Acta Botanica Sinica
植 物 学 报
2004, 46 (9): 1056－1064
http://www.chineseplantscience.com
Distribution of Water Channel Protein RWC3 and Its Regulation by
GA and Sucrose in Rice (Oryza sativa)
SUN Mei-Hao*, ZHANG Min-Hua, LIU Hong-Yan, LI Le-Gong**, YU Xin, SU Wei-Ai***, TANG Zhang-Cheng
(Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes of Biological Sciences, The Chinese
Academy of Sciences, Shanghai 200032, China)
Abstract: Water channel proteins facilitate water flux across cell membranes and play important roles
in plant growth and development. By GUS histochemical assay in RWC3 promoter-GUS transgenic rice
(Oryza sativa L. cv. Shenxiangjin 4), one of the members of water channel proteins in rice, RWC3, was
found to distribute widely in variety of organs, from vegetative and reproductive organs. Further studies
showed that gibberellin (GA) enhanced the GUS activity in the transgenic calli, suspension cells and leaves,
whereas ancymidol (anc), an inhibitor of GA synthesis, reduced the GUS activity. Sucrose was found to
inhibit the effects induced by addition of GA, suggesting a possible cross-talk between GA and sucrose
signaling on regulation of the RWC3 gene expression.
Key words: aquaporin; gibberellins (GA); sucrose; GUS; RWC3; rice (Oryza sativa)
Aquaporins, located in the cell membranes of mammals,
plants and microorganisms, facilitate water flux across cell
membranes. Aquaporins belong to a high conserved membrane protein group of major intrinsic proteins (MIPs). They
are typically classified into four subgroups: plasma intrinsic proteins (PIPs), tonoplast intrinsic proteins (TIPs),
NOD26-like intrinsic proteins (NIPs) and small basic intrinsic proteins (SIPs) (Kjellbom et al., 1999; Tyerman et al.,
1999; Johansson et al., 2000; Santoni et al., 2000; Johanson
et al., 2001; Maurel and Chrispeels, 2001). Many aquaporins
have been identified in plants. In maize, 36 aquaporin genes
have been sequenced (Chaumont et al., 2001), while 35
aquaporin genes have been identified in Arabidopsis genome (Johanson et al., 2001, Quigley et al., 2002). The discovery of aquaporins in plants resulted in a paradigm shift
in the understanding of plant water relations (Maurel and
Chrispeels, 2001).
By using variety of methods, it has been revealed that
water channel proteins have different localization patterns
and distinct regulation mechanisms (Kaldenhoff et al., 1995;
Yamada et al., 1995; Kaldenhoff et al., 1996; Sarda et al.,
1997; Barrieu et al., 1998; Chaumont et al., 1998; Higuchi
et al., 1998; Gao et al., 1999; Gerbeau et al., 1999; Chaumont
et al., 2000; Yamada and Bohnert, 2000; Dixit et al., 2001;
Frangne et al., 2001; Suga et al., 2001; Sun et al., 2001; Yu
et al. 2002), although they are closely related (Sarda et al.,
1999; Suga et al., 2001). For instance, it is indicated that
Brassica napus aquaporin BnPIP1 is expressed in vascular systems and tissues with rapid expanding and proliferating cells by GUS histochemical assay in BnPIP1 promotor-GUS transgenic tobacoo (Yu et al., 2002).
Because of multiplicity and ubiquity of the MIP superfamily in plant membranes, aquaporins seem to have quite
complex regulation mechanisms, including transcription
regulation, phosphorylation (Johansson et al., 1998), pH
(Gerbeau et al., 2002), Ca2+ (Gerbeau et al., 2002) and even
PIP interactions (Fetter et al., 2004). Nevertheless, studies
in vivo on expression and regulation of individual
aquaporin in plants is primarily vital to elucidate how an
aquaporin functions and is regulated in order to understand the functional complexity of the gene family (Javot et
al., 2003).
Recently, expression and regulation of several rice PIPs
have been studied (Malz and Sauter, 1999; Li et al., 2000;
Kawasaki et al., 2001). Two of these PIPs, RWC1 (OsPIP1a)
and RWC3, were characterized in oocyte expression system as water channel protein (Li et al., 2000, Lian et al.,
2004), and expressions of RWC1 (OsPIP1a) and OsPIP2a
Received 5 Apr. 2004 Accepted 16 Jul. 2004
Supported by the State Key Basic Research and Development Plan of China (G1999011700) and the Knowlege Innovation Program of The
Chinese Academy of Sciences (KSCXZ-SW-116).
* Present address: Department of Biochemistry, Albert Einstein College of Medicine, 1300 Morris Park Ave, Bronx, NY, 10461
** Present address: Department of Plant and Microbial Biology, University of California, Berkeley, CA 94720, USA
*** Author for correspondence. Tel: +86 (0)21 54924245; Fax: +86 (0)21 54924015; E-mail: <[email protected]>.
Abbreviations: anc, ancymidol; GA, gibberellins; GUS, beta-glucuronidase; 4-MU, 7-hydroxy-4-methylcoumarin β-Methylumbelliferone; 4MUG, 4-methylumbelliferyl-β-D-glucopyranosiduronic acid; RWC, rice water channel protein; X-gluc, 5-bromo-4-chloro-3-indoly-β-Dglucuroniside.
SUN Mei-Hao et al.: Distribution of Water Channel Protein RWC3 and Its Regulation by GA and Sucrose in Rice (Oryza sativa)１０５７
were demonstrated to be stimulated by gibberellins (GA)
(Malz and Sauter, 1999).
We have previously reported that drought stress stimulated an increase of RWC3 gene expression in droughttolerant upland rice, and overexpression of the RWC3 in
drought-sensitive lowland rice resulted in higher leaf water
potential (Lian et al., 2004), indicating that RWC3 plays an
important role in drought avoidance in rice. However, little
of knowledge so far has been gained in understanding the
mechanism of its function and regulation. In this paper GUS
staining of plants transformed with RWC3 promoter-GUS
fusions showed that RWC3 was broadly expressed in roots,
stems, leaves, floral organs and seeds, indicating comprehensively involving in a variety of physiological processes
in rice. Furthermore, GUS activity was enhanced by GA in
the transgenic rice; such enhancement, however, was repressed by sucrose.
1 Materials and Methods
1.1 Plant materials
Seeds of rice (Oryza sativa L. cv. Shenxiangjin 4) were
germinated on moist Whatman filter paper in darkness. Rice
seedlings were grown at a photon flux density of 350－400
µmol⋅m－2⋅s－1 with 12 h/12 h day/night cycle at (27 ± 1) °C in
the phytotron at the Shanghai Institute of Plant Physiology.
Seeds of transgenic rice were germinated on N6 media
containing 50 µg/mL hygromycin, and the selected seedlings were used to induce callus and establish suspension
cell culture as described by Kinya and Kokichi (1985). The
media for suspension cell culture contained the AA salts
and vitamins (Kinya and Kokichi, 1985) plus tryptone (500
mg/L), 2,4-D (2 mg/L), kinetics (0.2 mg/L) and sucrose (30
g/L), pH 5.8.
1.2 Construction of the promoter-GUS fusion
The PCR primers based on the RWC3 promoter sequence
(NCBI accession number: AB029325 ) were as follows: 5'CGAGTGAGCTCTCCTTTTCC-3' (forward primer) and 5'GCTCTAGAGCCTCTTCTTCTTCCTACTAC (reversed
primer, created XbaⅠ site is underlined), and the PCR was
performed with the Pfu high fidelity Taq DNA polymerase
(Stratagene) so that a blunt-ended product was obtained
and cloned into SmaⅠ site of the pCAMBIA1381Z vector
(Fig.1A, generously provided by the CAMBIA team of
Australia), forming the RWC3 promoter guided GUS report
gene expression construct. Orientation and sequence of
the insert were convinced by digestion with restriction enzymes EcoRⅠ and XbaⅠ (Fig.1C) and DNA sequencing
(ABI PRISMTM 377XL DNA Sequencer), respectively.
1.3 Plant transformation
Agrobacterium tumefaciens (EHA105) carrying the
RWC3 promoter-GUS construct was used for transformation as described by Liu et al. (1998). The generated calli
growing in the hygromycin medium and showing positive
GUS activities were then induced to regenerate transgenic
plants. The regenerated plants were grown in the phytotron
under the same conditions as described above.
1.4 Southern blot analysis
Genomic DNA from the regenerated transgenic rice
leaves of five individual plants was extracted as described
by Dellaporta et al. (1983). Ten µg of each DNA sample
were digested with Hind Ⅲ restricted enzyme and separated in 0.8% agarose gel. Southern blot analysis was carried out as described by Southern (1975) and Sambrook
et al. (1989) using the GUS coding region (32P labeled, nick
label system, SABC) as probe.
1.5 GA treatment on transgenic rice suspension culture
cells and leaves
The transgenic rice suspension cultured cells were
treated with 50 µmol/L GA (SABC) for 12, 24 and 48 h,
respectively, and then collected by centrifugation (4 000g,
3 min). To detect the changes of GUS activity, total proteins were extracted using ice-cold assay buffer (50 mmol/L
K-phosphate (pH 7.0), 10 mmol/L EDTA, 0.1% TritonX-100,
10 mmol/L β-mercaptoethanol) and quantified by Bradford
method (Bradford, 1976).
Similarly, detached leaves from 8 to 10-week old
transgenic rice seedlings were sectioned to 0.2 cm2, and
soaked in solution with or without 50 µmol/L GA. After
certain periods of treatment, samples were frozen in liquid
nitrogen prior to total protein extraction.
1.6 GUS activity assay and histochemical staining
GUS activity was assayed according to the method described by Jefferson (1987). Briefly, five µg total protein
was incubated with 2 mmol/L 4-methylumbelliferyl-β-Dglucopyranosiduronic acid (4-MUG) at 37 °C for 1 h and
quenched with Na2CO3, and GUS enzymatic product, 7hydroxy-4-methylcoumarin β-methylumbelliferone (4-MU)
was quantified with a fluorometer (DyNA Quant 200
Fluorometer, Hoefer, USA).
To localize the GUS activity in different tissues,
transgenic plant tissues were stained with 5-bromo-4-chloro3-indoly-β-D-glucuroniside (X-gluc; Jefferson, 1987) for 2
h at 37 °C, destained with 70% ethanol and then photographed as a whole or sections after embedded with paraffin and sliced to 15 µm in thickness.
１０５８
2
Ａｃｔａ　Ｂｏｔａｎｉｃａ　Ｓｉｎｉｃａ　植物学报　Ｖｏｌ．４６　Ｎｏ．９　２００４
Results
2.1 Cloning of RWC3 promoter and transforming rice
with RWC3 promoter-GUS construct
As expected, a size of 1.2 kb upstream sequence of the
open reading frame of RWC3 was amplified by PCR (Fig.
1B), which contained the promoter-indicative CAAT and
Fig.1. Transformation of RWC3 promoter-guided GUS into
rice. A. The construct used for transformation. Line arrows indicated the expression direction of genes. EcoRⅠ and SmalⅠ sites
were pointed by vertical line arrows. Hyg+: the gene encoding an
enzyme to digest hygromycin. B. Sequence of the RWC3 gene
promoter region. The PCR primers used to amplify this promoter were indicated by underlines, and XbaⅠ restriction site
created was parenthesized. CAAT and TATAA boxes were marked
with gray context. The cis-elements of GA were bolded. The
initial translation codon ATG was indicated in italic. C. Agarose
gel profile of the PCR product cloned into the pCAMBIA1381Z
vector after digested with EcoRⅠ and XbaⅠ.
TATAA boxes and GA cis-elements (Fig.1B). The RWC3
promoter was thereafter cloned into the pCAMBIA1381Z
vector, and its orientation was verified by sequencing (Fig.
1B) and restricted enzyme cutting (Fig.1C).
After transformation mediated by A. tumefaciens, screen
in the hygromycin medium and plant regeneration, Southern blotting analysis was carried out to detect the transgenic
plants (Fig.2).
2.2 Distribution of RWC3 in transgenic rice
By the GUS histochemical assay in the RWC3 promoterGUS transgenic plants, GUS staining was shown in both
vegetative and reproductive organs (Fig.3). In the transgenic
rice root, GUS activity was shown in elongation and mature
zones (Fig.3B), and was very significant in cells adjacent to
the vascular bundles (Fig.3A), in exodermis and root hairs
(Fig.3A). In the leaves, GUS activity was found not only in
leaf vascular bundles, but also in mesophyll cells (Fig.3D),
and the expression in the cells around vascular bundles
appeared to be higher than in mesophyll cells (Fig.3D). High
GUS activity was also observed in stem tissue (Fig.3C).
Notably, there was wide distribution of RWC3 protein
in reproductive tissues including pollen, anther, filament,
ovary and seeds. Expression of RWC3 protein, as indicated
by GUS staining intensity, was obviously high in immature
embryo (Fig.3G) and the seed coat (Fig.3F), and GUS activity in seed coats could be detected even after the endosperm
was mature (Fig.3E).
2.3 Up-regulation of RWC3 expression by GA
Presence of GA cis-elements in RWC3 gene promoter
led us to the assumption that GA might play a role in regulation of RWC3 gene expression. In fact, GA has previously
Fig.2. The Southern blot demonstrating the insertion of GUS
gene in the transgenic rice. The sample preparation, separation
and blotting were performed as described in Material and
Method. L1－L5: indicates the DNA samples from five individual
plants.
SUN Mei-Hao et al.: Distribution of Water Channel Protein RWC3 and Its Regulation by GA and Sucrose in Rice (Oryza sativa)１０５９
Fig.3. GUS activity in different tissues of the transgenic rice.
Tissues from transgenic rice were stained with X-Gluc for 2 h and
then destained with 70% ethanol, thereafter were photographed
directly, or embedded with paraffin and sectioned (15 µm) prior
to photographing. A. Cross-section of root at root hair zone. Bar
= 25 µm. B. Whole root to show GUS activity in different part of
root. C. GUS expression in rice stem. D. Cross section of leaf. E.
Mature seed. F. Stained immature seed coat. G. Immature embryo.
Bar = 200 µm. H. GUS staining in rice flower. A, anther; F,
filament; O, ovary; P, pollen; Sg, stigma; Sy, style. Insert: one
anther indicating the GUS activity in pollen. Bar = 100 µm.
been shown to increase expression of some water channel
proteins (Phillips and Huttly, 1994; Malz and Sauter, 1999).
Figure 4A shows that, incubation of the transgenic rice
leaves with 50 µmol/L GA also enhanced GUS activity by
28% of the control. Ancymidol (anc, Tanimoto, 1994), an
inhibitor of endogenous GA synthesis, on the contrary,
reduced GUS activity by 36% (Fig.4A).
Similarly, in transgenic rice calli, GUS activity was increased by 78%, 80%, and 92% of the control after 12, 24
and 48 h treatment with 50 µmol/L GA, respectively (Fig.
4B). On the other hand, anc, when added to the suspension
cells in a final concentration of 30 µmol/L, also decreased
Fig.4. Enhancement of RWC3 expression by GA. A. Effects of
GA and ancymidol on GUS activity in transgenic rice leaves. The
leaves were treated with 50 µmol/L GA and 30 µmol/L ancymidol,
respectively. Samples were taken out after certain period of treatment and frozen in liquid N2. Five µg of the extracted proteins
were used for GUS activity assay. B. Effect of GA on GUS
activity in callus. The transgenic rice calli were transferred to a
medium containing 50 µmol/L GA and growing for 12, 24 or 48 h,
respectively. Proteins were thereafter extracted for GUS activity
assay. C. Inhibition of expression of GUS by ancymidol and
recovery by GA in suspension cells. Three-week-old freshly cultured suspension cells (50 mL) were collected and re-cultured in
50 mL mannitol (146.1 mmol/L) media containing 30 µmol/L
ancymidol for a 24 h-pretreatment. The suspension cells were
then washed with media and divided into two groups for further
culture: one remained in 30 µmol/L ancymidol treatment, the other
one was added 50 µmol/L GA (final concentration). Samples were
taken out at certain periods for GUS activity assay. All the values
presented here are the mean ± SE of three independent
experiments.
１０６０
GUS activity (Fig.4C) as did in leaves (Fig.4A). The GUS
activity, as indicated by formation speed of 4-MU, was
about 0.11－0.15 nmol 4-MU.min－1.mg－1 protein in the absence of anc (Fig.5A, B), while it reduced to 0.05－0.07 nmol
4-MU.min－1.mg－1 protein after the 24 h anc treatment (Fig.
4C). Interestingly, this inhibition could be reversed by GA
treatment, with GUS activity reaching to 0.12 nmol 4-MU.
min－1.mg－1 protein after addition of 50 µmol/L GA (Fig.4C).
Inhibition of GUS expression by anc in rice leaves and suspension culture cells thus indicated that endogenous GA
could regulate the expression of RWC3.
Surprisingly, addition of GA (50 µmol/L) to the suspen-
Ａｃｔａ　Ｂｏｔａｎｉｃａ　Ｓｉｎｉｃａ　植物学报　Ｖｏｌ．４６　Ｎｏ．９　２００４
sion cell cultures did not induce the GUS activity. As shown
in Fig.5A, after 12 h culture in GA containing media, the
GUS activity had a slight increase, whereas the activity
remained almost the same as that without GA treatment
during further culture as long as 48 h. However, when the
same concentration of mannitol (146.1 mmol/L) was substituted for the sucrose in the culture media, addition of GA
was able to induce the GUS activity. Figure 5B shows that
it took longer time to recover the induction of GUS activity
by GA. Within 12 h culture, presence of GA did not benefit
the GUS activity, whereas the GUS activity was increased
by 47% within 48 h. The data suggested that sucrose in the
media inhibited the effect of GA on the expression of RWC3.
3 Discussion
Fig.5. Repression of the GA effect on RWC3 expression by
sucrose. A. No effect of GA on RWC3 expression in the suspension cells cultured in AA media. Three-weeks old freshly cultured
suspension cells (50 mL) were collected and re-cultured in 50 mL
medium containing 50 µmol/L GA. After 12, 24 or 48 h, the
suspension cells were collected by centrifugation for protein extraction and thereafter GUS activity assay. B. Recovery of the
role of GA in induction of RWC3 expression by substitution of
sucrose with mannitol. The similarly collected suspension cells
were re-cultured in the media with the same concentration of
mannitol instead of sucrose and supplemented with 50 µmol/L
GA. The GUS activity assay was performed as described above
after culturing 12, 24 or 48 h under such conditions. All the data
presented here were the average of three independent experiments
and the error bars represent SE.
RWC1 (OsPIP1a) and RWC3 in rice have been shown to
be able to induce increase of osmotic water permeability in
Xenopus oocytes by cRNA injection assay (Li et al., 2000;
Lian et al, 2004); and some of rice PIPs were also found to
be located primarily in rice roots and leaves (Malz and
Sauter, 1999; Li et al., 2000). Physiological investigations
further displayed that expression of these genes were affected by water-related environmental stresses (Li et al.,
2000; Kawasaki et al., 2001). Expression of RWC3 gene was
also found to be up-regulated by 20% PEG 6000 treatment
in drought-tolerant upland rice, whereas there was no
change of the gene expression in drought-sensitive lowland rice; overexpression of the gene in the lowland rice, on
the contrary, resulted in higher leaf water potential and
root osmotic hydraulic conductivity of the transgenic plants
under PEG treatment (Lian et al., 2004).
Previous results showed about 2-fold enhancement of
Xenopus oocyte water permeability by injection of RWC3
cRNA, demonstrating RWC3 protein is a functional water
channel protein (Lian et al., 2004). By investigation of the
GUS activity in the transgenic rice tissues, we found that
RWC3 protein expressed more broadly than any other reported rice aquaporins (Fig.3), from vegetative organs to
reproductive organs. RWC3 protein has the considerable
expression in root hairs (Fig.3A), root vascular bundles
(Fig.3A), elongation and mature zones (Fig.3B) of roots as
well as leaf vascular bundles (Fig.3D), which indicated
clearly its association with tissues where rapid cell growth
is occurring, and its involvement in root water uptake
(Ludevid et al., 1992; Kaldenhoff et al., 1995; Barrieu et al.,
1998; Chaumont et al., 1998; Karlsson et al., 2000) and facilitating water transport (Yamada et al., 1995; Schäffner,
1998; Karlsson et al., 2000; Frangne et al., 2001). Moreover,
RWC3 protein was found in flowers (Fig.3H) and seeds
SUN Mei-Hao et al.: Distribution of Water Channel Protein RWC3 and Its Regulation by GA and Sucrose in Rice (Oryza sativa)１０６１
(Fig.3E, F, G). Its expression in pollen (Fig.3H, Fukai et al.,
2001) suggested possible involvement in maturation of
pollen and in facilitating water absorption from the stigmatic surface during pollen germination; while high expression levels found in immature embryos (Fig.3G), immature
and mature seed coats (Fig.3E, F) suggested its roles in
seed maturation and germination as predicted by Gao et al.
(1999). The wide distribution and expression of RWC3 protein is in line with the findings which RWC3 protein provided rice for drought avoidance (Lian et al., 2004), and
strongly indicated its involvement in many biological
processes, playing crucial roles in the growth, development and reproduction of rice plant by controlling water
uptake and transport.
GA has been found to increase the expression of
aquaporin(s) in rice (Malz and Sauter, 1999) and Arabidopsis
(Phillips and Huttly, 1994; Kaldenhoff et al., 1996). Here GA
enhanced the GUS activity in the transgenic plant, suggesting that RWC3 was also probably increased by GA
(Figs.4,5B). It was assumed that the transcriptional enhancement of OsPIPs by GA was the results of water deficit created by GA-induced growth (Malz and Sauter, 1999). In
this study the presence of sucrose in the suspension cell
culture media is not only to keep osmotic balance, but also
to apply carbon source for the cells to keep growing.
Theoretically, addition of GA under this condition would
stimulate cells to grow, inducing water deficit-stimulated
enhancement of aquaporin expression if the assumption
was true. Our results, however, show that presence of sucrose repressed the RWC3 expression, while incubation of
the cells with the same concentration of mannitol for 48 h,
which caused unfavorable growth conditions of the cells,
stimulated the protein expression. The presence of GA ciselement in the promoter region of RWC3 (Fig.1; Guilfoyle,
1997) suggest a signaling of GA involving such stimulation
of the RWC3 expression, besides the water deficit-stimulated mechanism.
It had been revealed the cross-talk between sugar and
gibberellins signaling in modulating gene expression (Perata
et al., 1997; Sheen et al., 1999; Chen et al., 2002). In this
study, we observed that GA treatment of suspension-cultured cells did not result in increased expression unless
mannitol was substituted for sucrose in the AA suspension culture medium. This result lead us to think that the
response was either due to the sugars themselves (Sheen
et al., 1999) or to cell stress from starvation in the sucrose
deprived medium acting to affect the transcription of RWC3.
A glucose-starvation-related and putative water channel
protein cDNA, pZSS4, with 87% sequence homology to
RWC3 at amino acid level has been described (Chevalier et
al., 1995). pZSS4 transcription occurred both in glucosefed and starved root tips, and its transcription level seemed
to be unaffected by glucose concentration between 2.5 and
25 mmol/L, but higher glucose concentrations of 50, 100
and 200 mmol/L reduced its transcription level in root tips
(Chevalier et al., 1995). These results indicate sugars somehow affect pZSS4 and RWC3 transcription. A plausible
mechanism is the triggering of starch digestion by sugar
deprivation or low sugar concentration. Endogenous GA
levels would rise during this starch digestion, which promoting RWC3 transcription in addition. Sugar is known to
suppress GA levels and induction of amylase gene expression (Yu et al., 1996; Toyofuku et al., 1998; Loreti et al.,
2000). Sugar levels may play a similar role in the aquaporin
induction system. Further studies are needed to elucidate
the mechanism promoted by GA, the expression of RWC3
and the function of sugar in this process.
Acknowledgements: We thank Dr. HOU Cai-Xia for her
critical reading of the manuscript and helpful advice. We
thank the CAMBIA team of Australia for providing the
pCAMBIA1381Z promoter-testing vector. We also thank
Dr. GAO Xiao-Yan for his excellent technical assistance in
sample sectioning.
References:
Barrieu F, Thomas D, Marty-Mazars D, Charbonnier M, Marty
F. 1998. Tonoplast intrinsic proteins from cauliflower
(Brassica oleracea L. var. botrytis): immunological analysis,
cDNA cloning and evidence for expression in meristematic
tissues. Planta, 204: 335－344.
Bradford M M. 1976. A rapid and sensitive method for the
quantitation of protein utilizing the principle of protein-dye
binding. Anal Biochem, 72: 248－254.
Chaumont F, Barrieu F, Herman E M, Chrispeels M J. 1998.
Characterization of a maize tonoplast aquaporin expressed in
zones of cell division and elongation. Plant Physiol, 117: 1143－
1152.
Chaumont F, Barrieu F, Jung R, Chrispeels M J. 2000. Plasma
membrane intrinsic proteins from maize cluster in two sequence subgroups with differential aquaporin activity. Plant
Physiol, 122: 1025－1034.
Chaumont F, Barrieu F, Wojcik E, Chrispeels M J, Jung R. 2001.
Aquaporins constitute a large and highly divergent protein
family in maize. Plant Physiol, 125: 1206－1215.
Chen P W, Lu C A, Yu T S, Tseng T H, Wang C S, Yu S M. 2002.
１０６２
Ａｃｔａ　Ｂｏｔａｎｉｃａ　Ｓｉｎｉｃａ　植物学报　Ｖｏｌ．４６　Ｎｏ．９　２００４
Rice α-amylase transcriptional enhancers direct multiple mode
Maurel C. 2003. Role of a single aquaporin isoform in root
regulation of promoters in transgenic rice. J Biol Chem, 277:
water uptake. Plant Cell, 15: 509－522.
13641－13649.
Chevalier C, Bourgeois E, Pradet A, Raymond P. 1995. Molecu-
Jefferson R A. 1987. Assaying chimeric genes in plants: the GUS
gene fusion system. Plant Mol Biol Rep, 5: 387－405.
lar cloning and characterization of six cDNAs expressed dur-
Johanson U, Karlsson M, Johansson I, Gustavsson S, Sjovall S,
ing glucose starvation in excised maize (Zea mays L.) root
Fraysse L, Weig A R Kjellbom P. 2001. The complete set of
tips. Plant Mol Biol, 28: 473－485.
genes encoding major intrinsic proteins in Arabidopsis pro-
Dellaporta S L, Wood J, Hicks J B. 1983. A plant DNA
minipreparation: Version II. Plant Mol Biol Rep, 1: 19－21.
vides a framework for a new nomenclature for major intrinsic
protein in plants. Plant Physiol, 126: 1358－1369.
Dixit R, Rizzo C, Nasrallah M, Nasrallah J. 2001. The Brassica
Johansson I, Karlsson M, Johanson U, Larsson C, Kjellbom P.
MIP-MOD gene encodes a functional water channel that is
2000. The role of aquaporins in cellular and whole plant water
expressed in the stigma epidermis. Plant Mol Biol, 45: 51－62.
balance. Biochim Biophys Acta, 1465: 324－342.
Fetter K, van Wilder V, Moshelion M, Chaumont F. 2004. Inter-
Johansson I, Karlsson M, Shukla V K, Chrispeels M J, Larsson
actions between plasma membrane aquaporins modulate their
C, Kjellbom P. 1998. Water transport activity of the plasma
water channel activity. Plant Cell, 16: 215－228.
membrane aquaporin PM28A is regulated by phosphorylation.
Frangne N, Maeshima M, Schäffner A R, Mandel T, Martinoia E,
Plant Cell, 10: 451－459.
Bonnemain J L. 2001. Expression and distribution of a vacu-
Kaldenhoff R, Kolling A, Richter G. 1996. Regulation of the
olar aquaporin in young and mature leaf tissues of Brassica
Arabidopsis thaliana aquaporin gene AthH2 (PIP1b). J
napus in relation to water fluxes. Planta, 212: 270－278.
Photochem Photobiol (B), 36:351－354.
Fukai E, Nishio T, Nasrallah M E. 2001. Molecular genetic analy-
Kaldenhoff R, Kölling A, Meyers J, Karmann U, Ruppel G,
sis of the candidated gene for MOD, a locus required for self-
Richter G. 1995. The blue light-responsive AthH2 gene of
incompatibility in Brassica rapa. Mol Genet Genom, 265:
Arabidopsis thaliana is primarily expressed in expanding as
519－525.
well as in differentiating cells and encodes a putative channel
Gao Y P, Young L, Bonham-Smith P, Gusta L. 1999. Character-
protein of the plasmalemma. Plant J, 7: 87－95.
ization and expression of plasma and tonoplast membrane
Karlsson M, Johansson I, Bush M, McCann M C, Maurel C,
aquaporins in primed seed of Brassica napus during germina-
Larsson C, Kjellbom P. 2000. An abundant TIP expressed in
tion under stress conditions. Plant Mol Biol, 40: 635－644.
mature highly vacuolated cells. Plant J, 21: 83－90.
Gerbeau P, Amodeo G, Henzler T, Santoni V, Ripoche P, Maurel
Kawasaki S, Borchert C, Deyholos M, Wang H, Brazille S, Kawai
C. 2002. The water permeability of Arabidopsis plasma mem-
K, Galbraith D, Bohnert H J. 2001. Gene expression profiles
brane is regulated by divalent cations and pH. Plant J, 30: 71－
during the initial phase of salt stress in rice. Plant Cell, 13:
81.
889－905.
Gerbeau P, GüclüJ, Ripoche P, Maurel C. 1999. Aquaporin NtTIPa can account for the high permeability of tobacco cell
vacuolar membrane to small neutral solutes. Plant J, 18: 577－
587.
Guilfoyle T J. 1997. The structure of plant gene promoters. Genet
Eng News, 19: 15－47.
Kinya T, Kokichi H. 1985. Cell suspension and protoplast culture in rice. Plant Sci, 41: 179－183.
Kjellbom P, Larsson C, Johansson I, Karlsson M, Johanson U.
1999. Aquaporins and water homeostasis in plants. Trends
Plant Sci, 4: 308－314.
Li L, Li S, Tao Y, Kitagawa Y. 2000. Molecular cloning of a novel
Higuchi T, Suga S, Tsuchiya T, Hisada H, Morishima S, Okada Y,
water channel from rice: its products expression in Xenopus
Maeshima M. 1998. Molecular cloning, water channel activ-
oocytes and involvement in chilling tolerance. Plant Sci, 154:
ity and tissue specific expression of two isoforms of radish
43－51.
vacuolar aquaporin. Plant Cell Physiol, 39: 905－913.
Javot H, Lauvergeat V, Santoni V, Martin-Laurent F, GüçlüJ,
Vinh J, Heyes J, Franck K I, Schäffner A R, Bouchez D,
Lian H L, Yu X, Ye Q, Ding X S, Kitagawa Y, Kwak S S, Su W A,
Tang Z C. 2004. The role of aquaporin RWC3 in drought
avoidance in rice. Plant Cell Physiol, 45：481－489
SUN Mei-Hao et al.: Distribution of Water Channel Protein RWC3 and Its Regulation by GA and Sucrose in Rice (Oryza sativa)１０６３
Liu Q-Q, Zhang J-L, Wang Z-Y, Hong M-M, Gu M-H . 1998. A
1103－1111.
highly efficient transformation system mediated by
Schäffner A R. 1998. Aquaporin funtcion, structure, and
Agrobacterium tumefaciens in rice (Oryza sativa L.). Acta
expression: are there more surprises to surface in water
Phytophysiol Sin, 24: 259－271. (in Chinese with English
relations? Planta, 204: 131－139.
abstract)
Loreti E, Matsukura C, Gubler F, Alpi A, Yamaguchi J, Perata P.
Sheen J, Zhou L, Jang J C. 1999. Sugar as signal molecules. Curr
Opin Plant Biol, 2: 410－418.
2000. Glucose repression of amylase in barley embryos is
Southern E M. 1975. Detection of specific sequence among DNA
independent of GAMYB transcription. Plant Mol. Biol, 44:
fragments separated by gel electrophoresis. J Mol Biol, 98:
85－90.
503－517.
Ludevid D, Hofte H, Himelblau E, Chrispeels M J. 1992. The
Suga S, Imagawa S, Maeshima M. 2001. Specificity of the accu-
expression pattern of the tonoplast intrinsic protein γ-TIP in
mulation of mRNAs and proteins of the plasma membrane
Arabidopsis thaliana is correlated with cell enlargement. Plant
and tonoplast aquaporins in radish organs. Planta, 212: 294－
Physiol, 100: 1633－1639.
304.
Malz S, Sauter M. 1999. Expression of two PIP genes is rapidly
Sun M H, Xu W, Zhu Y F, Su W A, Tang Z C. 2001. A simple
growing enternodes of rice in not primarily controlled by mer-
method for in situ hybridization to RNA in guard cells of Vicia
istem activity or cell expansion. Plant Mol Biol, 40: 985－995.
faba L.: the expression of aquaporins in guard cells. Plant Mol
Maurel C, Chrispeels M J. 2001. Aquaporins: a molecular entry
into plant water relations. Plant Physiol, 125: 135－138.
Perata P, Matsukura C, Vernieri P, Yamaguchi J. 1997. Sugar
repression of a gibberellin-dependent signaling pathway in
barley embryos. Plant Cell, 9: 2197－2208.
Phillips A L, Huttly A K. 1994. Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive
hybridization: expression of tonoplast water channel, γ-TIP,
is increased by GA3. Plant Mol Biol, 24: 603－615.
Quigley F, Rosenberg J M, Shachar-Hill Y, Bohnert H J. 2002.
From genome to function: the Arabidopsis aquaporins. Genome Biol, 3: 1–17.
Sambrook F, Fritsch E F, Maniatis T. 1989. Molecular Cloning: a
Laboratory Manual. 2nd ed. Cold Spring Harbor, New York:
Cold Spring Harbor Laboratory Press.
Biol Rep, 19: 129－135.
Tanimoto E. 1994. Interaction of gibberellin A3 and ancymidol in
the growth and cell-wall extensibility of dwarf pea roots. Plant
Cell Physiol, 35: 1019－1028.
Toyofuku K, Umemura T, Yamaguchi J. 1998. Promoter elements
required for sugar-repression of the RAMY3D gene for α-amylase in rice. FEBS Lett, 428: 275－280.
Tyerman S D, Bohnert H J, Maurel C, Steudle E, Smith J A C.
1999. Plant aquaporins: their molecular biology, biophysics
and significance for plant water relations. J Exp Bot, 50: 1055－
1071.
Yamada S, Bohnert H J. 2000. Expression of the PIP aquaporin
promoter-MIPA from the common ice plant in tobacco. Plant
Cell Physiol, 41: 719－725.
Yamada S, Katsuhara M, Kelly W B, Michalowski C B, Bohnert
Santoni V, Gerbeau P, Javot H, Maurel C. 2000. The high diver-
H J. 1995. A family of transcripts encoding water channel
sity of aquaporins reveals novel facets of plant membrane
proteins: tissue-specific expression in the common ice plant.
functions. Curr Opin Plant Biol, 3: 476－481.
Plant Cell, 7: 1129－1142.
Sarda X, Tousch D, Ferrare K, Cellier F, Alcon C, Dupuis J M,
Yu Q, Du L, Hu Y, Lin Z. 2002. Cloning of the promoter region of
Casse F, Lamaze T. 1999. Characterization of closely related
plasma membrane aquaporin BnPIP1 from Brassica napus
delta-TIP genes encoding aquaporins which are differentially
and its functional analysis. Sci China (C), 46: 348－357.
expressed in sunflower roots upon water deprivation through
Yu S M, Lee Y C, Fang S C, Hwa S F, Liu L F. 1996. Sugars act as
exposure to air. Plant Mol Biol, 40: 179－191.
Sarda X, Tousch D, Ferrare K, Legrand E, Dupuis J M, CasseDdlbart F, Lamaze T. 1997. Two TIP-like genes encoding
signal molecules and osmotica to regulate the expression of αamylase genes and metabolic activities in germinating cereal
grains. Plant Mol Biol, 30: 1277－1289.
aquaporins are expressed in sunflower guard cells. Plant J, 12:
(Managing editor: HE Ping)