JMMB
Symposium
Penetration
of phage
λ DNA 361
J. Mol. Microbiol. Biotechnol. (2001) 3(3): 361-370.
Facilitation of Bacteriophage Lambda DNA Injection by
Inner Membrane Proteins of the Bacterial Phosphoenolpyruvate:Carbohydrate Phosphotransferase System (PTS)
Margarita Esquinas-Rychen and Bernhard Erni*
Introduction
Departement für Chemie und Biochemie, Freiestrasse 3,
Universität Bern, CH-3012, Bern, Switzerland.
Transport of nucleic acids across lipid bilayers is the least
understood of all membrane transport processes. It occurs
whenever genetic information is taken up by a cell from
the environment, exchanged between cells or transferred
from a virus to the host. Examples are the uptake of DNA
by naturally competent bacteria such as pneumococci and
haemophilus, the conjugative transfer of DNA between
bacterial cells, the injection of DNA from bacteriophages
into the bacterial host (for reviews see Dreiseikelmann,
1994 and Sabelnikov, 1994) and the import of nuclear
encoded tRNAs into the mitochondrium (Hauser and
Schneider, 1995; Schneider et al., 1994). Spreading
between cells of RNAi, the sequence-specific signal of posttranscritptional gene silencing, might also require
translocation of nucleic acids across membranes (Sharp,
1999). Double stranded B-DNA has a diameter of 20 Å
which is approximately equal to half the width of a lipid
bilayer, is highly elongated and has a high density of
negative charges. These properties necessitate molecular
mechanisms of transport different from those involved in
the translocation of polar low molecular weight solutes, of
polypeptide chains (Schatz and Dobberstein, 1996), of
oligosaccharides (Suzuki et al., 1998) and of long-chain
fatty acids (DiRusso and Black, 1999). Injection of
bacteriophage DNA into the bacterial host provides one
model system to study DNA transport. The process has
been investigated with bacteriophage T5 (Boulanger et al.,
1996; Lambert et al., 1998; Plancon et al., 1997),
bacteriophage T7 (Garcia and Molineux, 1995), and
bacteriophage λ and a number of the involved phage and
host genes have been identified.
Adsorption of phage λ to the cell occurs through
specific binding between the viral tail fiber protein p J
(Katsura, 1983) and the outer membrane porin LamB (Boos
and Shuman, 1998; Ferenci, 1989). LamB, a component
of the transport system for maltose and maltodextrins, is a
trimer of identical subunits each consisting of an 18stranded pore forming β-barrel (Schirmer et al., 1995). Each
subunit has a water filled pore of 5-6 Å diameter which is
selectively permeable for maltose, maltodextrins and to a
lesser extent to other small hydrophilic molecules. In view
of the narrow diameter and the rigid structure it is unlikely
that the double stranded DNA passes through LamB. LamB
is, however, important for triggering phage DNA ejection.
Solubilized LamB of E coli K-12 forms a reversible complex
with λ, which becomes irreversible and from which phage
DNA is ejected upon the addition of chloroform (RandallHazelbauer and Schwartz, 1973). LamB variants exist
which release DNA in the absence of organic solvents
(Roessner and Ihler, 1987), and which when incorporated
Abstract
Infection of Escherichia coli by bacteriophage lambda
depends on two membrane protein complexes: (i)
maltoporin (LamB) in the outer membrane for
adsorption and (ii) the IICMan-IIDMan complex of the
mannose transporter in the inner membrane for DNA
penetration. IICMan and IIDMan are components of the
phosphoenolpyruvate: sugar phosphotransferase
system (PTS) which together with the IIABMan subunit
mediate transport and phosphorylation of sugars. To
identify structural determinants important for
penetration of lambda DNA, the homologous IIC-IID
complexes of E. coli, K. pneumoniae and B. subtilis,
and chimeric complexes between the IIC and IID were
characterized. All three complexes support sugar
transport in E. coli. Only IIC-IID of E. coli and B. subtilis
also support bacteriophage lambda infection. The six
chimeric complexes had lost transport activity, but
three containing IIC of E. coli or B. subtilis continue to
support bacteriophage lambda infection. Complexes
containing IIC Man and fusion proteins between
truncated IID Man and alkaline phosphatase or βgalactosidase support penetration of lambda DNA if
less than 100 residues are missing from the C-terminus
of IIDMan. Truncation of IICMan renders the complex
unstable. Taken together, these results suggest, that
IIC is the major specificity determinant for lambda
infection but that the IIC subunit is stably expressed
only in a complex with the IID subunit. Lambda DNA in
transit across the periplasmic space, but not
transforming plasmid DNA, is inaccessible to the nonspecific nuclease NucA of Anabaena sp. targeted to
the periplasmic space either in soluble form or as a
fusion protein to the C-terminus of IIDMan.
Abbreviations:
PTS, phosphoenolpyruvate:sugar phosphotransferase system; IIA, IIB, IIC,
IID, protein subunits of transporters belonging to the mannose family of the
PTS; IPTG, isopropyl-β-D-thiogalactopyranoside
*For correspondence. Email [email protected]; Tel. ++41 (0)31/631 43 46;
Fax. ++41 (0)31/631 48 87.
© 2001 Horizon Scientific Press
Further Reading
Caister Academic Press is a leading academic publisher of
advanced texts in microbiology, molecular biology and medical
research.
Full details of all our publications at caister.com
• MALDI-TOF Mass Spectrometry in Microbiology
Edited by: M Kostrzewa, S Schubert (2016)
www.caister.com/malditof
• Aspergillus and Penicillium in the Post-genomic Era
Edited by: RP Vries, IB Gelber, MR Andersen (2016)
www.caister.com/aspergillus2
• The Bacteriocins: Current Knowledge and Future Prospects
Edited by: RL Dorit, SM Roy, MA Riley (2016)
www.caister.com/bacteriocins
• Omics in Plant Disease Resistance
Edited by: V Bhadauria (2016)
www.caister.com/opdr
• Acidophiles: Life in Extremely Acidic Environments
Edited by: R Quatrini, DB Johnson (2016)
www.caister.com/acidophiles
• Climate Change and Microbial Ecology: Current Research
and Future Trends
Edited by: J Marxsen (2016)
www.caister.com/climate
• Biofilms in Bioremediation: Current Research and Emerging
Technologies
Edited by: G Lear (2016)
www.caister.com/biorem
• Flow Cytometry in Microbiology: Technology and Applications
Edited by: MG Wilkinson (2015)
www.caister.com/flow
• Microalgae: Current Research and Applications
• Probiotics and Prebiotics: Current Research and Future Trends
Edited by: MN Tsaloglou (2016)
www.caister.com/microalgae
Edited by: K Venema, AP Carmo (2015)
www.caister.com/probiotics
• Gas Plasma Sterilization in Microbiology: Theory,
Applications, Pitfalls and New Perspectives
Edited by: H Shintani, A Sakudo (2016)
www.caister.com/gasplasma
Edited by: BP Chadwick (2015)
www.caister.com/epigenetics2015
• Virus Evolution: Current Research and Future Directions
Edited by: SC Weaver, M Denison, M Roossinck, et al. (2016)
www.caister.com/virusevol
• Arboviruses: Molecular Biology, Evolution and Control
Edited by: N Vasilakis, DJ Gubler (2016)
www.caister.com/arbo
Edited by: WD Picking, WL Picking (2016)
www.caister.com/shigella
Edited by: S Mahalingam, L Herrero, B Herring (2016)
www.caister.com/alpha
• Thermophilic Microorganisms
Edited by: F Li (2015)
www.caister.com/thermophile
Biotechnological Applications
Edited by: A Burkovski (2015)
www.caister.com/cory2
• Advanced Vaccine Research Methods for the Decade of
Vaccines
• Antifungals: From Genomics to Resistance and the Development of Novel
• Aquatic Biofilms: Ecology, Water Quality and Wastewater
• Alphaviruses: Current Biology
• Corynebacterium glutamicum: From Systems Biology to
Edited by: F Bagnoli, R Rappuoli (2015)
www.caister.com/vaccines
• Shigella: Molecular and Cellular Biology
Treatment
Edited by: AM Romaní, H Guasch, MD Balaguer (2016)
www.caister.com/aquaticbiofilms
• Epigenetics: Current Research and Emerging Trends
Agents
Edited by: AT Coste, P Vandeputte (2015)
www.caister.com/antifungals
• Bacteria-Plant Interactions: Advanced Research and Future Trends
Edited by: J Murillo, BA Vinatzer, RW Jackson, et al. (2015)
www.caister.com/bacteria-plant
• Aeromonas
Edited by: J Graf (2015)
www.caister.com/aeromonas
• Antibiotics: Current Innovations and Future Trends
Edited by: S Sánchez, AL Demain (2015)
www.caister.com/antibiotics
• Leishmania: Current Biology and Control
Edited by: S Adak, R Datta (2015)
www.caister.com/leish2
• Acanthamoeba: Biology and Pathogenesis (2nd edition)
Author: NA Khan (2015)
www.caister.com/acanthamoeba2
• Microarrays: Current Technology, Innovations and Applications
Edited by: Z He (2014)
www.caister.com/microarrays2
• Metagenomics of the Microbial Nitrogen Cycle: Theory, Methods
and Applications
Edited by: D Marco (2014)
www.caister.com/n2
Order from caister.com/order
362 Esquinas-Rychen and Erni
into phospholipid vesicles, mediate injection of λ DNA
across the vesicle bilayer (Roessner and Ihler, 1986;
Roessner et al., 1983). With this system DNA could be
entrapped within liposomes by ejection from bacteriophage
λ (Roessner and Ihler, 1984). Ejection of λ DNA is complete
within 1 minute when measured as increase of
fluoresecence in ethidium bromide loaded proteoliposomes
(Novick and Baldeschwieler, 1988). However,
transmembrane channels are formed only by intact phage
particles, but neither by purified tails nor by empty ghosts
suggesting that λ DNA and/or a pilot protein in addition to
tail proteins are necessary for formation and/or opening of
channels (Roessner and Ihler, 1986). Much less is known
of how λ DNA is transferred into the bacterium. Triggering
of DNA injection from λ preadsorbed to E. coli was shown
to be immediate at 37°C, to occur after a lag of 10 min at
23°C and not to occur at 15°C (Mackay and Bode, 1976).
It is not known, whether phage λ DNA diffuses across the
periplasmic space or is directly transferred out of the tail
into the cytoplasm. The observation that λ DNA becomes
DNase sensitive promptly after the injection into isolated
E. coli envelope-membrane complexes (Zgaga et al., 1973)
could indicate that λ DNA after adsorption first enters the
periplasmic compartment.
Whereas LamB mediates interaction between phage
λ and the outer membrane, two proteins, the IICMan and
IIDMan subunits of the mannose transporter, facilitate
penetration of λ DNA across the inner membrane. In
experiments designed to search for host-specific restriction
properties, Scandella and Arber (Scandella and Arber,
1974) found E. coli mutants which were insensitive to low
doses of λ vir but sensitive to high concentrations.
Adsorption of phage λ to these mutants was normal, but
the phage DNA remained inside the phage head and
bacteria therefore were not killed. These mutants were
termed pel- (penetration of lambda, (Elliott and Arber, 1978))
and the pel locus was found to be isoallelic with ptsM
(manXYZ) the locus for the mannose specific transporter
of the phosphoenolpyruvate:sugar phosphotransferase
system (PTS). The pel mutation was phage specific, it
inhibited infection by phages λ, 434 and 82 but not by the
closely related phage Φ80 or the unrelated phages T4, P1
and M13. Resistance of pel mutants was leaky however,
the efficiency of plating of λvir on these mutants was 10-5
and plaques were small and irregular. The resistance of
the pel mutants was much more severe to phages with
genomes smaller than wild-type, and resistance could be
overcome by increasing the length of the λ genome by
DNA insertions or duplications (Emmons et al., 1975;
Katsura, 1983). It could also be overcome by phages
termed λhp (host range for pel) with mutations in the genes
V and H (Scandella and Arber, 1976). V specifies the major
tail protein pV which forms the tail tube, a stack of 32 discs
composed of pV hexamers. Protein pH is located at the
distal tail cone and is proteolytically cleaved into a 78 kDa
polypeptide called pH* after assembly of the tail tube is
completed. Protein p H is part of the initiator for tail
assembly, and has been suggested to act as a template to
determine the length of the tail. After cleavage, pH* might
assume a constrained conformation providing the energy
to drive protein reorganisation during DNA injection
(reviewed in (Katsura, 1990)). Because pH* was found to
be accessible to exogenous proteases in free
bacteriophages but protected in complexes with liposomes,
it was also suggested to associate with the membrane to
form a hole for DNA entry (Roessner and Ihler, 1984). It is
not known whether this putative pore crosses the outer
membrane only or whether it is “portable” and can be
transferred/extended to the inner membrane, too.
The mannose transporter complex, mutations of which
are responsible for the above described Pel phenotype,
consists of three subunits, IIABMan, IIC Man and IIDMan
(Figure 1A) which together mediate translocation and
phosphorylation of mannose and related sugars. IIABMan
(323 residues) is a two-domain hydrophilic subunit which
contains the two phosphorylation sites, necessary for
transport and phosphorylation of mannose. IICMan (266
residues) and IIDMan (283 residues) are membrane subunits
which span the membrane six and one times, respectively
(Huber and Erni, 1996). The IICMan-IIDMan subcomplex is
sufficient for penetration of λ DNA (Erni et al., 1987). The
mannose transporter complex of E. coli belongs to a large
family of homologous PTS transporters which includes the
transporters for fructose of Bacillus subtilis (Martin
Verstraete et al., 1990), for sorbose of Klebsiella
pneumoniae (Wehmeier and Lengeler, 1994), for glucose
and mannose of Vibrio furnissii (Bouma and Roseman,
1996) and for glucose and mannose of Lactobacillus
curvatus (Veyrat et al., 1996). None of the other IIC-IID
expressing bacteria are infected by bacteriophage λ, most
likely because they lack the LamB receptor. The transporter
of B. subtilis supports sugar transport when expressed in
E. coli and confers λ sensitivity to pel hosts, indicating that
it is expressed in a functional form (Martin-Verstraete et
al., 1996).
In order to identify structural determinants that might
be important for IICMan-IIDMan mediated penetration of λ
DNA, homologous complexes of K. pneumoniae and B.
subtilis, fusion proteins between truncated IIDMan and
alkaline phosphatase or β-galactosidase (Figure 1B,C)
(Huber and Erni, 1996) and chimeric complexes between
the IIC and IID of different origins (Figure 1D) were
characterized, and the accessibility of λ DNA in transit
Figure 1. Schematic drawing of the different IIC-IID complexes used to
characterize penetration of phage λ DNA. (A) Wild-type (IIAB)2-IIC-(IID)2
complex. The cytoplasmic and the two membrane subunits are necessary
for transport and phosphorylation of sugars. Only the transmembrane
subunits are necessary to facilitate penetration of phage λ DNA. (B) Fusion
protein between IID and alkaline phosphatase. (C) Fusion protein between
truncated IID and β-galactosidase. (D) Chimeric protein between IIC and
IID of different origins. (E) Fusion protein between IID and NucA. (F) NucA
secreted and proteolytically processed from OmpA-NucA precursor. LamB,
maltoporin; OM, outer membrane; IM inner membrane; PP, periplasmic
space; CP, cytoplasm.
Penetration of phage λ DNA 363
Figure 2. LamB, IICMan-IID Man and mannose dependence of λ DNA
penetration. Bacteria lysogenic for P1 were grown under the indicated
conditions and infected with [ 3H]thymidine labelled phage λ. The extent of
DNA penetration was measured as [ 3H]DNA degradation by EcoP1 (cold
PCA soluble counts in percent of total DNA). (A) E. coli strain WA2127
transformed with pJFLPM (solid symbols) encoding the mannose transporter
complex, or with the control plasmid pJF119EH (open symbols) was grown
in LB medium supplemented with 0.4% maltose (for induction of LamB,
circles) or 0.4% glucose (for repression of LamB, squares). (B)
WA2127(pJFLPM) grown in LB medium supplemented with 0.4% maltose
were infected with λvir in the presence of 0 mM (circles), 0.5 mM (square),
5 mM (triangle up) and 50 mM (triangle down) mannose. (C, D) Temperature
dependence of λ DNA penetration. WA2127(pJFLPM) was grown at 10°C
(C, open symbols) and 30°C (D, solid symbols) in LB medium supplemented
with 0.4% maltose. Washed cells were preincubated for 5 min at the
indicated temperature (30°C (circle), 25°C (star), 20°C (square), 15°C
(diamond), 10°C (tickmark)) and then infected with [ 3H]thymidine labelled
phage λ at the preincubation temperature.
across the periplasmic space was probed with a
periplasmatic nuclease (Figure 1E,F). Phage λ DNA was
inaccessible, whereas transforming plasmid DNA was
inactivated.
Results
DNA Penetration Depends on IICMan-IIDMan and is not
Inhibited by the Presence of Mannose
Infection of E. coli by bacteriophage λ depends on the
presence of LamB in the outer and IICMan-IIDMan in the
inner membrane whereas the role of membrane lipids is
unknown. DNA penetration was measured with
[ 3 H]thymidine labelled bacteriophage λ and E. coli
lysogenized with bacteriophage P1 (Simmon and
Lederberg, 1972). Time course and extent of DNA
penetration was measured as perchloric acid soluble 3H
counts. DNA penetration occurs only when the expression
of LamB is induced with maltose but not when it is
Figure 3. Plaque morphology of λvir on E. coli expressing heterologous
and chimeric IIC-IID complexes. λvir was titrated on host WA2127∆G∆F
(not lysogenic for P1) transformed with plasmids encoding the different
wild-type (diagonal) and chimeric IIC-IID complexes (off diagonal).
Photographs (50 x magnification) of λvir plaques representative for the
different hosts are shown. The efficiency of plating (titer of λvir in percent of
the titer on E. coli IICMan-IIDMan (top left) is indicated in each panel. The
bottom panel shows the very small plaques of λvir on WA2127∆G∆F
transformed with pJF119EH (no IIC-IID). Abbreviations: E.c. E. coli; B.s. B.
subtilis; K.p., K. pneumoniae).
repressed by the presence of glucose. Similarly, DNA
penetration depends on the presence of IICMan-IIDMan
(Figure 2A). Penetration reaches a plateau after 10 min
when between 50% and 70% of the total [3 H]DNA is
degraded. The reason for this incomplete injection is not
known, but it is likely that some phage particles are
inactivated during purification and that the percentage of
penetration competent λ DNA further decreases during
storage of the phage lysate.
The primary function of IICMan-IIDMan is uptake and
phosphorylation of mannose and this process in principle
could interfere with DNA uptake. DNA penetration was
measured in the presence of between 0.5 and 50 mM
mannose with host cells expressing the complete IIABManIICMan-IIDMan complex (Figure 1A). Mannose uptake does
not interfere with λ penetration and a direct competition
between DNA and mannose can be excluded (Figure 2B).
To test for a possible influence of the membrane fluidity on
λ DNA penetration, bacteria were grown at 10°C and 30°C.
The ratio of saturated fatty acids at 10°C was increased
22 fold for 16:0/16:1 and 14 fold for 18:0/18:1 relative to
30°C (unpublished observation). DNA penetration was then
measured with bacteria from each of the two cultures at
10, 15, 20, 25 and 30°C. There is a lag phase between the
addition of phage and the start of penetration which
increases from less than 5 min to up to 10 min with
decreasing temperature of the penetration assay (Figure
364 Esquinas-Rychen and Erni
Figure 4. λ DNA penetration and sugar transport activities of the different
IIC-IID complexes. WA2127 lysogenic for P1 and transformed with plasmids
encoding different IIA-IIB-IIC-IID complexes were infected with [ 3H]thymidine
labelled phage λ. IICMan-IIDMan E. coli (circle); IICLev-IIDLev B. subtilis (star);
IICSor-IIDSor K. pneumoniae (square); IICGlc-IIDGlc; no IIC-IID, control
(triangle).
2C,D). However, once started, DNA penetration is only
weakly affected by the temperature of the penetration assay
and not at all by the fatty acid composition, suggesting
that DNA penetration is insensitive to membrane fluidity.
bacteria expressing IIC-IID complexes of E. coli and B.
subtilis , and background-only degradation in cells
expressing IIC-IID complexes of K. pneumoniae (Figure
4). This difference between E. coli and B. subtilis on one
hand and K. pneumoniae on the other is also evident from
the plaque areas (Figure 3). For comaparison sugar uptake
and phosphorylation activities were measured. All
transporters when expressed in E. coli conferred uptake
of one or several sugars.
Fructose was taken up via the transporters of B. subtilis
and K. pneumoniae but not of E. coli (Figure 5A). Glucose
was taken up by the transporters of E. coli and K.
pneumoniae whereas uptake via B. subtilis was below
background (Figure 5B), and mannose was taken up via
the E. coli transporter only (Figure 5C). The in vitro
sugar:phosphotransferase activities reflect the in vivo
results qualtitatively, but the specific activities of the
transporters of B. subtilis and K. pneumoniae are only
between 2% and 5% of the E. coli transporter (Figure 6,
compare panel A with B and C). In vitro activity most likley
is compromised because of inadequate complementation
between IIABMan of E. coli and the heterologous IIC-IID
complexes of B. subtilis and K. pneumoniae, respectively.
Whereas all four homologous IIA, IIB, IIC and IID subunits
are present in intact cells, the soluble IIA and IIB subunits
are lost in washed membrane preparations and had to be
substituted with purified IIABMan of E. coli.
Activity of Homologous IIC-IID Complexes from Other
Bacteria
IIC-IID complexes with between 40% and 60% sequence
identity with IICMan-IIDMan of E. coli also occur in K.
pneumoniae and B. subtilis. IIC-IID complexes from these
bacteria were expressed in E. coli, and λ penetration as
well as sugar transport activity were characterized. There
is a clear difference between fast λ DNA degradation by
Activity of IIC-IID Fusion and Chimeric Proteins
Neither IICMan nor IIDMan alone support λ penetration,
whereas IICMan in the presence of IIDMan containing short
truncations at the C-terminus supports λ penetration (Erni
et al., 1987). To determine the minimal length of IID
sequence necessary for λ infection, λ phages were titrated
on bacteria expressing full-length IICMan together with
fusion proteins between progressively truncated IIDMan and
either alkaline phosphatase (Figure 1B) or β-galactosidase
Figure 5. In vivo transport activity of IIC-IID complexes with different sugar
substrates. Initial rates of uptake of fructose (A), glucose (B) and mannose
(C) by E. coli WA2127∆G∆F expressing the IIA-IIB-IIC-IID complexes of E.
coli (circles), B. subtilis (squares), and K. pneumoniae (triangles up).
WA2127∆G∆F transformed with control plasmid (triangles down). The
uptake reaction was started by the addition of [ 14C]sugar (6000 dpm/nmol)
to a final concentration of 0.1 mM.
Figure 6. In vitro sugar phosphotransferase activity of IIC-IID complexes.
Activities of membranes prepared from WA2127∆G∆F expressing IIA-IIBIIC-IID complexes of E. coli (A), B. subtilis (B) and K. pneumoniae (C). The
sugar substrates are indicated at the bottom of each panel. Activities were
measured in the presence of purified EI, HPr and an excess of IIABMan of
E. coli origin. Activities are given in nmol sugar/mg total membrane protein/
30 min incubation time. The background activity of membranes of
WA2127∆G∆F was 9 nmol/mg protein/30 min.
Penetration of phage λ DNA 365
Phage λ DNA is not Degraded by a Periplasmically
Expressed Nuclease
It has been shown that λ DNA becomes DNase sensitive
after injection into isolated E. coli envelope-membrane
complexes (Zgaga et al., 1973). If λ DNA formed a transient
complex with IIC-IID during penetration across the inner
membrane, a nearby nuclease might cleave the λ DNA
and render it non-infectious. One or a few double strand
breaks should suffice to drastically reduce circularization
and replication of λ DNA. To probe proximity between λ
DNA and IIC-IID, two fusion proteins between IIDMan and
the sugar-non-specific nuclease NucA of Anabaena sp.
(Muro-Pastor et al., 1992) were constructed, one with the
two open reading frames flush, the other with the two
proteins connected by a 22 residue long Ala-Pro rich linker
(Figure 1E). In addition, NucA was targeted to the periplasm
with the cleavable OmpA signal sequence (Figure 1F)
(Meiss et al., 1998). Active site mutants (His124Ala) of IIDNucA and OmpA-NucA served as controls. The nuclease
activity of the recombinant proteins was verified in DNA
Figure 7. Efficiency of plating of λvir on E. coli expressing progressively
truncated IIDMan. λvir was titrated on WA2127 expressing IICMan and fusion
proteins between C-terminally truncated IIDMan and β-galactosidase (LacZ)
or alkaline phosphatase (PhoA). Aminoacid residues of IIDMan at which the
fusion occured are indicated on the x-axis. Efficiency of plating (diamonds).
Plaque area (circles). 100 % refers to plaques on lawns of cells expressing
wild-type IICMan-IIDMan.
(Figure 1C). Proteins with fusion points equally spaced
along the entire length of IIDMan were selected from a
collection which originally had been prepared to
characterize the membrane topology of IICMan and of IIDMan
(Huber and Erni, 1996). Efficiency of plating and plaque
area were only slightly affected when less than 100
residues were removed from the C-terminus of IIDMan but
dropped precipitously if the deletions were extended
beyond residue 184 (Figure 7). This decrease is not due
to instability of the IID fusion proteins, because their βgalactosidase activity increased with decreasing length of
the IID segment (Huber and Erni, 1996).
Chimeric IIC-IID complexes (Figure 1D) were
constructed by restriction fragment exchange at an AsuII
site which is present in all three IID genes between codons
34 and 35 (PheGlu). Chimeric proteins containing IIC of E.
coli or B. subtilis (IICB.s.-IIDE.c., IICE.c.-IIDB.s., IICE.c.-IIDK.p.)
supported rapid λ penetration whereas chimeras containing
IIC of K. pneumoniae and the IICB.s.-IIDK.p. pair did not
(Figure 8A). As before, rapid λ penetration corresponded
with large plaque size (Figure 3). Bacteria expressing the
chimeric IIC-IID complexes did not ferment mannose or
fructose on MacConkey indicator plates and membranes
prepared from these cells had no sugar
phosphotransferase activity (not shown). IIDE.c. could be
detected on Westernblots of chimeric proteins indicating
that IIDE.c. was stably expressed (Figure 8B). The antiserum
which was raised against IID E.c. did, however, not
crossreact with the IID of K. pneumoniae and B. subtilis
(not shown).
Figure 8. λ DNA penetration activities of chimeric IIC-IID complexes. (A)
WA2127 lysogenic for P1 and transformed with plasmids encoding chimeric
IIC-IID complexes were infected with [ 3H]thymidine labelled λ. IICB.s.-IIDE.c.
(solid diamonds), IICE.c.-IIDK.p. (open squares), IICE.c.-IIDB.s. (stars), IICK.p.IIDE.c. (open triangles), IICB.s.-IIDK.p. (semicircles), IICK.p.-IIDB.s. (triangles
down). Controls: IICE.c.-IIDE.c. (solid circles), no IIC-IID proteins (tickmarks).
(B) Immunblots of whole cell lysates from cells expressing IICB.s.-IIDE.c.,
IICK.p.-IIDE.c. and IICE.c.-IIDE.c. not induced (lane 1), induced with IPTG and
harvested after 3, 5 and 12 h (lanes 2-4). The polyclonal antiserum reacts
with IIDE.c. but does not crossreact with IID of the other species.
366 Esquinas-Rychen and Erni
suggested by the following observation. NucA expressing
bacteria became resistant to transformation with plasmid
DNA. This inactivation was caused by NucA bound to the
bacterial cell surface and not by NucA released into the
culture medium, because in a mixture of competent NucA
and competent control (bystander) cells, only the NucA
cells were resistant whereas the bystander cells could be
transformed (Table 1). However, periplasmic NucA did not
affect infection of bacteria by λ. The efficiency of plating of
λ on NucA cells was normal, as were the size and the
morphology of the plaques (Table 1). The presence of NucA
did not affect the efficiency of plating of bacteriophages
P1, K10 or λ hp 8 either (results not shown). These
observations suggest, that λ DNA crosses the periplasmic
space in a protected form and most likely is not in direct
physical contat with the IIC-IID complex.
Discussion
Man
Figure 9. Nuclease activities NucA with OmpA signal sequence and of IID NucA fusion proteins. (A, C) Ethidium bromide stained DNA gels (A) and
Coomassie stained regular gels (C) of cell free lysates from bacteria
expressing plasmid-encoded NucA with an OmpA signal sequence (w.t.)
and an inactive His124Ala variant (mut). Both, the putative precursor and
processed forms have nuclease activity (A) and are visible as overexpressed
proteinbands upon induction (C). (B, D) Ethidium bromide stained DNA gel
and immunblot of lysates containing fusion proteins between IIDMan and
NucA (w.t.) and the His124Ala mutant. Full length protein and the proteolytic
NucA and IID moieties of the fusion protein with the Ala Pro rich linker are
visible. Only the proteolytic moieties are detectable of the proteins without
a linker. Protein expression was induced ( Ind. ) with 0.02 µM
anhydrotetracyclin (A), 0.25 µM anhydrotetracyclin (C) and with 100 µM
IPTG (B, D).
containing polyacrylamide gels (Figure 9A,B). The IID-NucA
fusion protein without a linker was inactive whereas the
IID-NucA fusion protein with the Ala-Pro rich linker was
active. In both cases a proteolytic fragment, the size of
NucA and with NucA activity was also formed. The full
length fusion protein and the IID fragment could be
identified on an immunblot with an anti-IIDMan antiserum
(Figure 9D). NucA with the OmpA signal sequence
produced two closely spaced bands which were visible on
DNA gels and on Coomassie blue stained gels (Figure
9A,C). Judged from their size, the two fragments are
precursor and the processed form of OmpA-NucA. That
NucA was also active in the periplasm of bacteria is
The molecular mechanism of DNA injection from
bacteriophages into bacteria is poorly understood.
Bacteriophage DNA has to cross two membranes to reach
the cytoplasm of a Gram negative host. LamB in the outer
membrane of E. coli serves as receptor for phage λ and
trigger for DNA ejection. The IIC-IID complex is required
for penetration of λ DNA across the inner membranes, in
particular for DNA from phages with genomes smaller than
wild-type (Katsura, 1983). DNA injection into LamB
containing, ethidium bromide loaded proteoliposomes is
complete in less than 1 min as measured by the increase
of fluorescence (Novick and Baldeschwieler, 1988). In
contrast, EcoP1 dependent restriction of [ 3H]DNA following
injection requires approximately 10 min. The slow rate
suggests that nucleolytic breakdown rather than
penetration is rate limiting in these experiments, even if
one concedes that passage across the bacterial envelope
might be slower than DNA injection across the bilayer of
the proteoliposome. In the experiments described above
penetration may become rate limiting only in the presence
of poorly functioning IIC-IID variants, conditions under
which plaque size is reduced, too. Our results confirm that
the transporters of B. subtilis and K. pneumoniae support
sugar transport when expressed in E. coli indicating that
they are expressed in a functional form (Martin-Verstraete
et al., 1996; Wehmeier et al., 1995). Yet, only the IIC/IID
complex of B. subtilis confers λ sensitivity to pel hosts
whereas K. pneumoniae does not or only poorly.
Table 1. Effect of NucA on efficiency of infection by phage λ and transformation with plasmids
Tester (bystander) strains
Proteins expressed by tester strain
WA2127∆G
(WA2127∆G∆F)
IIC-IID OmpA-NucA
IIC-IID OmpA-NucA (H124A mutant)
IIC-IID-NucA
IIC-IID-NucA (mutant)
IIC-IID (control)
Infection with λvir
(e.o.p.)
Number of transformants
of tester strain (bystander)
33±13x109
38±11x109
16±4x109
12±7x109
41±7x109
0 (656)
937 (412)
893 (232)
570 (214)
1047
Tester (AmpR) and bystander strains (KanR) were grown to OD550 = 0.4 - 0.6, made competent with CaCl2 method and resuspended in 100 mM CaCl2 to
identical cell densities. Equal volumes (100 µl) of tester and bystander were mixed and added to 2 µl of plasmid pACYC184 (50 ng/µl). 1 ml LB medium was
added after the heat shock and the bacteria were incubated for 30 min at 37°C. 5 µl of the transformation mixture were spread on LB plates supplemented
with Amp and Cm to select for transformed tester strains, and on plates supplemented with Cm and Kan to select for transformed bystander strains.
Penetration of phage λ DNA 367
Table 2. Bacteria, phages and plasmids
Bacteria, phages, plasmids
Relevant properties
Source and reference
E. coli
WA921
WA2127
WA2127∆G
C600λcI857Sam7
Y1088
LJ160
WA2127∆G∆F
pel+
manXYZ thr leu met lac supE44 (rK-mK-)
manXYZ ptsG::cat
lysogenic for λ, cI(ts), Sam7
supF , indicator for λcI857Sam7
fruA::miniTn10 kan
manXYZ ptsG::cat fruA::miniTn10 kan
(Scandella and Arber, 1974)
(Scandella and Arber, 1974)
(Buhr et al., 1994)
gift of W. Arber
(Goldberg and Howe, 1969)
gift of J. Lengeler
by P1 transduction from WA2127∆G
(Buhr et al., 1994) and LJ160
Phages
λvir
λhp8
λcI857Sam7
P1
P1vir
extended host range
used for labelling with [ 3H]thymidine
cat cI(ts), lysogenic
used for transduction
(Scandella and Arber, 1974)
(Scandella and Arber, 1974)
(Goldberg and Howe, 1969)
gift of W. Arber
laboratory collection
Plasmids
pJF119EH
pJC6
pUWL53
pBBInucA
pASKnucA
pRL1
pTACL293
pTSML3
pJFPH6M
pJFLPM
pJFDEFG
pJFFBAM
pJFml
pJFms
pJFlm
pJFls
pJFsm
pJFsl
pYZnucA
pYZnucAMut
pYZapnucA
pASKnucAMut
Ptac lacIq bla ColEI
levDEFG (B. subtilis)
sorFBAM (K. pneumoniae)
nucA nuiA (Anabaena sp.) bla
Ptet::nucA with OmpA signal sequence bla
Ptac:: levDE lacIq bla
Ptac:: manX lacIq bla
manXYZ
Ptac:: manYZ lacIq bla IID His tagged
Ptac:: manXYZ lacIq bla
Ptac:: levDEFG lacIq bla
Ptac:: sorFBAM lacIq bla
Ptac:: manYlevG lacIq bla
Ptac:: manYsorM lacIq bla
Ptac:: levFmanZ lacIq bla
Ptac:: levFsorM lacIq bla
Ptac:: sorAmanZ lacIq bla
Ptac:: sorAlevG lacIq bla
Ptac:: manYZ::nucA lacIq bla
Ptac:: manYZ::nucA lacIq bla H124A mutation in nucA
Ptac:: manYZ::nucA lacIq bla with Ala Pro linker
Ptet::nucA with OmpA signal sequence bla H124A mutation in nucA
(Furste et al., 1986)
(Martin Verstraete et al., 1990)
(Wehmeier et al., 1995)
gift of G. Meiss
gift of G. Meiss
(Seip et al., 1997)
(Seip et al., 1994)
(Erni and Zanolari, 1985)
F. Huber and B. Erni, unpublished
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
this work
There is specificity of interaction between
bacteriophage λ and the IIC-IID complex since, although
homologous, not all complexes sustain DNA penetration.
Of the two subunits in the complex, IIC plays the more
dominant role than IID. Up to 100 residues can be removed
from the C-terminus of IIDMan and replaced by alkaline
phosphatase or β-galactosidase with little effect on the
plaque size but complete loss of sugar transport activity. A
chimeric complex between IIC of E. coli and IID of the
inactive K. pneumoniae complex is fully active whereas
the inverse combination is inactive. None of the chimeric
proteins supporting λ penetration has sugar transport
activity. Neither IIC nor IID could be expressed alone in
bacteria (although each could be expressed in minicells
where degradation of misfolded proteins must be slower,
(Erni et al., 1987)). Taken together these results suggest,
that mutual interaction between IIC and IID is important
for stability and that a specific but static interaction is
sufficient for facilitation of λ penetration. For translocation
and phosphorylation of sugars a more dynamic interaction
between IIC, IID and probably also the IIABMan subunit is
required. The proteins IICAga and IID Aga (for GalNAc)
paralogous to IICMan-IIDMan and also encoded in the E. coli
genome (Reizer et al., 1996)) do not support DNA
penetration, if they are expressed at all.
The results obtained with the non-specific nuclease
NucA tethered to IIDMan or secreted into the periplasmic
space suggest that λ DNA in contrast to transforming
plasmid DNA is protected from nucleolytic attack in the
periplasm. It is not known, whether the tail tube of phage λ
is in direct physical contact with the inner membrane such
that λ DNA is at no time exposed to the periplasmic medium
or whether transit of λ DNA across the periplasm is so
rapid (Novick and Baldeschwieler, 1988) that the few
nucleolytic breaks do not suffice to disrupt the continuity
of the DNA strands.
Experimental procedures
Bacterial Strains, Bacteriophages, Plasmids and Media
Bacteria, phages and plasmids used are listed in Table 2. Bacteria were
grown on LB medium at 37°C or 30°C supplemented with antibiotics and
0.4 % sugar where indicated. MacConkey indicator plates (MacConkey
agar base, Difco) were supplemented with 1.0 % sugar and standard
concentrations of antibiotics (Sambrook et al., 1989). Bacto-Agar (“Difco”
certified, 15 g/l) was used for plating of λ because other brands did not
afford reproducible results (our observation).
Bacteriological Methods
WA2127 transformed with different IIC/IID encoding plasmids was
lysogenized with P1 (ts CmR) following standard procedures (Miller, 1992).
Lysogens were selected on LB agar plates containing 25 µg/ml
chloramphenicol and 100 µg/ml ampicilline and tested for P1 lysogeny by
titration with λvir. The titer of λvir on P1 lysogenic bacteria was four orders
368 Esquinas-Rychen and Erni
of magnitude lower than on a non-lysogenic control. FruA transductants
were selected on MacConkey fructose plates. Plate lysates of bacteriophage
λ were prepared as described (Arber et al., 1983).
Preparation of [3H]-Methyl Thymidine Labelled Phage λ
[ 3H] labelled phage λ was prepared in E. coli C600 lysogenic for λcI857Sam7
which carries the temperature sensitive repressor cI857 and a defective
lysis gene (Sam7) as described (Scandella and Arber, 1974). 2 ml (1 mCi/
ml) [3 H]methyl-thymidine were added to 500 ml of culture. Phages were
purified by equilibrium centrifugation in CsCl as described (Sambrook et
al., 1989). The phage titer determined on E. coli Y1088 supF, was 1012
PFU/ml and the radioactivity incorporated was 4.4 x 106 dpm/ml.
Construction of Plasmids
All plasmids used have the ColE1 origin of replication and 15-20 copies/
cell (Furste et al., 1986). pJFLPM encoding the three subunits of the E. coli
mannose transporter under the control of the Ptac promoter was constructed
as follows: Plasmids pTACL293 (Seip et al., 1994) and pTSML3 (Erni and
Zanolari, 1985) were digested with SnaBI and PvuI and the vector fragment
of pTACL293 (manX) was ligated with the insert fragment of pTSML3
(manYZ). pJFDEFG encoding the four subunits of the B. subtilis fructose
transporter under the control of the Ptac promotor was constructed as
follows: Plasmids pRL1 (Seip et al., 1997) and pJC6 (Martin Verstraete et
al., 1990) were digested with EcoRV and PstI and the vector fragment of
pRL1 (levDEF') was ligated with the insert fragment of pJC6 (lev'FG).
pJFFBAM encoding the four subunits of the K. pneumoniae sorbose
transporter under the control of the Ptac promoter was constructed as
follows: pMSFB (same structure as pRL1, but encoding the IIASor and IIBSor
subunits, unpublished data) was digested with EcoRI, made flush with
Klenow enzyme and then digested with XhoI. pUWL53 (gift of U.F. Wehmeier
and J. Lengeler, Osnabrück, Germany) was digested with XbaI, made flush
with Klenow enzyme and then digested with XhoI, and the vector fragment
of pMSFB (sorFBA') was ligated with the insert fragment of pUWL53
(sor'AB). Plasmids pJFml (manYlevG) encodes a chimeric IICE.c.-IIDB.s.
complex. pJFms, pJFlm, pJFls, pJFsm and pJFsl encode similar chimeric
complexes composed of IIC and IID of different species (Table 2). They
were constructed as follows: The parent plasmids pJFLPM, pJFDEFG and
pJFFBAM were split with AsuII and ScaI into a vector fragment (encoding
the 3' half of bla, IIA, IIB and IIC) and an insert fragment (encoding IID and
the 5' half of bla). The AsuII sites are located 81, 99 and 78 bp downstream
of the start codon of manZ, levG and sorM genes, respectively, the ScaI
site is in bla. The vector and insert fragments were ligated in all six possible
combinations.
Plasmids pYZnucA encoding IICMan of E. coli, a fusion protein between
IIDMan of E. coli and NucA (sugar-non-specific nuclease) of Anabaena sp.,
and NuiA (inhibitor of NucA) (Muro-Pastor et al., 1997) was constructed as
follows: A DNA fragment encoding the LacI repressor, the Ptac promoter
and IICMan-IIDMan was PCR amplified from pJFPH6M (F. Huber and B. Erni,
unpublished) as template with the 5' primer TGGGGAAGGCCATGGA
GCCACGCGTCGCGA introducing a Nco I site and a 3' primer
AGTGTACACATATGTGTTCGAATCCCAGCAGGCCG adding a NdeI site
to the 3' end of manZ coding region. This PCR fragment and plasmid
pBBInucA (encoding NucA, β-lactamase and the NuiA inhibitor of NucA
(Meiss et al., 1998)) were both digested with NdeI and NcoI and then ligated
to afford pYZnucA. Plasmid pYZnucAMut encoding the His124Ala active
site mutant of NucA was obtained by exchanging the NdeI/ScaI fragment
(encoding the wild-type sequence) against the NdeI/ScaI fragment from
the mutant plasmid pBBInucAMut (Meiss et al., 1998). Plasmids pYZapnucA
and pYZapnucAMut are like the above described plasmids except that the
IID and NucA moiety of the fusion protein are separated by a 20 residue
alanine proline rich linker peptide. They were constructed in two steps
starting from pYZNucA. (i) The NucA coding region was removed by partial
digestion of pYZnucA with SfuI and complete digestion with ScaI, and
replaced with a DNA fragement encoding the Ala Pro rich linker which was
obtained from a pJFGPL1 (Beutler et al., 2000). (ii) The intermediate was
then digested with NdeI (at the 3' end of the Ala Pro encoding DNA) and
ScaI and ligated with the NucA encoding NdeI/ScaI fragment excised from
pYZnucA affording the new plasmid with the Ala-Pro rich linker between IID
and NucA. pYZapnucAMut was constructed from pYZapnucA as described
above for pYZnucAMut. pASKnucA encodes NucA with the OmpA signal
sequence (Meiss et al., 1998). Plasmid pASKnucAMut was obtained by
exchanging the NdeI/ScaI fragment against the NdeI/ScaI fragment of the
His124Ala mutant as described above.
Assay for Phage λ DNA Penetration
Penetration of phage λ DNA across the cytoplasmic membrane was
measured as nucleolytic cleavage of λ DNA by EcoP1 endonuclease
expressed in E. coli P1 lysogens. Bacteria transformed with the indicated
plasmids and lysogenic for P1 were grown to OD550 = 0.8 in 20 ml LB
supplemented with 0.4% maltose and 100 µg/ml ampicillin. No IPTG was
added because the expression of IIC-IID from the leaky Ptac promoter was
sufficient to yield maximum efficiency of plating. The amount of non-induced
plasmid encoded IIC-IID is between 5% and 20% of the chromosomal level.
Overexpression of IIC-IID arrests cell growth and reduces the efficiency of
plating. Cells were collected by centrifugation and resuspended in 2 ml TM
(0.01 M Tris, pH 7.5, 0.01 M MgSO4) at 30°C. To 2 ml of the concentrated
bacteria [3 H]methyl-thymidine labelled phage λ (20000 to 30000 cpm;
multiplicity of infection = 1) was added at 30°C. 0.2 ml aliquots (3000 to
4000 cpm) were withdrawn at different time intervals and added to 0.2 ml
4% perchloric acid (PCA) at 0°C (Simmon and Lederberg, 1972). After at
least 30 min at 0°C, acid insoluble material was removed by centrifugation
at 12000 rpm for 10 min in an Eppendorf centrifuge and the supernatant
containing the cold acid-soluble products was transferred to 2 ml of
scintillation fluid. The acid-insoluble precipitate was resuspended in 0.4 ml
of 2% PCA, heated at 100°C for 60 min and freed of insoluble material by
centrifugation at 12000 rpm for 10 min. The supernatant containing the hot
acid-soluble fraction was added to 2 ml of scintillation fluid. The radioactivity
of the cold acid-soluble and the hot acid soluble fractions was determined.
The fraction of total λ [3 H]DNA degraded by P1 endonuclease after
penetration was calculated from the ratio cold acid-soluble cpm to total
cpm (cold acid soluble plus hot acid-soluble fractions).
Assays for Phage λ Sensitivity
To test for λ sensitivity, bacteria were grown to saturation in LB medium
without IPTG in the presence of 0.4% maltose and cross-streaked against
phage λ. The sensitivity of strains was also characterized by titration with λ
(Arber et al., 1983) on plates prepared with Bacto-Agar (“Difco” certified,
15 g/l). Plaques were examined and when necessary counted under the
microscope at a magnification of 50 x. The diameters of at least 10 plaques
were averaged.
Assays for Transport and Phosphotransferase Activity
To test for in vivo carbohydrate transport activity, bacteria expressing different
IIC-IID complexes were streaked on MacConkey indicator plates containing
100 µg/ml ampicillin and 1.0 % mannose or fructose. Sugar uptake by intact
bacteria was determined as described (Buhr et al., 1992) with the following
modifications. E. coli WA2127∆G∆F (manXYZ ptsG fruA) transformed with
plasmids encoding the IIA, IIB, IIC and IID subunits were grown to OD550 =
0.5 in 250 ml of mineral salts medium (M9) without IPTG supplemented
with 100 µg/ml ampicillin, 0.1% casamino acids, 1% glycerol, collected by
centrifugation and resuspended in 3 ml of ice-cold M9 medium, and
incubated for 30 min on ice. 0.33 ml of cell suspension were diluted with
0.77 ml M9 medium and aerated for 10 min at room temperature. Uptake
was started by addition of 12 µl of 10 mM [ 14C]sugar (6000 dpm/nmol).
Aliquots of 100 µl were withdrawn after 5, 10, 15, 20, 30, 45, 60 and 120 s,
diluted into 8 ml of ice-cold M9 containing 0.4 mM of the corresponding
sugar, and filtered through GF/F (Whatman) glass fiber filters under suction.
The filters were washed under suction with 20 ml of ice-cold 0.15 M NaCl
and radioactivity determined by liquid scintillation counting. To test for in
vitro sugar-phosphotransferase activity of IIC-IID complexes, bacteria were
grown in LB medium, protein expression was induced with 100 µM IPTG
when they had reached OD550 = 0.8, and incubation continued for 4 h.
Membranes were prepared and assayed by ion-exchange chromatography
as described (Erni and Zanolari, 1985). 100 µl of incubation mixture
contained 0.5 µg enzyme I, 2.8 µg HPr, 4 µg IIABMan and rate-limiting
amounts of the membrane preparation (0-10 µg total protein). The specific
activity of the [ 14C]sugars was 1000 cpm/nmol. Membranes containing
IICMan-IIDMan of E. coli were used as positive, membranes from the manXYZ
strain as negative control.
Western Blot and Nuclease Assays in DNA Gels
Bacteria were grown at 37°C in 25 ml cultures to OD550 = 0.8 and protein
expression was then induced with 100 µM IPTG or 0.02 - 0.25 µM
anhydrotetracyclin. 2 ml aliquots were removed after time intervals.. Samples
were harvested by centrifugation, resuspended in sample buffer at
concentration 1010 cell/ml and sonicated. After SDS-PAGE electrophoresis
on a 20% polyacrylamide gel, the proteins were blotted onto nitrocellulose,
tagged with polyclonal rat anti-IIDMan antiserum (unpublished results) and
visualized with a peroxidase conjugated rabbit immunoglobulin to rat
immunoglobulin (DAKO). Nuclease assays in DNA-containing
polyacrylamide gels were performed as described (Muro-Pastor et al., 1992;
Rosenthal and Lacks, 1977). Bacteria were resuspended in water at a
concentration of 1010 cells/ml, solubilized in 5 times concentrated SDS
loading buffer, sonicated and boiled for 5 min. Aliquots were applied to
polyacrylamide gels containing 15 mg/ml calf thymus DNA (Sigma). Proteins
in the gel were renaturated by gentle agitation of the gels in nuclease buffer
(10 mM Tris-HCl pH 7.5, 5 mM MgCl2) with three changes of solution for 90
min at 4°C or room temperature. Incubation was continued at 37°C for the
indicated time, after which the gels were stained with ethidium bromide
and photographed under UV light.
Penetration of phage λ DNA 369
Acknowldegements
We would like to thank I. Martin-Verstraete (Institut Pasteur), J. Lengeler
(University of Osnabrück), and G. Meiss (University of Giessen) for their
generous gifts of plasmids and for technical advice. This work was supported
by grant 31-45838.95 from the Swiss National Science Foundation.
References
Arber, W., Enquist, L., Hohn, B., Murray, N.E., and Murray, K. (1983).
Experimental methods for use with lambda. In Lambda II. R.W. Hendrix,
ed. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp.
433-466.
Beutler, R., Ruggiero, F., and Erni, B. 2000. Folding and activity of circularly
permuted forms of a polytopic membrane protein. Proc.Natl.Acad.Sci.USA
97: 1477-1482.
Boos, W. and Shuman, H. 1998. Maltose/maltodextrin system of Escherichia
coli: Transport, metabolism, and regulation. Microbiol.Mol.Biol.Rev. 62:
204-229.
Boulanger, P., Le Maire, M., Bonhivers, M., Dubois, S., Desmadril, M., and
Letellier, L. 1996. Purification and structural and functional characterization
of FhuA, a transporter of the Escherichia coli outer membrane.
Biochemistry 35: 14216-14224.
Bouma, C.L. and Roseman, S. 1996. Sugar transport by the marine
chitinolytic bacterium Vibrio furnissii. Molecular cloning and analysis of
the mannose/glucose permease. J.Biol.Chem. 271: 33468-33475.
Buhr, A., Daniels, G.A., and Erni, B. 1992. The glucose transporter of
Escherichia coli. Mutants with impaired translocation activity that retain
phosphorylation activity. J.Biol.Chem. 267: 3847-3851.
Buhr, A., Flükiger, K., and Erni, B. 1994. The glucose transporter of
Escherichia coli. Overexpression, purification, and characterization of
functional domains. J.Biol.Chem. 269: 23437-23443.
DiRusso, C.C. and Black, P.N. 1999. Long-chain fatty acid transport in
bacteria and yeast. Paradigms for defining the mechanism underlying
this protein-mediated process. Mol.Cell Biochem. 192: 41-52.
Dreiseikelmann, B. 1994. Translocation of DNA across bacterial membranes.
Microbiol.Rev. 58: 293-316.
Elliott, J. and Arber, W. 1978. Escherichia coli mutants which block phage
lambda DNA injection coincide with ptsM which determines a component
of a sugar transport system. Mol.Gen.Genet. 161: 1-8.
Emmons, S.W., MacCosham, V., and Baldwin, R.L. 1975. Tandem genetic
duplications in phage lambda. III. The frequency of duplication mutants
in two derivatives of phage lambda is independent of known recombination
systems. J.Mol.Biol. 91: 133-146.
Erni, B. and Zanolari, B. 1985. The mannose-permease of the bacterial
phosphotransferase system. Gene cloning and purification of the Enzyme
IIMan/IIIMan complex of Escherichia coli. J.Biol.Chem. 260: 15495-15503.
Erni, B., Zanolari, B., and Kocher, H.P. 1987. The mannose permease of
Escherichia coli consists of three different proteins: amino-acid sequence
and function in sugar transport,sugar phosphorylation,and penetration of
phage lambda Dna. J.Biol.Chem. 262: 5238-5247.
Ferenci, T. 1989. Selectivity in solute transport: binding sites and channel
structure in maltoporin and other bacterial sugar transport proteins.
Bioessays 10: 3-7.
Furste, J.P., Pansegrau, W., Frank, R., Blocker, H., Scholz, P., Bagdasarian,
M., and Lanka, E. 1986. Molecular cloning of the plasmid RP4 primase
region in a multi- host- range tacP expression vector. Gene. 48: 119-131.
Garcia, L.R. and Molineux, I.J. 1995. Rate of translocation of bacteriophage
T7 DNA across the membranes of Escherichia coli. J.Bacteriol. 177: 40664076.
Goldberg, A.R. and Howe, M. 1969. New mutations in the S cistron of
bacteriophage lambda affecting host cell lysis. Virology 38: 200-202.
Hauser, R. and Schneider, A. 1995. tRNAs are imported into mitochondria
of Trypanosoma brucei independently of their genomic context and genetic
origin. EMBO J. 14: 4212-4220.
Huber, F. and Erni, B. 1996. Membrane topology of the mannose transporter
of Escherichia coli K12. Eur.J.Biochem. 239: 810-817.
Katsura, I. (1983). Tail assembly and injection. In Lambda II. R.W. Hendrix,
ed. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp.
331-346.
Katsura, I. 1990. Mechanism of length determination in bacteriophage
lambda tails. Adv.Biophys. 26: 1-18.
Lambert, O., Plancon, L., Rigaud, J.L., and Letellier, L. 1998. Proteinmediated DNA transfer into liposomes. Mol.Microbiol. 30: 761-765.
Mackay, D.J. and Bode, V.C. 1976. Events in lambda injection between
phage adsorption and DNA entry. Virology 72: 154-166.
Martin-Verstraete, I., Michel, V., and Charbit, A. 1996. The levanase operon
of Bacillus subtilis expressed in Escherichia coli can substitute for the
mannose permease in mannose uptake and bacteriophage lambda
infection. J.Bacteriol. 178: 7112-7119.
Martin Verstraete, I., Debarbouille, M., Klier, A., and Rapoport, G. 1990.
Levanase operon of Bacillus subtilis includes a fructose- specific
phosphotransferase system regulating the expression of the operon.
J.Mol.Biol. 214: 657-671.
Meiss, G., Franke, I., Gimadutdinow, O., Urbanke, C., and Pingoud, A.
1998. Biochemical characterization of Anabaena sp. strain PCC 7120
non- specific nuclease NucA and its inhibitor NuiA. Eur.J.Biochem. 251:
924-934.
Miller, J.F. (1992). A short course in bacterial genetics (Cold Spring Harbor,
New York: Cold Spring Harbor Laboratory Press).
Muro-Pastor, A.M., Flores, E., Herrero, A., and Wolk, C.P. 1992.
Identification, genetic analysis and characterization of a sugar-nonspecific nuclease from the cyanobacterium Anabaena sp. PCC 7120.
Mol.Microbiol. 6: 3021-3030.
Muro-Pastor, A.M., Herrero, A., and Flores, E. 1997. The nuiA gene from
Anabaena sp. encoding an inhibitor of the NucA sugar-non-specific
nuclease. J.Mol.Biol. 268: 589-598.
Novick, S.L. and Baldeschwieler, J.D. 1988. Fluorescence measurement
of the kinetics of DNA injection by bacteriophage lambda into liposomes.
Biochemistry 27: 7919-7924.
Plancon, L., Chami, M., and Letellier, L. 1997. Reconstitution of FhuA, an
Escherichia coli outer membrane protein, into liposomes. Binding of phage
T5 to Fhua triggers the transfer of DNA into the proteoliposomes.
J.Biol.Chem. 272: 16868-16872.
Randall-Hazelbauer, L. and Schwartz, M. 1973. Isolation of the
bacteriophage lambda receptor from Escherichia coli. J.Bacteriol. 116:
1436-1446.
Reizer, J., Ramseier, T.M., Reizer, A., Charbit, A., and Saier, M.H.J. 1996.
Novel phosphotransferase genes revealed by bacterial genome
sequencing: a gene cluster encoding a putative N-acetylgalactosamine
metabolic pathway in Escherichia coli. Microbiology. 142: 231-250.
Roessner, C.A. and Ihler, G.M. 1984. Proteinase sensitivity of bacteriophage
lambda tail proteins gpJ and pH in complexes with the lambda receptor.
J.Bacteriol. 157: 165-170.
Roessner, C.A. and Ihler, G.M. 1986. Formation of transmembrane channels
in liposomes during injection of lambda DNA. J.Biol.Chem. 261: 386390.
Roessner, C.A. and Ihler, G.M. 1987. Sequence of amino acids in lamB
responsible for spontaneous ejection of bacteriophage lambda DNA.
J.Mol.Biol. 195: 963-966.
Roessner, C.A., Struck, D.K., and Ihler, G.M. 1983. Injection of DNA into
liposomes by bacteriophage lambda. J.Biol.Chem. 258: 643-648.
Rosenthal, A.L. and Lacks, S.A. 1977. Nuclease detection in SDSpolyacrylamide gel electrophoresis. Anal.Biochem. 80: 76-90.
Sabelnikov, A.G. 1994. Nucleic acid transfer through cell membranes:
towards the underlying mechanisms. Prog.Biophys.Mol.Biol. 62: 119-152.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning: a
laboratory manual (Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory Press.).
Scandella, D. and Arber, W. 1974. An Escherichia coli mutant which inhibits
the injection of phage lambda DNA. Virology. 58: 504-513.
Scandella, D. and Arber, W. 1976. Phage lambda DNA injection into
Escherichia coli pel mutants is restored by mutations in phage genes V
and H. Virology. 69: 206-215.
Schatz, G. and Dobberstein, B. 1996. Common principles of protein
translocation across membranes. Science 271: 1519-1526.
Schirmer, T., Keller, T.A., Wang, Y.F., and Rosenbusch, J.P. 1995. Structural
basis for sugar translocation through maltoporin channels at 3.1 A
resolution. Science 267: 512-514.
Schneider, A., Martin, J., and Agabian, N. 1994. A nuclear encoded tRNA
of Trypanosoma brucei is imported into mitochondria. Mol.Cell Biol. 14:
2317-2322.
Seip, S., Balbach, J., Behrens, S., Kessler, H., Flükiger, K., Demeyer, R.,
and Erni, B. 1994. Mannose transport of Escherichia coli. Backbone
assignments and secondary structure of the IIA domain of the IIABman
subunit. Biochemistry. 33: 7174-7183.
Seip, S., Lanz, R., Gutknecht, R., Flükiger, K., and Erni, B. 1997. The fructose
transporter of Bacillus subtilis encoded by the lev operon - Backbone
assignment and secondary structure of the IIBLev subunit. Eur.J.Biochem.
243: 306-314.
Sharp, P.A. 1999. RNAi and double-strand RNA. Genes Dev. 13: 139-141.
Simmon, V.F. and Lederberg, S. 1972. Degradation of bacteriophage lambda
deoxyribonucleic acid after restriction by Escherichia coli K-12. J.Bacteriol.
112: 161-169.
Suzuki, T., Yan, Q., and Lennarz, W.J. 1998. Complex, two-way traffic of
molecules across the membrane of the endoplasmic reticulum.
J.Biol.Chem. 273: 10083-10086.
Veyrat, A., Gosalbes, M.J., and Perez-Martinez, G. 1996. Lactobacillus
370 Esquinas-Rychen and Erni
curvatus has a glucose transport system homologous to the mannose
family of phosphoenolpyruvate-dependent phosphotransferase systems.
Microbiology. 142: 3469-3477.
Wehmeier, U.F. and Lengeler, J.W. 1994. Sequence of the sor-operon for
L-sorbose utilization from Klebsiella pneumoniae KAY2026.
Biochim.Biophys.Acta 1208: 348-351.
Wehmeier, U.F., Wöhrl, B.M., and Lengeler, J.W. 1995. Molecular analysis
of the phosphoenolpyruvate-dependent L-sorbose: Phosphotransferase
system from Klebsiella pneumoniae and of its multidomain structure.
Mol.Gen.Genet. 246: 610-618.
Zgaga, V., Medic, M., Salaj-Smic, E., Novak, D., and Wrischer, M. 1973.
Infection of Escherichia coli envelope-membrane complex with lambda
phage: adsorption and penetration. J.Mol.Biol. 79: 697-708.