Plant Biotechnology Journal (2013) 11, pp. 933–941
doi: 10.1111/pbi.12085
Targeted molecular trait stacking in cotton through
targeted double-strand break induction
Kathleen D’Halluin1,*, Chantal Vanderstraeten1, Jolien Van Hulle1, Joanna Rosolowska1, Ilse Van Den Brande1,
Anouk Pennewaert1, Kristel D’Hont1, Martine Bossut1, Derek Jantz2, Rene Ruiter1 and Jean Broadhvest1
1
Bayer CropScience N.V., Gent, Belgium
2
Precision BioSciences, Durham, NC, USA
Received 11 February 2013;
revised 16 April 2013;
accepted 24 April 2013.
*Correspondence (Tel +32 9 243 05 45;
fax +32 9 383 67 31; email Kathleen.
[email protected])
Keywords: cotton, targeted molecular
trait stacking, meganuclease, targeted
DNA double-strand break induction
and repair, homologous
Summary
Recent developments of tools for targeted genome modification have led to new concepts in
how multiple traits can be combined. Targeted genome modification is based on the use of
nucleases with tailor-made specificities to introduce a DNA double-strand break (DSB) at specific
target loci. A re-engineered meganuclease was designed for specific cleavage of an endogenous
target sequence adjacent to a transgenic insect control locus in cotton. The combination of
targeted DNA cleavage and homologous recombination–mediated repair made precise targeted
insertion of additional trait genes (hppd, epsps) feasible in cotton. Targeted insertion events were
recovered at a frequency of about 2% of the independently transformed embryogenic callus
lines. We further demonstrated that all trait genes were inherited as a single genetic unit, which
will simplify future multiple-trait introgression.
recombination, gene targeting.
Introduction
Cotton is one of the major GM field crops next to soya bean,
corn and canola. The percentage of the global cotton acreage
planted with GM cotton has reached 82% in 2012 (James,
2011). Herbicide tolerance and/or insect resistance is the most
widely used GM traits in cotton. Different herbicide tolerance
and insect resistance genes with different modes of action will
be needed to provide for future combined, broad coverage
weed and pest control. In addition to herbicide tolerance and
insect resistance traits, there are several agronomic and quality
traits being developed for multiple-trait introgression in cotton
and other crop plants, including disease resistance, abiotic
stress tolerance, yield enhancement and quality traits. Combining two or more traits in one variety can be performed either
by conventional breeding stacks or by molecular trait stacking
in a single transgene locus using a transformation vector
carrying multiple-trait genes (Que et al., 2010). With both
technologies, the logistical challenges increase with the number
of trait genes to be stacked. Either large breeding populations
have to be screened to identify those individuals in which all
trait genes are retained or large numbers of transformants have
to be screened to identify the one expressing all traits as
desired. Targeted molecular trait stacking could overcome many
of these challenges by targeted insertion of the additional trait
genes in close genetic vicinity of an already existing transgene
locus.
Targeted genome modifications have been achieved by the
introduction of a DNA double-strand break (DSB) at a chosen
specific chromosomal location using different types of sequencespecific nucleases. The three major types of sequence-specific
designer rare-cutting endonucleases for targeted DSB induction
are the zinc finger nucleases (ZFNs) (Porteus and Baltimore,
2003), the transcription activator-like effector nucleases (TALENs)
(Bogdanove and Voytas, 2011) and the meganucleases (Epinat
et al., 2003). The ZFNs consist of a synthetic C2H2 DNA-binding
zinc finger domain fused to the catalytic domain of the FokI
endonuclease (Carroll, 2011). The DNA-binding domain is usually
composed of three to five zinc fingers, each recognizing a 3-bplong sequence. Zinc finger binding depends on more than simply
matching triplets of DNA to the corresponding finger. TALENs
consist of an engineered DNA-binding domain from transcription
activator-like effectors (TALEs) fused to the catalytic domain of
FokI (Cermak et al., 2011). Each transcription activator-like
effector (TALE) repeat binds a single base pair in the target
DNA, thereby simplifying design in comparison with ZFNs. Also,
there seem to be fewer context effects with TALE repeats than
with zinc fingers (Christian et al., 2010). As dimerization of the
FokI domain is required for cleavage, this necessitates the design
of a pair of reagents for both ZFNs and TALENs to cleave the
desired target sequence.
The LAGLIDADG homing endonucleases, also called meganucleases, are a third class of designer nucleases for targeted DSB
induction (Epinat et al., 2003). Meganucleases are more challenging to re-engineer compared with TALENs and ZFNs as the
DNA-binding domains of most homing endonucleases are not
separated from the catalytic domain (Taylor et al., 2012). These
meganucleases typically cleave long recognition sites (20–30 bp),
making them highly specific. The I-CreI homing endonuclease of
Chlamydomonas reinhardtii (Thompson et al., 1992) has been
used as scaffold for the development of designer meganucleases
(Arnould et al., 2007; Smith et al., 2006).
More recently, a new platform for targeted DSB induction in
complex genomes based on the CRISPR-associated (Cas) endonuclease has been discovered. Cas9 is guided to its target by a
small designer RNA and specifically cleaves target sequences
complementary to this small guide RNA (Hwang et al., 2013;
Jinek et al., 2012). Cleavage of a new target sequence requires
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd
This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License,
which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and
no modifications or adaptations are made.
933
934 Kathleen D’Halluin et al.
only a new guide RNA but no new enzyme, while for ZFNs and
TALENs and meganucleases, a new enzyme has to be generated
for each target.
Double-strand breaks in plant cells are predominantly repaired
by nonhomologous recombination (NHR), which is often imprecise resulting in the loss of gene function. Precise repair of DSBs is
possible through homologous recombination (HR) by the use of a
homologous DNA template that is exploited for the creation of
precise modifications at a desired target site. Up to now, there are
several papers reporting on targeted mutagenesis in plants by
nonhomologous end joining (NHEJ) using ZFNs as designer
nucleases, like in Arabidopsis (Lloyd et al., 2005), tobacco
(Maeder et al., 2008; Zhang et al., 2013) and soya bean (Curtin
et al., 2011). As TALENs have been developed only a few years
ago, there are still only a few papers describing studies of TALENs
in plants. TALENs have been used for the creation of mutations by
NHEJ in Arabidopsis (Cermak et al., 2011), tobacco (Mahfouz
et al., 2011) and in rice for the generation of disease-resistant
plants by targeted disruption of the rice bacterial blight susceptibility gene (Li et al., 2012). Targeted mutagenesis by NHR at the
liguleless1 chromosomal locus in maize using an engineered I-CreI
endonuclease has been demonstrated by Gao et al., 2010. There
have no studies been published yet on the use of CRISPR/Cas9 for
targeted DSB induction and repair in plants.
Most published studies on HR-mediated targeted genome
modification mediated by ZFNs use the model plant tobacco (Cai
et al., 2009; Townsend et al., 2009; Wright et al., 2005; Zhang
et al., 2013) or Arabidopsis (De Pater et al., 2013). To date, there
is only one plant paper on ZFN- and HR-mediated genome
modification in an agronomic crop describing targeted gene
addition at an endogenous locus in maize (Shukla et al., 2009).
These authors show disruption of the IPK1 locus by HR-mediated
targeted insertion of an herbicide tolerance gene resulting in both
herbicide tolerance and phytate reduction. HR-mediated gene
targeting using TALENs has only been reported for tobacco. In
this study, gene targeting was obtained at frequencies that would
not further require the need for selection or enrichment procedures (Zhang et al., 2013).
In our study, we assessed whether a customized designed
nuclease could be used for trait stacking by HR-mediated gene
addition next to a pre-existing, good performing transgene locus
in cotton. Using single-chain I-CreI–based engineered homing
endonuclease technology, we were able to precisely insert two
herbicide tolerance genes in close vicinity to a pre-existing insect
control locus.
Results
Design and validation of the endonuclease
To allow transgene stacking in the elite insect control event
GHB119 (described in 2008/151780, deposit nr ATCC PTA-8398)
comprising the cry2Ae gene and the bar gene, conferring
Lepidoptera resistance and glufosinate tolerance, respectively, a
customized meganuclease was developed for cleavage in the
flanking genomic sequence of the cry2Ae/bar transgene locus. A
flanking sequence of about 5.2 kb was screened for the presence
of potential useful target sites. Four potential target sites for the
development of a meganuclease were identified: COT-1/2, COT5/6, COT-7/8 and COT-9/10. Southern blot analysis was carried
out to test whether these endonucleases did in vitro cleave
genomic cotton DNA at the intended recognition sequence.
Although Southern blot analysis did show that all four endonucleases cleaved their intended recognition site in vitro, only the
COT-5/6 meganuclease cleaved efficiently its intended ‘chromosomal’ target site in planta. To test the meganucleases for their
potential to cleave their chromosomal target in planta, we
produced stable transformants with each of the four meganucleases and we performed PCRs over the target site. Upon
cleavage of its chromosomal target, NHEJ will result in imprecise
repair and may result in a shift in size of the PCR amplification
product as a result of insertion or deletion of sequences at the
target site. With COT-5/6 transformants, we could observe PCR
amplification products with a size different from the ones
expected for a noncleaved target. In cotton transformations with
the other three meganucleases, only incidental cleavage of the
chromosomal target was observed with COT-7/8 and no cleavage
was observed with COT-1/2 and COT-9/10 based on the size of
the PCR amplification product (data not shown). To evaluate
whether the absence of cleavage of their chromosomal target
was due to an expression problem of the meganuclease, we
tested expression by RNA and protein gel blot analysis for stable
transformants with the COT-1/2 meganuclease. Full-length COT1/2 transcript and protein were observed (data not shown). By
making a fusion protein between COT-1/2 and GFP, we also
showed that the protein was targeted to the nucleus, as intended
(data not shown). We therefore hypothesize that target inaccessibility was the reason for absence of cleavage of the COT-1/2
and likewise also for the COT-9/10 meganuclease.
The COT-5/6 meganuclease was designed to recognize and
cleave the DNA sequence 5′-TAAAATTATTTACAAGTGTTTA-3′,
and the target sequence was found 2072 bp upstream of the
cry2Ae/bar transgene locus (Figures 1 and 2). To develop the
engineered COT-5/6 meganuclease, the DNA-binding characteristics of the natural, homodimeric I-CreI homing endonuclease
were modified by the introduction of a number of amino acid
substitutions into a pair of engineered monomers (designated as
COT-5 and COT-6, Figure 1). A single-chain meganuclease,
comprising this pair of modified I-CreI monomers, fused into a
single polypeptide, was used for the targeted cleavage to allow
the insertion of additional genes at the elite insect control locus.
The COT-5/6 coding sequence was placed under the control of a
Figure 1 The predicted amino acid contacts
between the engineered COT-5 and COT-6
meganuclease monomers and the intended target
site in the cotton genome. Amino acids that
deviate from I-CreI are shown in red. Bases in the
target site that deviate from the wild-type I-CreI
target are shown in yellow. Predicted contacts to
the DNA backbone are in blue.
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
Targeted molecular trait stacking in cotton 935
Figure 2 Homologous recombination (HR)-mediated targeted insertion of hppd and epsps at a pre-existing transgene locus (cry2Ae and bar) in the target
line GHB119. pCV211 is the repair DNA; a 2072 bp downstream and a 1561 bp upstream of the COT-5/6 cleavage site function as the homologous
regions. Stacked events obtained after double-strand break-induced HR between the target GHB119 and the repair DNA pCV211 are expected to have the
structure as shown in the bottom part of the figure. The primer pairs IB617 9 IB527, VDS406 9 IB589 and IB616 9 IB527 are generating a fragment
of 3893, 2731 and 9639 bp, respectively. With primer pair IB616 9 IB527, a PCR fragment should shift from 2992 bp for target GHB119 to 9639 bp for
a correct stacked event. Bar, phosphinothricin acetyltransferase; hppd, 4-hydroxyphenylpyruvate dioxygenase gene; cry2Ae, insecticidal crystal protein of
Bacillus thuringiensis, epsps, 5-enol-pyruvylshikimate-3-phosphate synthase.
35S promoter, and an SV40 nuclear localization signal (NLS) was
fused to the N-terminus of the protein.
Stacking of trait genes by targeted sequence insertion
To allow precise gene addition, a homologous DNA pCV211,
designated ‘repair DNA’, was developed. The repair DNA contains
two herbicide tolerance genes, epsps and hppd genes, flanked by
cotton genomic sequences corresponding to the target locus,
being 1561 bp homology upstream and 2072 bp homology
downstream of the COT-5/6 cleavage site (Figure 2). The coding
sequence of the 4-hydroxyphenylpyruvate dioxygenase gene
(hppd) of Pseudomonas fluorescens (Boudec et al., 2001) was
under the control of a 35S promoter. The coding sequence of a
double mutant enol-pyruvylshikimate-3-phosphate synthase gene
(epsps) of Zea mays (Lebrun et al., 1997) was operably linked to
the promoter region of the histone H4 gene of Arabidopsis
thaliana Ph4a748 (Chabout
e et al., 1987). The epsps gene
confers tolerance to the herbicide glyphosate, whereas the hppd
gene confers tolerance to the hppd inhibitor herbicides, for
example tembotrione. Particle bombardment was used to
co-deliver the COT-5/6 meganuclease coding sequence and the
repair DNA pCV211 into embryogenic callus (EC) of the hemizygous target line GHB119. To test whether simultaneous
expression of the COT-5/6 meganuclease and the delivery of
homologous repair DNA may lead to events with precise targeted
insertion of the herbicide tolerance genes at the intended target
locus, we first selected for EC transformation events on the basis
of tolerance to the herbicide glyphosate. Glyphosate-tolerant EC
events were subsequently subjected to PCR analysis for the
identification of targeted sequence insertion events. The presence
of a PCR product of 3893 bp with primer pair IB527 9 IB617 or a
PCR product of 9640 bp fragment with primer pair
IB527 9 IB616 and the presence of a PCR product of 2731 bp
with primer pair IB589 9 VDS406 are indicative for precisely
stacked gene insertion by two-sided HR. The presence of only a
3893 bp or a 9640 bp and the absence of a 2731 bp or vice versa
are indicative of at least one-sided homologous-mediated insertion.
In total, 27 putative correctly stacked EC events have been
identified using PCR analysis: targeted sequence insertion events
were recovered at a frequency of 1.8% of the 1479 identified
glyR events. To further confirm that the PCR-identified stacked
events were indeed the result of targeted integration of the epsps
and the hppd gene, Southern blot analysis was performed. By
hybridization of DraIII-/StuI-digested DNA with the cry2Ae probe,
we showed that the 4.5-kb fragment in the target line shifted to
an 11-kb fragment in the stacked event (Figure 3). This 5.5-kb
increase in fragment size is corresponding with the 5.5-kb size of
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
936 Kathleen D’Halluin et al.
the hppd and epsps genes showing the feasibility of homologybased targeted insertion of the hppd and epsps genes. By
hybridization with the hppd and the epsps probes, the same
11-kb fragment was obtained (data not shown). This provides
proof of evidence for homology-directed targeted insertion of the
hppd and epsps genes in the cotton genome. In Southern blot
analysis, we also included some samples from glyphosate-tolerant
EC events that did not yield a PCR product with the abovementioned primers, as the absence of a PCR product could also
result from poor DNA quality or large deletions or insertions at the
target site. These latter events yielded only a fragment of 4.5 kb
upon DNA hybridization of DraIII-/StuI-digested DNA with the
cry2Ae probe, showing the absence of targeted insertion of the
herbicide resistance genes in these events (Figure 3a).
Sequence analysis of a 3893-bp or a 2731-bp fragment, PCR
amplified with primer pair IB527 9 IB617 or primer pair
IB589 9 VDS406, respectively, from 18 targeted insertion events,
and spanning the two recombination sites, showed perfect
insertion of epsps and hppd at the target locus up to the
nucleotide (Figure 4).
A remarkable large fraction (~60%–70%) of the stacked
events did not contain additional insertions of hppd or epsps or
COT-5/6 meganuclease elsewhere in the genome. No bands in
addition to the 11-kb fragment were observed after hybridization
of DraIII-/StuI-digested DNA with the hppd or epsps probes
(Figure 3b,c). Also after hybridization with the COT-5/6 meganuclease probe, the majority of the stacked events (80%) did not
show insertions of the meganuclease gene (Figure 3d). This
suggests that most often the meganuclease was only transiently
expressed and did not stably integrate into the genome. In
contrast to our stacked events, the nonstacked events included in
Figure 3 (indicated by a dot) did often show an intense ‘smear’
upon hybridization with the hppd, epsps or COT-5/6 meganuc-
lease probe. This presumably results from multiple-copy insertions
of the repair DNA and the meganuclease in these nonstacked
events, which is typical for particle bombardment–mediated
transformation.
Based on all the results, we can conclude that DSB-induced
perfect two-sided HR-mediated targeted trait gene addition at a
specified target locus, without random additional insertions, is
feasible in cotton.
Inheritance of the stack
To verify the inheritance of the four trait genes as a single genetic
unit, we attempted to produce seeds. As not all tissue culture–
regenerated plants from cotton are fertile, we regenerated
multiple plants from each independent stacked EC event to
increase the chance of getting seeds.
Plant regeneration was obtained from 15 independent stacked
EC events and seven events produced seeds either by selfpollination and/or by pollination with wild-type C312 pollen.
Individual progeny were analysed by real-time PCR (Ingham et al.,
2001) for copy number determination of the four genes of the
stack. Hemizygous and homozygous progeny plants did contain 1
and 2 copies, respectively, of each of the four genes of the gene
stack, while null segregants were WT for all four genes. All
progeny did show inheritance of the gene stack (cry2Ae, bar,
hppd, epsps) in a normal Mendelian manner as a single genetic
locus.
We further evaluated the tolerance to the HPPD inhibitor
herbicide tembotrione (TBT) in the greenhouse on T1 and T2
progeny. The plants displayed some mild bleaching after a TBT
spray treatment (200 g/ha) but recovered completely and produced plenty of seeds. Null segregants bleached out completely
and died off (Figure 5). This shows that the hppd gene was
expressed. We further showed that the other three genes, epsps,
(a)
(b)
(c)
(d)
Figure 3 Southern blot analysis on DraIII-/StuI-digested genomic DNA isolated from embryogenic callus and probed with cry2Ae (a), hppd (b), epsps (c)
and the COT-5/6 meganucleases (d) from events selected on glyphosate. Events designated as stacked events based on PCR genotyping are indicated with
an arrow. Events designated as nonstacked events based on the absence of a PCR product upon PCR genotyping are indicated with a dot. First lane:
molecular mass marker (1 kb+); lanes 1, 2, 4, 5, 7, 8, 10, 12, 14, 15, 17, 19 and 20: stacked events; lanes 3, 6, 9, 11, 13, 16 and 18: nonstacked events;
lane 21: target line GHB119. The fragments corresponding to a 4.5-kb band for a nonstacked event (after hybridization with the cry2Ae probe) and an
11-kb fragment for a stacked event (after hybridization with the cry2Ae, hppd, and epsps probes) are indicated by arrows to the left.
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
Targeted molecular trait stacking in cotton 937
Figure 4 Sequence analysis at the target locus of a stacked event. The epsps and hppd genes are highlighted in green, the flanking homologous
sequences in black, the COT-5/6 recognition sequence in red, the cry2Ae and bar sequence in blue, and the flanking genomic sequence outside the repair
DNA in purple. Target DNA (GHB119) and repair DNA (pCV211) sequences are illustrated at the top of the figure. Primers IB617 9 IB527, VDS406 9 IB589
and IB616 9 IB527, used to amplify the fragments for sequence analysis, are indicated both in Figure 2 and in Figure 4 as on the stacked event at
the bottom. In 18 independent stacked events, the hppd and epsps inserts show junctions as for perfect 2-sided homologous recombination events as
shown in this figure.
Figure 5 Greenhouse evaluation of segregating T1 progeny of a stacked event sprayed with 200 g/ha tembotrione. Pictures were taken 18 days
after the spray treatment. The azygous plants (right) were completely killed 18 days after the herbicide treatment. The transformed plants carrying the
four genes (hppd, epsps, cry2Ae and bar) showed some mild bleaching, with sometimes a mosaic pattern, on one or a few leaves. No difference in
herbicide tolerance performance was observed between homozygous and hemizygous progeny plants.
bar and cry2Ae, were expressed, as 2mEPSPS, PAT/bar and
CRY2A protein were detected by the EnviroLogix QuickStixTM Strip
tests (catalogue number AS 089ST and AS 005LT, EnviroLogix,
Portland, ME). From these observations, it can be concluded that
the four genes were transmitted to the next generation as a
single genetic unit and that all genes of the gene stack were
expressed.
Discussion
The number of trait genes to be transformed into an agronomically relevant crop as cotton could easily add up to a number that
would become unmanageable to be combined in a single variety
through breeding. The breeding effort to introduce different trait
loci into a crop will increase exponentially with the number of
trait loci. Therefore, it may be important to bring several trait
genes into a single genetic locus. This could be done either
through molecular trait stacking by transformation with a vector
containing multiple-trait genes or through targeted molecular
trait stacking by targeted insertion of additional trait genes in an
already existing trait locus. In this study, we have shown the
feasibility of the targeted introduction, through targeted DSB
induction by a customized meganuclease, of additional genes at
an already existing transgenic locus in cotton.
Engineering new GM traits in cotton is particularly challenging.
There is a strong genotype dependence for regeneration through
somatic embryogenesis, with long timelines to produce transformed plants and with fertility problems related to the high level
of somaclonal variation (Kumria et al., 2003). In a difficult
transformable crop as cotton, the development of a good
performing event is a tedious process. As customized nucleases
can be designed for targeted DSB induction, in combination with
the targeted molecular trait stacking concept shown in this study,
this offers the possibility to build on an existing elite event by
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
938 Kathleen D’Halluin et al.
inserting the additional transgenes in close proximity of the initial
transgenes within a genetic distance that would not allow
segregation.
Molecular trait stacking through standard transformation with
vectors containing only two trait genes already requires the
generation of many independent transformants to identify a
single-copy transformant with optimal expression of both transgenes. Tandemly arranged genes may influence each other’s
expression due to transcriptional interference between these
genes (Eszterhas et al., 2002). Using transformation vectors
carrying even more gene cassettes, the probability of selecting
an elite event may decrease as the expression of each gene, and
the efficacy of each trait, will become less predictable with the
increasing number of transgenes (Dietz-Pfeilstetter, 2010; Halpin,
2005). As an alternative for molecular trait stacking by delivering
multiple transgenes simultaneously in one vector, transgenes
could now be added consecutively by targeted integration at an
already identified existing locus as described in this study. The
advantage of this approach is that the integration position can be
chosen such that the presence of genomic sequences between 2
transgenes reduces transcriptional interference and allows for
more predictable expression.
Still, also for targeted molecular trait stacks, it remains
important to evaluate whether stacked trait genes are expressed
as expected to give the desired trait efficacy, whether their
expression remains stable over generations and whether no gene
silencing occurs (Que et al., 2010). It has been shown that crelox–mediated site-specific transgene integration into a specific
chromosome location can produce alleles that express at a
predictable level, as well as alleles that are differentially silenced
while the alleles were identical at the DNA sequence level (Day
et al., 2000). This variation could not be attributed to a position
effect as the site of insertion is the same between different sitespecific integration events. Epigenetic modification of the transgene, such as methylation, may be one of the factors triggering
variation in expression (Day et al., 2000).
It was remarkable to observe that stacked events, as confirmed
by PCR and Southern blot analysis, were two-sided HR events and
showed perfect insertion up to the nucleotide of both epsps and
hppd. Previously, it has been reported that repair of genomic
DSBs in somatic plant cells is frequently initiated by one-sided
invasion of a homologous sequence, even with repair DNA being
homologous to both ends of the break (Puchta, 1998). Puchta’s
results showed that one-sided invasion was the main pathway for
DSB repair in plant cells using T-DNA as matrix. We used
extrachromosomal plasmid DNA as repair matrix and particle
bombardment as delivery system, and we cannot exclude that
these differences have an impact on the mode of repair. Plasmid
DNA enters the plant nucleus as a double-stranded DNA
molecule, whereas Agrobacterium transfers a single-stranded,
protein-coated T-DNA molecule into the nucleus. Although it has
been shown that T-DNA may rapidly turn double-stranded in the
plant nucleus (Tinland et al., 1994), the timing by which it
becomes double-stranded may have an impact on the outcome of
DSB repair. In the end, double-stranded DNA template molecules
are required for repair of a DSB by two-sided HR as described by
the double-strand break repair (DSBR) model for HR (Szostak
et al., 1983). In studies performed with mammalian cells, using
double-stranded plasmid DNA with homology to both ends of the
DSB, also one-sided HR events were found at a high frequency
(Rouet et al., 1994; Smih et al., 1995). This suggests that also the
target tissue, through the prevalence of certain repair machinery,
may stimulate either one- or two-sided HR-mediated repair of
DSBs. In our study, we used EC as target tissue, and it is not
known whether DSBs are repaired by HR differently in somatic
cells from different target tissues. Our observation of highly
frequent, perfect, two-sided HR is of particular interest as this
allows the predictable generation of ‘perfect’ recombination
events.
Of the four meganucleases used in this study, only one
efficiently cleaved its chromosomal target in planta, although
Southern blot analysis of cotton genomic DNA incubated with
purified meganuclease protein revealed that all four meganucleases cleaved their intended chromosomal target sites efficiently
in vitro. This discrepancy between in vitro and in planta results is
likely due to target site accessibility. Chromosomal context and
epigenetic factors play a major role in the cleavage efficiency of
rare-cutting endonucleases and account for strong position
effects (Daboussi et al., 2012). The latter authors show a very
robust correlation between chromatin accessibility and meganuclease efficacy that may also apply to other types of nucleases such
as ZFNs and TALENs.
Again in this study, we made the observation that in the
majority of our precise targeting events, no additional random
integrations of the hppd and epsps genes were observed. We
previously made the same observation in maize upon
HR-mediated targeted sequence insertion at a pre-engineered I-SceI
site (D’Halluin et al., 2008). This is specifically remarkable for DNA
delivery by biolistics, which is usually associated with high copy
number integration of fragmented and rearranged DNA
sequences (Hansen and Chilton, 1996; Travella et al., 2005).
We hypothesize that many of the repair proteins involved in DSB
repair may be recruited to the nuclease-induced targeted DSB
site, hereby reducing the frequency of random integration.
Tools for directed genome modification at any target position
in a genome based on targeted cleavage with designed
nucleases are becoming a reality. While earlier methods used
random mutagenesis and nontargeted methods for genome
engineering, with more recent methods, targeted genome
optimization is within reach. The induction of DSBs at natural
chromosomal sites of choice by custom-made nucleases will
allow targeted genome optimization in all agronomically relevant crops. In addition, this technology will make it possible to
more effectively exploit the ever-increasing knowledge from
systems biology and genomics for both gene discovery and trait
development.
In this study, we show for the first time the feasibility of precise
targeted integration of transgenes at an elite locus in cotton. This
was possible through the combination of targeted DNA cleavage
by nucleases with tailor-made specificities and HR-mediated
repair of the DSB by naturally occurring DNA repair mechanisms.
Targeted molecular trait stacking will facilitate faster and
economical trait introgression.
Experimental procedures
Plasmids
The COT-5/6 meganuclease was developed by Precision BioSciences. To produce the COT-5 and COT-6 monomers, a number
of amino acid changes were introduced in I-CreI (Figure 1). The
two engineered monomers were joined into a single polypeptide
using an 38 amino acid linker as described in the study by Gao
et al., 2010. To generate plasmid pCV193, the single-chain
meganuclease was preceded by an SV40 NLS and cloned
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
Targeted molecular trait stacking in cotton 939
between the cauliflower mosaic virus (CaMV)35S promoter and
the 3’nos terminator.
The repair DNA pCV211 was constructed as follows. A
fragment of 3671 bp consisting of a 1561-bp flanking genomic
DNA sequence upstream of the COT-5/6 cleavage site, a multiple
cloning site (HpaI, StuI, AsisI), and a 2072-bp flanking genomic
DNA sequence downstream of the COT-5/6 cleavage site was
synthesized by Entelechon GmbH (Figure 2). The gene cassette
P35S2-hppd-3′his linked to a Phis-2mepsps-3′his gene cassette
was transferred as a 6628-bp AsisI/HpaI fragment into the
multiple cloning site (MCS) of the synthetic fragment, yielding
the repair DNA construct pCV211 as schematic presented in
Figures 2 and 4.
The vector construction of the repair DNA pCV211, and the
COT-5/6 meganuclease, including sequence listings, is described
in detail in Example 1 of WO2013/026740.
Plasmid DNA preparation
Plasmid DNA was prepared with the GenEluteTM Plasmid Maxiprep
Kit from Sigma, Saint-Louis, MO. An additional DNA precipitation
was performed on the 5 mL eluted DNA with 0.1 volume of 7 M
NH4Ac and 2 volumes of 100% ethanol.
The DNA pellet was dissolved in MQH2O after washing the
DNA pellet with step with 70% ethanol.
Plant material, transformation, repair DNA delivery and
selection of targeted integration events
Embryogenic callus was produced from hypocotyls of 8- to
10-day-old hemizygous seedlings from the elite insect control event
GHB119 (described in 2008/151780, deposit nr ATCC PTA-8398).
GHB119 is a Coker312 transformant comprising the cry2Ae and
the bar genes. Hypocotyl explants were plated on medium 100
for callus induction, which is a slightly modified medium as
described by Trolinder and Goodin (1987) [M&S salts (Murashige
and Skoog, 1962), 100 mg/L myo-inositol, B5 vitamins (Gamborg
et al., 1968), 30 g/L glucose, 0.5 g/L 2-(N-morpholino)ethanesulphonic acid (MES), 0.94 g/L MgCl26H2O, 2 g/L Gelrite, pH
5.8] and incubated under dim light conditions (5–10 lmol/m2/s).
After about 2 months when the wound callus at the cut surface
of the hypocotyls started to show fast proliferation, the further
subculture for the enrichment and maintenance of EC was
performed on medium 100 with 2 g/L active carbon. Induction
and maintenance of EC occur under dim light conditions
(intensity: 1–7 lmol/m2/s; photoperiod: 16-H light/8-H dark) at
26–28 °C. EC was collected 2–3 weeks after subculture, and
~0.7 mL packed cell volume was plated uniformly on top of a
filter paper (WhatmanTM 70 mm diameter, GE Healthcare UK
Limited, Little Chalfont, UK) on 100 Q (=100 medium with 0.2 M
mannitol and 0.2 M sorbitol) for 4–6 h prior to bombardment.
After preplasmolysis on 100Q substrate, the EC was bombarded
with plasmid DNAs pCV211and pCV193 (0.5–0.75 pmol of each
DNA) using the biolistic PDS-1000/He particle delivery system
(Bio-Rad, Bio-Rad Laboratories S.A./N.V., Nazareth Eke, Belgium).
The particle bombardment parameters were as follows: diameter
gold particles, 0.3-3 lm; target distance, 9 cm; bombardment
pressure, 9301.5 k Pa; gap distance, 6.4 mm; and macrocarrier
flight distance, 11 mm. Immediately after bombardment, the
filters were transferred on medium 100 without glyphosate. After
2–4 days on nonselective substrate under dim light conditions at
26–28 °C, the filters were transferred onto medium 100 with
1 mM glyphosate. After about 2–3 weeks, proliferating calli were
selected from the filters and further subcultured as small piles
onto selective medium with 1 mM glyphosate. A molecular screen
based on PCR analysis for the identification of candidate targeted
modification events was performed at the level of transformed EC
selected on substrate with 1 mM glyphosate. Plant regeneration
was initiated from the targeted modification events by plating EC
on medium 104 (=medium 100 + 1 g/L KNO3) with 2 g/L active
carbon and 1 mM glyphosate under light conditions (intensity:
40–70 lmol/m2/s; photoperiod: 16-H light/8-H dark) at
26–28 °C. After about 1 month, individual embryos of about
0.5–1 cm were transferred on top of a filter paper on M104
medium with active carbon and 1 mM glyphosate. Further wellgerminating embryos were transferred onto nonselective germination medium 702 [Stewarts salts and vitamins (Stewart and
Hsu, 1977), sucrose 5 g/L, MgCl26H2O 0.71 g/L, Gelrite 1.5 g/L,
plant agar 5 g/L, pH 6.8]. After 1–2 months, the further developing
embryos were transferred onto medium 700 [Stewarts salts + vitamins, sucrose 20 g/L, MgCl26H2O 0.47 g/L, Gelrite 1 g/L, plant agar
2.25 g/L, pH 6.8.].
Nucleic acid procedures
Southern blot analysis
Genomic DNA was extracted from cotton callus or leaf tissue
using the DNeasy Plant Mini Kit from Qiagen©, Qiagen GmbH,
Hilden, Germany. The DNA was digested, separated by electrophoresis on a 1% agarose gel, transferred to nylon membranes
and hybridized with 32P-radioactive probes following standard
procedures (Sambrook and Russell, 2001).
PCR analysis
PCR was performed on 100 ng of genomic DNA extracted from
cotton calli using a sbeadex kit-based DNA extraction method
from LGC genomics (LGC Limited, Teddington, UK).
For PCR products generated with primer pairs IB527 9 IB617
and IB589 9 VDS406, the Expand enzyme mix from Roche was
used with the following cycling parameters: 4-min denaturation
at 94 °C followed by five cycles of 1 min at 94 °C, 1 min at
57 °C, 4 min at 68 °C, followed by 25 cycles of 15 s at 94 °C,
45 s at 60 °C and 4 min at 68 °C (extended with 5 s per cycle)
and a final elongation step of 10 min at 68 °C in a 50 lL mixture.
For PCR products generated with primer pair IB527 9 IB616, the
Elongase Enzyme Mix from Invitrogen (Life Technologies,
Carlsbad, CA) was used in a final MgSO4 concentration of
2 mM with the following cycling parameters: 2 min at 94 °C
followed by 35 cycles of 30 s at 94 °C, 30 s at 58 °C and 9 min
at 68 °C and a final elongation step of 7 min at 68 °C.
IB527: TCCAGTACTAAAATCCAGATCATGC
IB616: TGATGCGATGAATAACGTAGTG
IB617: CCCTGGCTTGCAGTTGGTCC
IB589: CGACAGCCATCAGAGACGTG
VDS406: TATAAATGCCGGCGCGTAGC
Sequence analysis
Sequence analysis was performed on a 9640-bp, a 3893-bp and
a 2371-bp fragments generated with primer pairs
IB527 9 IB616, IB527 9 IB617 and IB589 9 VDS406, respectively. The 9640-bp fragment is covering the inserted hppd and
epsps cassettes, and 1561-bp and 2072-bp genomic flanking
sequence upstream and downstream of the COT-5/6 cleavage
site, respectively, and 50 bp of the 3′end of the cry2Ae
transgene locus in the GHB119 target line. The 3893-bp and
the 2371-bp fragments are covering the recombination sites
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
940 Kathleen D’Halluin et al.
downstream and upstream of the COT-5/6 target site, respectively (Figure 2).
Acknowledgements
Kristine Reynaert, Guillermo Aguacil Ruiz, Christoph Van Hese,
Wendy Walraet and Stefanie Van Laere are kindly acknowledged
for follow up of the plant material in the greenhouse. We
acknowledge Jeff Smith and Michael Nicholson (Precision
BioSciences) for their contribution to the development of the
COT meganucleases. We are grateful to Geert Hesters for
excellent tissue culture support. We thank Veerle Habex for
providing the target flanking genomic sequences.
References
Arnould, S., Perez, C., Cabaniols, J-P., Smith, J., Gouble, A., Grizot, S., Epinat, J-C.,
Duclert, A., Duchateau, P. and P^aques, F. (2007) Engineered I-CreI derivatives
cleaving sequences from the human XPC gene can induce highly efficient
gene correction in mammalian cells. J. Mol. Biol. 371, 49–65.
Bogdanove, A. and Voytas, D. (2011) TAL effectors: customizable proteins for
DNA targeting. Science, 333, 1843–1846.
Boudec, P., Rodgers, M., Dumas, F., Sailland, A. and Bourdon, H. (2001)
Mutated hydroxyphenylpyruvate dioxygenase, DNA sequence and isolation of
plants which contain such a gene and which are tolerant to herbicides. US
Patent US6245968B1, France.
Cai, C., Doyon, Y., Ainley, W., Miller, J., Dekelver, R., Moehle, E., Rock, J.,
Lee, Y., Garrison, R., Schulenberg, L., Blue, R., Worden, A., Baker, L., Faraji,
F., Zhang, L., Holmes, M., Rebar, E., Collingwood, T., Rubin-Wilson, B. and
Gregory, P. (2009) Targeted transgene integration in plant cells using
designed zinc finger nucleases. Plant Mol. Biol. 69, 699–709.
Carroll, D. (2011) Genome engineering with zinc-finger nucleases. Genetics,
188, 773–782.
Cermak, T., Doyle, E., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.,
Somia, N., Bogdanove, A. and Voytas, D. (2011) Efficient design and
assembly of custom TALEN and other TAL effector-based constructs for DNA
targeting. Nucleic Acids Res. 39, e82.
Chabout
e, N., Chaubet, N., Philipps, G., Ehling, M. and Gigot. (1987) Genomic
organization and nucleotide sequences of two histone H3 and two histone
H3 genes of Arabidopsis thaliana. Plant Mol. Biol. 8, 179–191.
Christian, M., Cermak, T., Doyle, E., Schmidt, C., Zhang, F., Hummel, A.,
Bogdanove, A. and Voytas, D. (2010) Targeting DNA double-strand breaks
with TAL effector nucleases. Genetics, 186, 757–761.
Curtin, S., Zhang, F., Sander, J., Haun, W., Starker, C., Baltes, N., Reyon, D.,
Dahlborg, E., Goodwin, M., Coffman, A., Dobbs, D., Joung, K., Voytas, D.
and Stupar, M. (2011) Targeted mutagenesis of duplicated genes in soybean
with zinc-finger nucleases. Plant Physiol. 156, 466–473.
Daboussi, F., Zaslavskiy, M., Poirot, L., Loperfido, M., Gouble, A., Guyot, V.,
^te, F., Dupuy, A.,
Leduc, S., Galetto, R., Grizot, S., Oficjalska, D., Perez, C., Delaco
Chion-Sotinel, I., Le Clerre, D., Lebuhotel, C., Danos, O., Lemaire, F.,
Oussedik, K., C
edrone, F., Epinat, J., Smith, J., Yanez-Munoz, R., Dickson, G.,
Popplewell, L., Koo, T., VandenDriessche, T., Chuah, M., Duclert, A.,
Duchateau, P. and P^aques, F. (2012) Chromosomal context and epigenetic
mechanisms control the efficacy of genome editing by rare-cutting designer
endonucleases. Nucleic Acid Res. 40, 6367–6379.
Day, C., Lee, E., Kobayashi, J., Holappa, L., Albert, A. and Ow, D. (2000)
Transgene integration into the same chromosome location can produce
alleles that express at a predictable level, or alleles that are differentially
silenced. Genes Dev. 14, 2869–2880.
De Pater, S., Pinas, J., Hooykaas, P. and van der Zaal, B. (2013) ZFN-mediated
gene targeting of the Arabidopsis protoporphyrinogen oxidase through
Agrobacterium-mediated floral dip transformation. Plant Biotechnol. J. 11,
510–515.
D’Halluin, K., Vanderstraeten, C., Stals, E., Cornelissen, M. and Ruiter, R. (2008)
Homologous recombination: a basis for targeted genome optimization in
crop species such as maize. Plant Biotechnol. J. 6, 93–102.
Dietz-Pfeilstetter, A. (2010) Stability of transgene expression as a challenge for
genetic engineering. Plant Sci. 179, 164–167.
Epinat, J-C., Arnould, S., Chames, P., Rochaix, P., Desfontaines, D., Puzin, C.,
Patin, A., Zanghellini, A., P^aques, F. and Lacroix, E. (2003) A novel engineered
meganuclease induces homologous recombination in yeast and mammalian
cells. Nucleic Acids Res. 31, 2952–2962.
Eszterhas, S., Bouhassira, E., Martin, D. and Fiering, S. (2002) Transcriptional
interference by independently regulated genes occurs in any relative
arrangement of the genes and is influenced by chromosomal integration
position. Mol. Cell. Biol. 22, 469–470.
Gamborg, O., Miller, R. and Ojima, K. (1968) Nutrient requirements of
suspension cultures of soybean root cells. Exp. Cell. Res. 50, 151–158.
Gao, H., Smith, J., Yang, M., Jones, S., Djukanovic, V., Nicholson, M., West, A.,
Bidney, D., Falco, C., Jantz, D. and Lyznik, A. (2010) Heritable targeted
mutagenesis in maize using a designed endonuclease. Plant J. 61, 176–187.
Halpin, C. (2005) Gene stacking in transgenic plants-the challenge for 21st plant
biotechnology. Plant Biotechnol. J. 3, 141–155.
Hansen, G. and Chilton, M-D. (1996) Agrolistic transformation of plant cells:
integration of T-strands generated in planta. Proc. Natl Acad. Sci. USA, 93,
14978–14983.
Hwang, W., Fu, Y., Reyon, D., Maeder, M., Tsai, S., Sander, J., Peterson, R.,
Yeh, J.R. and Young, K. (2013) Efficient genome editing in zebrafish using a
CRISPR-Cas system. Nat. Biotechnol. 31, 227–229.
Ingham, D.J., Beer, S., Money, S. and Hansen, G. (2001) Quantitative real-time
PCR assay for determining transgene copy number in transformed plants.
Biotechniques, 31, 132–140.
James, C. (2011) ISAAA report on global status of biotech/GM crops.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. and Charpentier, E.
(2012) A programmable dual-RNA-guided DNA endonuclease in adaptive
bacterial immunity. Science, 337, 816–821.
Kumria, R., Leelavathi, S., Bhatnagar, R. and Reddy, V. (2003) Regeneration and
genetic transformation of cotton: present status and future perspectives.
Plant Tissue Cult. 13, 211–225.
Lebrun, M., Sailland, A. Freyssinet, G. and Degryse, E. (1997) Mutated
5-enol-pyruvylshikimate-3-phosphate synthase, gene coding for said protein
and transformed plants containing said gene. WO1997004103 France.
Li, T., Liu, B., Spalding, M., Weeks, D. and Yang, B. (2012) High-efficiency
TALEN-based gene editing produces disease resistant rice. Nat. Biotechnol.
30, 390–392.
Lloyd, A., Plaisier, C., Carroll, D. and Drews, G. (2005) Targeted mutagenesis using
zinc-finger nucleases in Arabidopsis. Proc. Natl Acad. Sci. USA, 102, 2232–
2237.
Maeder, M., Thibodeau-Beganny, S., Osiak, A., Wright, D., Anthony, R.,
Eichtinger, M., Jiang, T., Foley, J., Winfrey, R., Townsend, J., Unger-Wallace,
€bel, C., Dassie, J.,
€ller-Lerch, F., Fu, F., Pearlberg, J., Go
E., Sander, J., Mu
Pruett-Miller, S., Porteus, M., Sgroi, D., Iafrate, A., Dobbs, D., McCray, P.,
Cathomen, T., Voytas, D. and Joung, J. (2008) Rapid ‘open-source’
engineering of customized zinc-finger nucleases for highly efficient gene
modification. Mol. Cell, 31, 294–301.
Mahfouz, M., Li, L., Shamimuzzaman, M., Wibowo, A., Fang, X. and Zhu, J.
(2011) De novo-engineered transcription activator-like effector (TALE) hybrid
nuclease with novel DNA binding specificity creates double-strand breaks.
Proc. Natl Acad. Sci. USA, 93, 5055–5060.
Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and
bioassays with tobacco tissue culture. Physiol. Plant. 15, 473–497.
Porteus, M. and Baltimore, D. (2003) Chimeric nucleases stimulate gene
targeting in human cells. Science, 300, 763.
Puchta, H. (1998) Repair of double-strand breaks in somatic plant cells by
one-sided invasion of homologous sequences. Plant J. 13, 331–339.
Que, Q., Chilton, M-D., de Fontes, C., He, C., Nuccio, M., Zhu, T., Wu, Y.,
Chen, J. and Shi, L. (2010) Trait stacking in transgenic crops: challenges and
opportunities. GM Crops, 1, 1–10.
Rouet, P., Smih, F. and Jasin, M. (1994) Introduction of double-strand breaks
into the genome of mouse cells by expression of a rare-cutting endonuclease.
Mol. Cell. Biol. 23, 5012–5019.
Sambrook, J. and Russell, D. (2001) Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941
Targeted molecular trait stacking in cotton 941
Shukla, V., Doyon, Y., Miller, J., DeKelver, R., Moehle, E., Worden, S., Mitchell,
J., Arnold, N., Gopalan, S., Meng, X., Choi, V., Rock, J., Wu, Y-Y., Katibah,
G., Zhifang, G., McCaskill, D., Simpson, M., Blakeslee, B., Greenwalt, S.,
Butler, H., Hinkley, S., Zhang, L., Rebar, E., Gregory, P. and Urnov, D. (2009)
Precise genome modification in the crop species Zea mays using zinc-finger
nucleases. Nature, 459, 437–441.
Smih, F., Rouet, P., Romanienko, P.J. and Jasin, M. (1995) Double-strand breaks
at the target locus stimulate gene targeting in embryonic stem cells. Nucleic
Acids Res. 14, 8096–8106.
Smith, J., Grizot, S., Arnould, S., Duclert, A., Epinat, J-C., Chames, P., Prieto, J.,
Redondo, P., Blanco, F., Bravo, J., Montoya, G., P^aques, F. and Duchateau, P.
(2006) A combinatorial approach to create artificial homing endonucleases
cleaving chosen sequences. Nucleic Acids Res. 34, e149. doi:10.1093/nar/
gkl720.
Stewart, J. and Hsu, C. (1977) In ovulo embryog culture and seedling
development of cotton (Gossypium hirsutum L.). Planta, 137, 113–117.
Szostak, J.W., Orr-Weaver, T.L., Rothstein, R.J. and Stahl, F.W. (1983) The
double-strand break repair model of recombination. Cell, 33, 25–35.
Taylor, G., Petrucci, L., Lambert, A., Baxter, S., Jarjour, J. and Stoddard, B.
(2012) LAHEDES: the LAGLIDADG homing endonuclease database and
engineering server. Nucleic Acids Res. 40, W110–W116.
Thompson, A., Yuan, X., Kudlicki, W. and Herrin, D. (1992) Cleavage and
recognition pattern of a double-strand-specific endonuclease (I-CreI) encoded
by the chloroplast 23S rRNA intron of Chlamydomonas reinhardtii. Gene,
119, 247–251.
Tinland, B., Hohn, B. and Puchta, H. (1994) Agrobacterium tumefaciens
transfers single-stranded transfer DNA (T-DANN) into the plant cell nucleus.
Proc. Natl Acad. Sci. USA, 91, 8000–8004.
Townsend, J., Wright, D., Winfrey, R., Fu, F., Maeder, M., Joung, J. and Voytas,
D. (2009) High-frequency modification of plant genes using engineered
zinc-finger nucleases. Nature, 459, 442–445.
Travella, S., Ross, M., Harden, J., Everett, C., Snape, J. and Harwoord, W. (2005)
A comparison of transgenic barley lines produced by particle bombardment
and Agrobacterium-mediated techniques. Plant Cell Rep. 23, 780–789.
Trolinder, L. and Goodin, J. (1987) Somatic embryogenesis and plant
regeneration in cotton (Gossypium hirsute L.). Plant Cell Rep. 6, 231–234.
Wright, D., Townsend, J., Winfrey, R., Irwin, P., Rajagopal, J., Lonosky, P., Hall, B.,
Jondle, M. and Voytas, D. (2005) High-frequency homologous recombination
in plants mediated by zinc-finger nucleases. Plant J. 44, 693–705.
Zhang, Y., Zhang, F., Li, X., Baller, J., Qi, Y., Starker, C., Bogdanove, A. and
Voytas, D. (2013) TALENs enable efficient plant genome engineering. Plant
Physiol. 161, 20–27.
ª 2013 Bayer CropScience N.V. Plant Biotechnology Journal published by Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal,
11, 933–941