutrients. It is a complex process and may be divided into seven stages .An axial filament of nuclear material forms (Stage-I), followed by an inward folding of the cell membrane to enclose part of the DNA and produce the forespore septum (Stage-II). The membrane continues to grow and engulfs the immature spore in a second membrane (Stage-III). Next, cortex is laid down in the space between the two membranes, and both calcium and dipicolinic acid is accumulated (StageIV). Protein coats then are formed around the cortex (Stage-V), and maturation of the spore occurs (Stage-VI). Finally, lytic enzymes destroy the sporangium releasing the spore (Stage-VII). Diagram representing the different stages of sporulation (Prescott et al., 2002). Germination: In the presence of favorable growth conditions spores get germinated. The germination process is essentially a biophysical and degradative one вЂ“ the sporeвЂ™s inner membrane increases in fluidity and ion fluxes resume; monovalent cations, potassium and sodium, move across the spore membrane, and calcium ions and dipicolinate are excreted. The peptidoglycan of the spore cortex is degraded, and the coat layers are partially degraded. ATP synthesis and oxidative metabolism resume, DNA damage is repaired and the DNA-complexing small acid-soluble proteins (SASPs) are degraded by a specific protease, providing a source of amino acids for outgrowth. As germination events precede any de novo synthesis of macromolecules, the apparatus required for spore germination must be already present in the mature spore (Moir et al., 2002). Application of spores as biosensor: Bacterial spores are suitable for use as biosensor because they have the ability to sense environmental changes in response to specific вЂњgerminantвЂќ and transform into rapid growing cells. The spores are heat resistant and can remain in non metabolic state for many years. This characteristic can effectively be used as a biosensor for tracking these residues in milk and milk products and the details of biosensor developed are as follows: 242 Spore Based Biosensor as A Quality Control Tool in Dairy Industry 1. Development of analytical process for detection of antibiotic residues in milk using bacterial spores as biosensor.(Patent no Reg# IPR /4.9.1/05074/2006)(Kumar et al., 2006) 2. A kit for detection of ОІ-lactam antibiotic group in milk using bacterial spore as biosensor (Patent Reg # IPR/ 4.14.1/08073/del/2009) (Kumar et al., 2009) 3. Development of Spore Inhibition Based -Enzyme Substrate Assay (SIB-ESA) for monitoring Aflatoxin M1 in milk (Patent Regd.# IPR /4/14.4/10045) 4. Development of Enzyme Substrate Assay (ESA) for Monitoring Enterococci in Milk (Setlow, P, 2003.) Development of analytical process for detection of antibiotic residues in milk using bacterial spores as biosensor The bacterial spores have unique ability to sense environmental changes in response to specific вЂњgerminantвЂќ and transform rapidly into growing vegetative cells. The spores are heat resistant and can remain in non metabolic state for many years. This characteristic can effectively be used as a biosensor for tracking these residues in milk and milk products. In the present invention, an analytical process of transformation of dormant spore of Bacillus stearothermophilus into active vegetative cell through activation, germination and outgrowth has been developed .This analytical process can track major groups of antibiotic residues in milk within 2.30-3.0 hours at MRL / or above levels recommended by codex. Brief of Invention: An analytical process which involves sporulation & activation of dormant spores of B.stearothermophilus in newly developed medium & their germination/ outgrowth in presence of selective germinant mixture has been developed (Patent Reg # IPR/ 4.9.1.4/ 05074/ 1479 /DEL /2006). The validated process is in line with AOAC approved charm 6602 system & can be used effectively for semi-quantitative detection of antibiotic residues in different types of milk system within 2.30-3.0 hrs at MRL/ or above levels as recommended by the codex /EU. This cost effective process can also find applications in targeting spoilage and pathogenic organisms in dairy and non dairy foods. Market Potential: For monitoring of drug residues in milk well defined test / rapid assay technique are not available in India. MDR test Kit was offered to various stake holders like m/s Duke Thomson Pvt. Ltd., Indore; Hi-media Pvt. Ltd, Mumbai, NDDB; M/s Neugen diagnostic secunderabad etc. The product was appreciated by all these potential customers and finally one non-exclusive license with fee of Rs. 2.50 lakhs, royalty 2.0% & validity of license for period of 7 years was given to M/s Neugen diagnostic Secunderabad who currently is selling our product to different dairy units like Mother Dairy, Delhi; Paras Dairy (3 units); Bholebaba Dairy; Hatsun Dairy, TN; Aavin Dairy, TN; Kolar Dairy, Karnataka; Shipra Lab, Bengaluru; Delhi Milk Scheme etc. Microbial Drug Residues Test Kit (15 set test) developed at dairy microbiology division were sold to different dairy units through M/s Neugen Diagnostic Pvt. Ltd. @ 1200/- + CST @ 10.30% in last six months period. Further steps are required for 243 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance AOAC approval of this product which will be costing around 10 lakhs and may expand its application at domestic level by incorporating in our legal standard (PFA standard) as well as in export. Novel features of process: 1. Cost effective 2. Better sensitivity 3. Semi-quantitative detection 4. No false positive /negative results 5. Insensitivity towards detergents / sanitizers 6. Consistency in color development with in 3.0 hrs 7. Validated with AOAC approved charm 6602 system 8. Wide spectrum of application for different types of milk 244 Spore Based Biosensor as A Quality Control Tool in Dairy Industry A kit for detection of ОІ-lactam antibiotic group in milk using bacterial spore as biosensor: This invention relates to application of dormant bacterial spores as biosensor. The study is based on the resistance mechanism of some ОІ-lactamase generating Bacillus spp. Some spore forming bacteria such as B. cereus and B. licheniformis produce ОІ-lactamase enzyme due to induction by ОІ-lactam antibiotics and the enzyme production is proportional to the concentration of inducer present in milk. A real time microbial assay based on ОІ-lactamase enzyme using starch iodine as color indicator has been developed. The microbial assay is working on principle of non competitive enzyme action on inducer (ОІ-Lactam) resulting in indirect reduction of starch iodine mixture through penicilloic acid. A comparison of the intensity of the test reaction with that of a control was taken as criteria to determines whether the sample is positive or negative (Kumar et al., 2009) .The assay can detect specifically ОІlactam groups in spiked milk with in 15-20 min at regulatory codex limits with negligible sensitivity towards non ОІ- lactam groups. The presence of Inhibitors other than antibiotic residues in milk did not interfere with the working principle of microbial assays. A significant correlation between microbial assay & receptor based assay (charm 6202) was established in survey work with raw, pasteurized milk and dried products with no false positive/ negative results. Spore suspension was found stable up to 5 months when stored under refrigeration conditions. The microbial assay (Rs 20.54/- test) is cost effective can find immense application in dairy industry as вЂњON FARMвЂќ milk screening test for ОІ- lactam group (Kumar et al., 2009). The impact of innovation on life of Rural India: The invention was carried out to test drug residues at farm level. These drug residues have immense public health and processing implications. The field level testing will be of public heath and processing value to dairy farmers and entrepreneurs who are involved in dairy small business. Development of spore inhibition basedвЂ“enzyme substrate assay (sib-esa) for monitoring aflatoxin M1 Brief about Innovation: Aflatoxins are toxic, carcinogenic, mutagenic immuno-suppressive agents produced as secondary metabolites by the fungi Aspergillus flavus & A. parasiticus. Four major Aflatoxins B1, B2, G1, and G2 have been isolated from feeds. Aflatoxin M1 is hydroxylated derivative Patent on development of spore inhibition basedвЂ“enzyme substrate assay (SIB-ESA) for monitoring aflatoxin M1 in milk has been filed at NDRI and is under processing(Patent Regd.# IPR /4/14.4/10045) 245 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance of Aflatoxin B1.The bacterial spores as nano-detector have unique ability to sense environmental changes in response to specific вЂњgerminantвЂќ and transform rapidly into growing vegetative cells. This characteristic can be effectively used as biosensor for tracking microbial and nonвЂ“microbial contaminants (Kumar et al.,2005; Rotman 2001 & 2003).The present hypothesis is based on the specific spore germination inhibition principle in presence of specific analyte i.e. aflatoxin M1. In case where analyte is absent in milk system, specific indicator enzyme (s) are produced by active bio-sensing molecules which will act specifically on chromogenic/or fluorogenic substrate resulting in colored reaction/or fluorescence as end product which is measured semi-quantitatively by either visually/or using optical system at specific excitation/emission spectra (Kumar et al., 2010). The end product response is significantly different in case of buffer/ or milk system containing specific analyte i. e. aflatoxin M1. The developed test assay was validated by analyzing 25 samples of each raw and pasteurized milk procured from different organized/or private own dairies and other reputed brands using AOAC approved RIA and ELISA based system and a significant correlation with ELISA at Codex MRL Limit (0.5 ppb) of Aflatoxin M1 was established. Development of Enzyme Substrate Assay (ESA) For Monitoring Enterococci in Milk: An Enzyme Substrate Assay (ESA) based on ОІ-D-glucosidase activity was attempted for specific detection of Enterococci to meet the emerging demand of dairy industry. Four enrichment broths commercially available in the market were screened for selective recovery of Enterococci based on ОІ-D-glucosidase activity. One of these broths namely Chromocult Enterococcus Broth (CEB) showed better performance in terms of selectivity and enzyme activity with partial inhibition of contaminants other than Enterococci. The selected medium was further improved for desired features by increasing the concentration of sodium azide from 0.06 to 0.15 g/100 ml resulting in significant inhibitory effect on growth pattern of L. lactis, L. casei, Leuconostoc mesenteroides and L. monocytogenes. Other media components and supplements were also optimized for enhanced sensitivity and selectivity of Enterococcus sp. The optimized selective enrichment medium i. e. Esculin Based Sodium Azide Medium (EBSAM) demonstrated superior features in terms of sensitivity, selectivity, fastness, accuracy etc. and may be a suitable substitute for existing media used for routine monitoring of Enterococci in R&D institutions. Developed assay was screened for Enterococci count with 32 samples of raw milk and it could detect 2.67, 3.50, 4.25 and 4.8 log counts within incubation period of 12, 7ВЅ, 6ВЅ and 5 hr respectively. ESA could also detect Enterococci log counts of 2.84 in pasteurized milk within 12 hrs of incubation; however, assay was insensitive at very low level of 1.13 and 0.915 log counts. As such ESA developed in current investigation may find industrial application as Hygiene Indicator test for detection of Enterococci in raw milk & pasteurized milk with in 5-12 hrs as against 36-48hrs required 246 Spore Based Biosensor as A Quality Control Tool in Dairy Industry in conventional method (Thakur et al., 2010). Concluding remarks: Biosensors are making a great impact on the development of rapid, sensitive assays for the detection of microbial and non вЂ“ microbial contaminants in food system. Kits are now available for several organisms such as E. coli O157:H7 and Salmonella typhimurium and it is hoped that more will become available shortly. The most viable openings in the food industry will arise where a biosensor can rapidly detect total microbial contamination. The largest area of application for the environment lies in the development of biosensors for monitoring bacteria in drinking and waste water, rivers, reservoirs and supplies. Spores have a great potential to be used as a biosensor and the bioassay are cost effective, rapid, easy to perform and require almost negligible infra-structural facilities. References: Belluzo, M. S., Ribone, M. E., Lagier, C. M., 2008. Assembling Amperometric Biosensors for Clinical Diagnostics. Sensors 8, 1366-1399. Biran, I., Rissin, D., Ron, E. and D. Walt. 2003. Optical imaging fiber-based live bacterial cell array biosensor. Analytical Biochemistry, 315:1, pp. 106-113. Chauhan, S., Rai, V., Singh, H. B., 2004. Biosensors. Resonance. 33-44. Daunert S., Barrett G., Feliciano J., Shetty R., Shrestha S., and W. Smith-Spencer. 2000. Genetically Engineered WholeCell Sensing Systems: Coupling Biological Recognition with Reporter Genes. Chem. Rev., 100, pp. 2705-2738. Irudayaraj, J., 2009. Pathogen Sensors. Sensors 9, 8610-8612. Ivnitski, D., Abdel-Hamid, I., Atanasov, P., Wilkins, E., 1999. Biosensors for detection of pathogenic bacteria. Biosensors & Bioelectronics 14, 599вЂ“624. Kumar, N., Das, S., Manju, G., 2009. A kit for detection of ОІ-lactam antibiotic group in milk using bacterial spore as biosensor (Patent Reg # IPR/115/del/2009). Kumar, N., Sawant, S., Malik, R.K., Patil, G.R., 2005. Development of analytical process for detection of antibiotic residues in milk using bacterial spores as biosensor (Patent Reg # IPR/4.9.1.4/05074/1479/del/2006). Kumar, N., Singh, N., Singh, V.K., Bhand, S., Malik, R.K., 2010. Development of spore inhibition basedвЂ“enzyme substrate assay (SIB-ESA) for monitoring aflatoxin M1 in milk (Patent Regd.# IPR /4/14.4/10045). Mandal, P. K., Biswas, A. K., Choi, K., Pal, U. K., 2011. Methods for Rapid Detection of Foodborne Pathogens: An Overview. American Journal of Food Technology 6(2), 87-102 Moir, A., Corfe, B. M., Behravan, J., 2002. Spore germination. Cell Mol Life Sci 59, 403вЂ“409. National Research Council (NRC), 2003. Bioavailability of Contaminants in Soils and Sediments: Processes, Tools, and Applications. The National Academies Press. Prescott, L. M., Harley, Klein., 2002. Microbiology. 5th Edition. The McGraw-Hill companies. (Chapter 3) Rasooly and Herold, 2006. Biosensors for the Analysis of Food- and Waterborne Pathogens and their Toxins. Journal of AOAC international 89(3), 873-883. Rogers, K. R., 2000. Principles of affinity-based biosensors. Molecular Biotechnology 14(2), 109-129. Rotman, B., 2001. Using living spores for real-time biosensing. Gen. Eng. News 21, 65. Rotman, B., Cote, M. A., 2003. Application of a real-time biosensor to detect bacteria in platelet concentrates. Biochem. Biophys. Res. Comm 300, 197-200. Scott, A. O., 1998. Biosensor for food analysis. Published by Royal Society of chemistry, Cambridge, UK. (Chapter 1) Setlow, P., 2003. Spore germination. Current Opinion in Microbiology 6, 550вЂ“556. Tantilipikara, P., 2005. Optical biosensor for microalbumin determination. A thesis submitted in partial fulfilment of the requirement for the degree of Master of Science. Mahidol University. Tauriainen, S., Virta, M. and M. Karp. 2000. Detecting Bioavailable Toxic Metals and Metalloids from Natural Water Samples Using Luminescent Sensor Bacteria. Water Research, 34:10, pp. 2661-2666. Thakur, G., Kumar, N., Raghu, H. V., Malik, R. K., (2010). Development of Off-Line Enzyme Substrate Based Assay for Monitoring Enterococci in Milk. NDRI Newsletter Apr вЂ“ June 2010. Pp 2-3. Thevenot, D. R., Toth, K., Durst, R. A., Wilson, G. S., 2001. Electrochemical biosensors: recommended definitions and classification. Biosensors & Bioelectronics 16(1), 121-131. Turpeinen R., Virta M., and M. Haggblom. 2003. Analysis of Arsenic Bioavailability in Contaminated Soils. Environmental Toxicology and Chemistry, 22:1, pp. 1-6. 247 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance Detection and Evaluation of Antimicrobial Activities of Bacteriocins and Bioactive Peptides Produced by LAB Shilpa Vij, Subrota Hati and Meenakshi Dahiya Dairy Microbiology Division, NDRI, Karnal Lactic Acid Bacteria (LAB) have been used for centuries in the fermentation of a variety of dairy products. The preservative ability of LAB in foods is attributed to the production of anti-microbial metabolites including organic acids and bacteriocins. Bacteriocins generally exert their anti-microbial action by interfering with the cell wall or the membrane of target organisms, either by inhibiting cell wall biosynthesis or causing pore formation, subsequently resulting in death. Bioactive Peptides are released from milk proteins on enzymatic hydrolysis by the proteolytic enzymes such as trypsin, pepsin , chymotrypsin and LAB fermentation of milk proteins i.e. whey and casein by proteolytic LAB such as L.helveticus, L.fermentum, L.acidophilus, L casei and Lactococci. A large variety of techniques have evolved to assess the ability of microorganisms to produce antagonistic substances. Antimicrobial activities of bacteriocins/ Bioactive Peptides produced by LAB Materials Required: Sterile Petri-plates, sterile pipettes, Micropipettes, Sterile Micro tips, incubator, MRS agar, TGE agar, TGE soft Agar (0.8 % agar) tubes, indicator strains, the glass tube with a suction bulb, sterile filter paper discs, forceps, ethyl alcohol (70%). Indicator strain Culture Condition Pediococcus acidilactici LB42 30/37ВєC MRS / TGE Broth Lactobacillus plantarum NCDO 955 37ВєC MRS / TGE Broth Lactobacillus helveticus 37ВєC Whey/ Sodium Caseinate Important: вЂў Only freshly grown (3-4 hours incubation) active indicator strains should be used for determining antibacterial activity. вЂў Do not use stored (refrigeration temperature) indicator strain for the assay. вЂў Do not use the over night incubated culture for the assay. Procedure: вЂў Grow LAB/ Bacteriocin producing LAB cultures in MRS / M17 broth for 18-24 H as its optimal growth temperature (30/37ВєC). вЂў Grow proteolytic strains of LAB in whey or sodium caseinate (supplemented with 0.5% glucose) for 24 - 48 h as its optimal growth temperature (30/37ВєC) for bioactive peptide production. вЂў Remove the cells by centrifugation at 12000 rpm for 20 min at 5ВєC. вЂў Sterilize the supernatant from broth by passing through a 0.22 Вµm membrane or heat treat the supernatant at 90ВєC for 3 min in a dry bath/ water bath. вЂў Alternatively cells are killed by boiling for 3-5 min and heat killed cultures can be employed. вЂў Ultrafilterate whey qnd sodium caseinate fermentate from 10K Da membrane for separating bioactive peptides of less than 10 KDa molecular weight. вЂў Prepare agar plates by pouring melted agar (MRS/M17) in sterile Petri plates вЂў After solidification of the agar transfer the plates to the incubator at 37ВєC overnight for drying of the agar surface. 248 Detection and Evaluation of Antimicrobial Activities of Bacteriocins and Bioactive Peptides Produced by LAB вЂў Overlay 5-7 ml of soft agar (0.8% agar) which had been seeded with 50 Вµl of the freshly grown (3-4 h) indicator strain. This will generate a potential mat of the indicator bacteria. вЂў Refrigerate the plates at 5ВєC for 1-2 h before the wells are punched out of the agar. вЂў Punch out the wells with the broad end of a sterile Pasteur pipette and remove the agar buttons. вЂў Fill the wells 100 Вµl of the prepared culture supernatant/ heat killed cultures and less than 10 K Da bioactive peptides from whey and sodium caseinate вЂў Put the plates in the refrigerator (5-7ВєC) for 3-4 h to facilitate the diffusion of the antimicrobial compound (Do not invert the plates). вЂў Incubate the plates at optimum temperature of the indicator strain for 18-24 h (Do not invert the plates). вЂў Observe the plates for zone of clearance (if any) around the edge of the wells. вЂў A clear zone of 1 mm or greater extending laterally from the edge of the wells is considered positive inhibition. Use sterile distilled water as a control. Detection of bacteriocin (Nisin) produced by LAB This is a faster MTT [3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide] colorimetric assay (MCA) for quantitative measurement of polypeptide bacteriocins in solutions with nisin as an example. After an initial incubation of nisin and indicator bacterium Micrococcus luteus NCIB 8166 in tubes, MTT was added for another incubation period. After that, nisin was quantified by estimating the number of viable bacteria based on measuring the amount of purple formazan produced by cleavage of yellow tetrazolium salt MTT. Then MCA was compared to a standard agar diffusion assay (ADA). 1. Indicator bacterial strain and cultivation: Inoculate a loop of Micrococcus luteus on the S1 agar (0.8% tryptone , 0.5% yeast extract 0.5% D-glucose 0.5% NaCl and 0.2% Na2HPO4. In agar medium add 1.5% (w/v) Tween 20.) plate and incubate at 37В°C for 18~24 h. Then, transfer a single colony of bacteria from the S1 agar to S1 broth and incubate at 37В°C for 12 h. 2. Dissolve MTT in phosphate buffered saline (pH 7.2) to a concentration of 5 mg/ml, and then filtere through a 0.2-Ојm syringe filter. 3. Add 100Вµl of MTT solution into each of 2 ml fresh S1 broth with indicator bacteria (from 106 to 101 CFU/ml) and then incubate at 37В°C for 1, 2, 3, 4, 5 and 6 h, respectively. 4. Keep the broth culture in boiling water for 5 min to stop reaction. 5. After cooling, centrifuge the cultures at 1 500Г—g for 20 min to precipitate formazan crystals 6. Remove the supernatant. To dissolve the formazan crystals, add 2 ml of dimethylsulfoxide (DMSO) and then incubate the mixture for 10 min at room temperature. 7. Measured the optical density (OD) of the formazan solution at the wavelength of 510 nm. 249 Chemical Analysis of Value Added Dairy Products and Their Quality Assurance List of Selected Participants for Winter School 1. Sh. Shiv Shanker Chasta 7. Assistant Professor, DFT Department, College of Dairy & Food Science Technology, MPUAT, Udaipur-313001 (Rajasthan) [email protected], 09828566021 2. Dr. M. Ilamaran Assistant Professor (FSN) Department of Food Science and Nutrition, Home Science College and Research Institute, Tamil Nadu Agricultural University, Madurai - 625 104 [email protected], 09865175206 3. Dr. R. Saravanakumar Assistant Professor (FSN) Department of Food Science and Nutrition, Home Science College and Research Institute, Tamil Nadu Agricultural University, Madurai - 625 104 [email protected], 09942893107 4. Mr. Durga Shankar Bunkar Assistant Professor, Center of Food Science & Technology, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi- 221 005 [email protected], 09389835175 5. Dr. Raj Kumar Duary Assistant Professor, Department of Food Processing Technology, School of Engineering, Tejpur University, Napaam, Sonitpur, Assam -784 028 [email protected], 09957669564 6. Dr. Ashim Kumar Biswas Dr. S.G. Narwade Assist. Prof. (Dairy Science) Department of Animal Husbandry & Dairy Science, College of Agriculture M.A.U. Parbhani.431 402 [email protected], 09028584537 8. Dr. R.A. Patil Assistant Professor (AHDS) Dept. Animal Husbandry & Dairy Science, College of Agriculture, Latur-412 513 (M.S.) [email protected], 09422189001 9. Dr. D.D. Patange Assistant Professor, College of Agriculture, Kohlapur-416004 (MS) [email protected], 09421800941 10. Dr. K.D. Chavan Assistant Professor, Animal Science and Dairy Science Section, College of Agriculture, Pune, Behind Mariai Gate , Khadki, Pune 411 003 (MS) [email protected], 09422058693 11. Mr. Ramachandra. B Assistant Professor, Dairy Science College, KVAFSU, Bidar-585 401 [email protected], 09481191728 12. Mr. Harsh Prakash Sharma Assistant Professor Department of Food Engineering College of Food Processing Technology & Bio Energy AAU,Anand-388110 Gujarat, [email protected], 09408398737 13. Dr. Pawas Goswami Department of Livestock Products Technology, COVS, Gadvasu, Ludhiana-141 004 (Punjab) Assistant Professor Department of Microbiology Maharshi Dayanand Saraswati University Ajmer вЂ“ 305009 [email protected], 09463320622 [email protected], 09829273453 List of Selected Participants for Winter School 14. Dr. Rakesh Kumar 20. Mr. Devraja Naika H. SMS (Dairy Technology) 303-C, Aradhana Enclave, Khajpura, Bailey Road, Patna-800 014 Veterinary college, Koravangala Gate, Arsikere road, Hassan-573201, Karnataka [email protected], 09934263033 [email protected], 9900704695 15. Sh. Yogesh Khetra Scientist, Dairy Technology Division, NDRI, Karnal [email protected], 09813902989 16. Dr. P. Narender Raju Scientist, Dairy Technology Division, NDRI, Karnal [email protected], 09896038983 17. Mr. Awanish Kr. Srivastava Unipex Dairy Product Co. Ltd. UAE PO Box 5646, Sharjah, United Arab Emirate [email protected], 0097150 3637840 18. Er. Tariq Ahmad Assistant Professor Department of Food Technology Islamic University of Science and Technology Avantipora (J & K) [email protected], 09906480112 19. Dr. Arun Goel, Assistant Professor DFT Department, College of Dairy & Food Science Technology, MPUAT, Udaipur-313001 (Rajasthan) [email protected], 09887182750 21. Dr. S. Shive Kumar Assistant Scientist (DT) College of Dairy Science & Technology GADVASU, Ludhiana-141 004 (Punjab) [email protected], 09646434238 22. Mr. Vilas Mahadeorao Thakre Programme Coordinator KVK, Sindewahi, Distt. Vhandrpur (Maharashatra) [email protected], 09881149896 23. Mr. Saraff Sripad Asstt. Professor & Head, Department of Dairy Chemistry, Dairy Technology Programme, SVVU, Kamareddy, Distt. Nizamabad-AP 503 111 [email protected], 09848721561 24. Ms. Nikam Pranali Balkishan College of Dairy Technology, Warud, Pusad -445204 [email protected], 09225235250 25. Dr. Vishakha Singh Assistant Professor Department of Foods & Nutrition, College of Home science, Maharana Pratap University of Agriculture & Technology, Udaipur 313001(Rajasthan) [email protected], 09414029748