Biochem. J. (2010) 425, 235–243 (Printed in Great Britain)
235
doi:10.1042/BJ20091500
Regulatory factors controlling transcription of Saccharomyces cerevisiae
IXR1 by oxygen levels: a model of transcriptional adaptation from
aerobiosis to hypoxia implicating ROX1 and IXR1 cross-regulation
Raquel CASTRO-PREGO1 , Mónica LAMAS-MACEIRAS, Pilar SOENGAS, Isabel CARNEIRO, Isabel GONZÁLEZ-SISO and
M. Esperanza CERDÁN2
Departamento de Biologı́a Celular y Molecular, Facultad de Ciencias, Universidad de A Coruña, 15071, Spain
Ixr1p from Saccharomyces cerevisiae has been previously studied
because it binds to DNA containing intrastrand cross-links formed
by the anticancer drug cisplatin. Ixr1p is also a transcriptional
regulator of anaerobic/hypoxic genes, such as SRP1/TIR1,
which encodes a stress-response cell wall manoprotein, and
COX5B, which encodes the Vb subunit of the mitochondrial
complex cytochrome c oxidase. However, factors controlling
IXR1 expression remained unexplored. In the present study
we show that IXR1 mRNA levels are controlled by oxygen
availability and increase during hypoxia. In aerobiosis, low levels
of IXR1 expression are maintained by Rox1p repression through
the general co-repressor complex Tup1–Ssn6. Ixr1p itself is
necessary for full IXR1 expression under hypoxic conditions.
Deletion analyses have identified the region in the IXR1 promoter
responsible for this positive auto-control (nucleotides − 557 to
− 376). EMSA (electrophoretic mobility-shift assay) and ChIP
(chromatin immunoprecipitation) assays show that Ixr1p binds to
the IXR1 promoter both in vitro and in vivo. Ixr1p is also required
for hypoxic repression of ROX1 and binds to its promoter. UPC2
deletion has opposite effects on IXR1 and ROX1 transcription
during hypoxia. Ixr1p is also necessary for resistance to oxidative
stress generated by H2 O2 . IXR1 expression is moderately activated
by H2 O2 and this induction is Yap1p-dependent. A model of IXR1
regulation as a relay for sensing different signals related to change
in oxygen availability is proposed. In this model, transcriptional
adaptation from aerobiosis to hypoxia depends on ROX1 and IXR1
cross-regulation.
INTRODUCTION
hypoxic genes during aerobiosis [5–8]. Ixr1p has also been related
to aerobic and anaerobic repression of SRP1/TIR1 [9].
Ixr1p and Rox1p both control yeast genes that are differentially
expressed during aerobiosis or hypoxia and both contain HMG
(high-mobility group) motifs, which bind to and bend DNA [3,9–
11]. However, in contrast with ROX1, very little is known about
the conditions that influence IXR1 expression. We have found
that IXR1 expression is controlled by oxygen levels and in the
present work we have characterized transcriptional factors that
exert control upon its transcription during aerobiosis or hypoxia.
We have also demonstrated that auto-activation is necessary for
full IXR1 expression under hypoxic conditions and we have
delimited the region in the IXR1 promoter responsible for this
control. Ixr1p is also necessary for hypoxic repression of ROX1
and for resistance to oxidative stress generated by H2 O2 , a feature
that could be related to the physiological changes necessary for
adaptation from aerobiosis to hypoxia and opens new connections
between hypoxic and stress-induced regulons in S. cerevisiae.
Saccharomyces cerevisiae is probably the unicellular eukaryote
that has been most extensively studied by traditional and genomewide approaches. However, many questions about transcriptional
regulation, which may throw light on more complex systems,
still remain unanswered. This is particularly true in regard
to transcription factors that are structurally similar to other
eukaryotic proteins but have been little explored in terms of
function. The yeast Ixr1p protein [the IXR names refers to
intrastrand cross(X)-link recognition] was first characterized
during screening for SSRPs (structure-specific recognition
proteins) that bind to DNA containing intrastrand cross-links
formed by the anticancer drug cisplatin. It was suggested that
Ixr1p may have a role in mediating the cytotoxicity of cisplatin
[1]. In fact, Ixr1p blocks the excision repair of cisplatin–DNA
adducts in yeast [2,3]. The gene IXR1 (and known as ORD1)
was also identified by complementation of trans-acting mutants
defective in the aerobic repression of COX5B transcription [4].
Mutations in IXR1 cause aerobic de-repression of COX5B,
which encodes the hypoxic isoform of the subunit Vb of the
mitochondrial complex cytochrome c oxidase [4]. However, these
mutations do not affect the aerobic repression of other hypoxic
genes such as CYC7 and ANB1 [4], which form part of the ROX1
regulon, a well-studied system for aerobic repression of yeast
Key words: hypoxia, IXR1 transcriptional regulation, oxidative
stress, ROX1, Saccharomyces cerevisiae.
EXPERIMENTAL
Strains
The S. cerevisiae strains were obtained from EUROSCARF
(European S. cerevisiae archive for functional analysis;
Abbreviations used: AR1, anaerobic response element 1; ChIP, chromatin immunoprecipitaion; CM, complete synthetic medium; CM−Ura ,CM without
uracyl; EMSA, electrophoretic mobility-shift assay; ERG, ergosterol biosynthesis; HMG, high-mobility group; PNPG, p -nitrophenyl-α-D-galactopyranoside;
ROS, reactive oxygen species.
1
This paper is dedicated to Raquel Castro-Prego. She started this study as a PhD student and did not live to see the definitive version when a car
crash ended her life. We will always remember her joy, enthusiasm and friendship.
2
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2010 Biochemical Society
236
Table 1
R. Castro-Prego and others
Yeast strains used in the present study
Strain
Genotype
Source
W303
BWG1-7a
BY4741
BY4741rox 1
BY4741sut 1
BY4741sut 2
BY4741ixr 1
BY4741upc 2
BY4741ecm 22
BY4741yap 1
BY4741tup 1
BY4741ssn 6
BJ3505
Z1580
Z1465
MATa ade 2-1 can 1-100 leu2-3 ,112 trp 1-100 ura 3-52
MATa ade 1-100 leu2-2 ,112 his 4-519 ura 3-52
MATa his 31 leu20 met 150 ura 30
MATa his 31 leu20 met 150 ura 30 YPR065w ::kanMX4
MATa his 31 leu20 met 150 ura 30 YGL162w ::kanMX4
MATa his 31 leu20 met 150 ura 30 YPR009w ::kanMX4
MATa his 31 leu20 met 150 ura 30 YKL032c ::kanMX4
MATa his 31 leu20 met 150 ura 30 YDR213w ::kanMX4
MATa his 31 leu20 met 150 ura 30 YLR228c ::kanMX4
MATa his 31 leu20 met 150 ura 30 YML007w ::kanMX4
MATa his 31 leu20 met 150 ura 30 YCR084c ::kanMX4
MATa his 31 leu20 met 150 ura 30 YBR112cc ::kanMX4
pep4::HIS3 prb-Δ1.6R HIS3 lys2-2008 trp1-Δ101 ura3-52 gal2 can1
MATa ade 2-1 trp 1-1 can 1-100 leu2-3,112 his 3-11,15 ura 3 GAL+ psi+ IXR1:myc9::TRP1
MATa ade 2-1 trp1-1 can 1-100 leu2-3,112 his 3-11,15 ura 3 GAL+ psi+ ROX1:myc9::TRP1
[12]
[14]
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
Eastman Kodak Company
R.A. Young (Massachusetts Institute of Technology, Cambridge, U.S.A.) [13]
R.A. Young (Massachusetts Institute of Technology, Cambridge, U.S.A.) [13]
Table 2
Oligonucleotides used in the present study
Sequences added for restriction sites or recombination are in lower-case. Sequences which are underlined are restriction sites. W, Watson strand; C, Crick strand, n/a, not applicable.
Primer name
Sequence
Gene
Strand
Added
site
Hybridization
position
ECV325ED0
ECV326E
ECV569RD1
ECV570RD2
ECV571RD3
ECV572RD4
ECV573RD5
ECV613
ECV570M
ECV614M
ECV615M
ECV616
ECV617
ECV593M
ECV612
ECV651
ECV652
ECV686
ECV687
ART27
ART28
U3F
U3R
ggggagctcAACCAACGCCTGCACTTAAA
gggctcgagTTGTGGGTACTGTTAGCGTCG
ggggagctcAACAACAGCAACAATAGCACAAG
ggggagctcCCATAAAACATACACATCGTGCT
ggggagctcTTGGTGAGAGAACGAATGGG
ggggagctcAATGTGGTTTACTTCGTTATCCTCT
ggggagctcCCGAGACTGTGACGCTGAAG
CCCATTCGTTCTCTCACCAA
GGGGAGCTCCCATAAAACATACACATCGTGCT
CCGTGGAGGAATGGGTGGAACGGTTACTGACGACGGCCGCGCGGGGTTTTGTGTTGGGTGTGATGTCCGGATGCAACAGCAGCAAAGGA
TCCTTTGCTGCTGTTGCATCCGGACATCACACCCAACACAAAACCCCGCGCGGCCGTCGTCAGTAACCGTTCCACCCATTCCTCCACGG
ctatatcgtaatacaccaagctcgacctcgcgATGAACACCGGTATCTCGCC
ggtcgacgggcccggatccatcgatagatcttcacttgtcatcgtcatccttgtagtcTTCATTTTTTATGATCGAACCATT
AAGCCCAGCCTCAACAACAA
TGGTGAGTCAATTGAGGTTG
TTTTCCACCTCCCCTTGGTGAGAGAACGAATGGGAACAAAAAAAAAATGCACACATCAGCTGGTGG
tTTGGCTCCACCAGCTGATGTGTGCATTTTTTTTTTGTTCCCATTCGTTCTCTCACCAAGGGGAGGTGG
AACTTGGCGATTGCTGACA
GACCGTTACATTACGCAAAGTG
GACCCAAGAACGCATTTATT
TTGATTTGAATTGTTGATACTG
CGACGTACTTCAGTATGTAA
ATTTGTACCCACCCATAGAG
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
IXR1
ROX1
ROX1
ROX1
ROX1
SNR17A
SNR17A
W
C
W
W
W
W
W
W
C
W
C
W
C
W
C
W
C
W
C
W
C
W
C
SacI
XhoI
SacI
SacI
SacI
SacI
SacI
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
n/a
− 848
−6
− 667
− 557
− 376
− 258
− 164
− 566
− 357
− 520
− 432
+1
+ 1791
+ 161
+ 860
− 390
− 319
− 428
− 254
+ 35
+ 858
+3
+ 475
http://web.uni-frankfurt.de/fb15/mikro/euroscarf/) or from other
sources [12–14]. The BY4741 wild-type and the derivative
isogenic mutants in transcriptional regulators, as used in the
present study, are described in Table 1.
ergosterol and 0.5 % Tween 80. As a positive control for hypoxia
generation, induction of the hypoxic gene HEM13 was assessed
by Northern blotting in each experiment (results not shown).
Fusions to the reporter gene MEL1
Growth conditions
Yeast cells were grown at 30 ◦C in YPD medium [2 % (w/v)
glucose, 2 % (w/v) bacto-peptone and 1 % (w/v) yeast extract],
or in CM (complete synthetic medium) prepared as previously
described [15]; other media for particular applications are
as specified below. Hypoxic conditions (oxygen concentration
< 1 %) were generated in anaerobic jars with the GasPack EZAnaerobe system (Becton, Dickinson and Company) and under
these conditions the medium was supplemented with 20 mg/l
c The Authors Journal compilation c 2010 Biochemical Society
The promoter of IXR1 was fused in-frame to the MEL1
reporter gene, which encodes the enzyme α-galactosidase,
in the centromeric plasmid pMELα [Ampr MEL1 URA3] as
described in [16]. The primers ECV325ED0 and ECV326E
(Table 2) were used for PCR amplification. The forward
primer contained a SacI site and the reverse an XhoI site for
convenient cloning in pMELα, which was also digested with
the same enzymes. Standard procedures for manipulation of
nucleic acids were used. After ligation, the Escherichia coli
Transcriptional regulation of IXR1
strain DH10B was used for propagating the recombinant
plasmids by conventional techniques. The desired recombinants
were identified by PCR and restriction analysis. The selected
construct was finally verified by sequencing and the recombinant
vector, pIXR1::MEL1, was obtained. Other selected regions
of the IXR1 promoter were also fused to the reporter gene
MEL1 by the same procedure. The different promoter regions
(designated as D1–D5) were amplified by PCR using the specific
forward primers described in Table 2 and the reverse ECV326E
primer.
Protein extracts
Protein extracts were prepared as described previously [17] from
yeast cells incubated in CM under aerobic or hypoxic conditions
and the protein concentration was determined by the Bradford
method [18].
α-Galactosidase activity determination
The fusions to the reporter gene were used to transform several
S. cerevisiae strains (described in Table 1). Yeast cells were
transformed following the procedure of Ito et al. [19]. Independent
transformants were randomly picked and grown in CM−Ura
(CM without uracil) to a D600 of approx. 0.8. α-Galactosidase
activity was usually determined in chemically-permeabilized
cells as described previously [20] and at least three independent
experiments were performed. In brief, 5–10 ml of yeast cultures
were grown to an D600 between 0.5 and 1.5, and the D600 was
recorded. A 1 ml volume of cells was centrifuged at 14 000 g for
1 min and the pellet was resuspended in 200 μl of 20 mM Hepes,
pH 7.5, containing 10 mM dithiothreitol and 0.002 % sodium
dodecyl sulfate. Chloroform (50 μl) was added and the sample
was vortexed for 10 s. After a 5 min pre-equilibration at 30 ◦C,
800 μl of 7 mM PNPG (p-nitrophenyl-α-D-galactopyranoside;
Sigma–Aldrich) dissolved in buffer (77 mM Na2 HPO4 , pH 4,
containing 61 mM citric acid) was added and incubation at 30 ◦C
was continued. At various times, 100 μl aliquots were added to
900 μl of 0.1 M Na2 CO3 to stop the reaction and develop the
yellow colour characteristic of the cleaved product (which remains
colourless at pH 4). The reaction products were centrifuged for
5 min in a microcentrifuge and the A400 was determined. Units of
α-galactosidase activity are given as: A400 /[D600 ×time (min)×
ml]×1000, using samples taken at time points such that A400 <3.0.
When the strains were flocculent or low activities were expected,
the activity was determined on protein extracts as described
in [16] and expressed as nmol of PNPG per min per mg of
protein {A400 /[0.0182×time (min)×mg of protein]}. Statistical
analyses were carried out using the least-significant difference
test included in the Statgraphics Plus Package 2.1 with 95 %
confidence.
237
hybridization positions of these primers are described in Table 2.
After hybridization, the filters were washed twice for 10 min with
0.1 % SDS and 2× SSC (1× SSC is 0.15 M NaCl/0.015 M sodium
citrate) at the temperature selected for hybridization. Northern
blots were carried out in triplicate and radioactive blots were
exposed to PhosphorImager screens for quantification using the
ImageQuant program.
Ixr1p purification
The coding sequence of IXR1 was amplified with primers ECV616
and ECV617, which also contain sequences for recombining
in the YEpFLAG-1TM plasmid (Sigma–Aldrich), following the
manufacturer’s instructions. Ixr1p, fused to the FLAG peptide at
the C-terminus, was expressed in the yeast strain BJ3505. Cells
were grown at 30 ◦C for more than 48 h in YPHSM medium
[8 % (w/v) bactopeptone, 1 % (w/v) yeast extract, 3 % (v/v)
glycerol and 1 % (w/v) dextrose] until they reached an A600 of
6.0, coinciding with maximum expression of the YEpFLAG-1
vector. Cells were lysed in Tris-buffered saline (50 mM Tris/HCl,
pH 7.4, containing 150 mM NaCl). After centrifugation (15 min
at 8000 g), the protein was purified using anti-FLAG M2 agarose
(Sigma–Aldrich). Ixr1 was eluted with 150 ng/μl FLAG peptide
(Sigma–Aldrich) in Tris-buffered saline. Proteins were separated
by PAGE on 10 % gels.
EMSA (electrophoretic mobility-shift assay) assays
EMSA assays were carried out with the desired promoter
fragments obtained after annealing the complementary primers
ECV614M and ECV615M (IXR1 promoter from nucleotides
− 520 to − 432; − 1 is the nucleotide immediately upstream
of the first codon) or ECV651 and ECV652 (IXR1 promoter
from nucleotides − 390 to − 319). The fragments were labelled
by using the Klenow fragment with [α-32 P]dATP. The binding
reactions were carried out using protein extracts or the purified
Ixr1–FLAG protein as specified. With protein extracts, the
best results were obtained when the binding reactions were
performed at 30 ◦C for 20 min in buffer A {20 mM Hepes, pH 7.8,
containing 0.1M NaCl, 10 mM MgCl2 , 1 mM EDTA, 7 mM βmercaptoethanol and 10 % (v/v) glycerol; [17]} with at least
10 000 c.p.m. of labelled DNA, 15 μg of protein extract and
2 μg of calf thymus DNA as carrier. Binding reactions with the
purified Ixr1p were performed either on ice for 20 min in the
buffer as described by Lambert et al. [4] [4 mM Tris/HCl, pH 8.0,
containing 4 mM MgCl2 , 100 mM KCl and 12 % (v/v) glycerol]
or at 30 ◦C for 20 min in buffer A, using at least 10 000 c.p.m.
of labelled DNA and 2–3 μg of protein, with similar results. In
competition experiments, a large excess, 20- or 100-fold molar, of
the unlabelled promoter fragment (nucleotides − 520 to − 432)
was used as a specific competitor. A 100-fold molar excess of
non-labelled sonicated salmon sperm DNA was used as unspecific
competitor.
RNA isolation and Northern blotting
RNA was isolated and Northern blotting was performed as
described previously [21]. RNA blots were hybridized overnight
in buffer (0.5 M Na2 HPO4 , pH 7.2, containing 7 % (w/v) SDS
and 1 mM EDTA) at a temperature appropriate for the length and
composition of the DNA probe. The IXR1 probe was obtained
by PCR amplification of genomic DNA with the ECV593M
and ECV612 primers. The ROX1 probe was amplified with
primers ART27 and ART28. Results were normalized for RNA
loading against the signal obtained from the control probe
SNR17A amplified with primers U3F and U3R. The sequences and
ChIP (chromatin immunoprecipitation) assays
Protein extracts were prepared from cells of the strains Z1580 and
Z1465 (Table 1) grown in aerobiosis or hypoxic conditions. These
strains express c-Myc-tagged Ixr1p and Rox1p respectively,
as described previously [13]. The ChIP assays were carried
out as described previously [13] with magnetic Dynabeads
(Invitrogen) following the manufacturer’s instructions and using
anti-(c-Myc) antibodes (sc47694; Santa Cruz Biotechnology)
for specific Ixr1p–c-Myc or Rox1p–c-Myc immunoprecipitation.
c The Authors Journal compilation c 2010 Biochemical Society
238
Figure 1
R. Castro-Prego and others
Transcriptional regulation of IXR1 and ROX1 expression
(A) Nothern blots showing the effect of ROX1, SUT1, SUT2, ECM22 and UPC2 disruption
on IXR1 mRNA expression. (B) Nothern blots showing the effect of IXR1, ECM22 and UPC2
disruption on ROX1 mRNA expression. The Northern blots were carried out in triplicate and
a representative picture is shown. The blots were normalized with reference to the SNR17A
signal in order to compare the expression levels under different conditions. The intensity of the
wild-type (wt) strain in aerobiosis was set as 1 and was used as the reference to calculate
the relative values of the other signals, which are shown under the appropriate blots. Values are
means, calculated from the three independent blots.
Negative controls, with rabbit IgG immunoprecipitation, were
also performed. The promoter region of IXR1, from nucleotides
− 566 to − 357, was amplified by PCR with primers ECV570M
and ECV613 (Table 2). The promoter region of ROX1, from
nucleotides − 428 to − 254, was amplified by PCR with primers
ECV686 and ECV687 (Table 2). After optimization of PCR
conditions, the percentage of immunoprecipitated DNA from
the specific IXR1 and ROX1 promoter regions was calculated
in duplicate using the Quantity One 4.5.0 software from
Bio-Rad (by dividing the amount of PCR product obtained
with immunoprecipitated DNA by the amount obtained with
total DNA isolated from sheared chromatin and kept as
input).
RESULTS
IXR1 expression is repressed by Rox1p and other related factors
during aerobiosis and it is increased during hypoxia
Although in the last few years a certain number of genome-wide
analyses on oxygen regulated genes have been performed [6,22–
24], transcriptional regulation of IXR1 expression by oxygen
levels has not been reported. Taking into account the role of Ixr1p
as a transcriptional regulator of several anaerobic/hypoxic genes
[4,9] we decided to directly test the existence of this regulation by
Northern blotting and fusion of the IXR1 promoter to the MEL1
reporter gene.
Northern analyses were carried out on the S. cerevisiae strain
BY4741 and a series of haploid isogenic S. cerevisiae strains obtained from the EUROSCARF collection with specific deletions
of genes coding for transcriptional regulatory factors that have
previously been related to the aerobic–hypoxic response in yeast.
In these assays, IXR1 expression was detectable during aerobiosis
but increased 1.8-fold during hypoxia (Figure 1A).The proteins
Ixrlp and Rox1p are related to transcriptional regulation of
aerobic–hypoxic genes in S. cerevisiae although their targets are
different [4,9,25]. Interestingly, ROX1 and IXR1 are oppositely
c The Authors Journal compilation c 2010 Biochemical Society
regulated in response to oxygen availability, ROX1 being upregulated in aerobic conditions as reported previously [10,25]
with IXR1 being up-regulated during hypoxia (the present
study).
We also confirmed the hypoxic induction of IXR1 by a second
approach. To this purpose, the IXR1 promoter was fused inframe to the MEL1 reporter gene in the plasmid pMELα and
the S. cerevisiae strains BY4741, BWG1-7a and W303 (which
are wild-type with respect to IXR1; Table 2) were transformed
with this construct. Cells were grown in aerobiosis and hypoxia
to D600 of approx. 0.8–1.2 and harvested for determination of αgalactosidase activity. Hypoxic induction was present in all of the
yeast strains; the BY4741 transformants in aerobic conditions αgalactosidase activity was recorded as 0.03 +
− 0.01 units, which
increased to 18.00 +
− 1.00 units in hypoxia, for BWG1-7a the
increase was from 0.02 +
− 0.01 units to 1.25 +
− 0.50 units and
for W303 from 0.04 +
− 0.02 to 4.60 +
− 0.90 units. Differences
between strains are probably attributable to the different genetic
backgrounds, which might affect the hypoxic response, whereas
as the variability between the IXR1 induction ratios within strains
might be caused by the different stability of the IXR1 or MEL1
transcripts.
The results in Figure 1(A) show that under aerobiosis
IXR1 expression was increased 2.1-fold in the Δrox1 strain.
Low expression of IXR1 under aerobic conditions is therefore
attributable to repression exerted by Rox1p. Several promoters
of yeast genes, which are known to be repressed by Rox1p,
bind the co-repressor complex Tup1p–Ssn6p [7,8,26]. The
wild-type strain BY4741 and two derivatives, Δtup1 and
Δssn6, were therefore transformed with the reporter construct
pIXR1::MEL1. Aerobic expression of IXR1 (0.03 +
− 0.01 αgalactosidase units) was significantly increased in these two
S. cerevisiae mutant strains (1.00 +
− 0.03 α-galactosidase units
in Δtup1 and 2.00 +
− 0.04 in Δssn6), thus confirming the role of
Rox1p in the control of IXR1 expression.
Hypoxic IXR1 expression did not significantly change in the
Δsut1 or Δsut2 strains (Figure 1A). Therefore, IXR1 hypoxic
induction is not dependent on Sut1p and Sut2p. SUT1 is a hypoxic
gene encoding a nuclear protein with a zinc finger from the
Zn[II]2 Cys6 family and it has been shown to be involved in
the transcriptional induction of hypoxic genes (e.g. DAN1)
when the cells are shifted from aerobiosis to anaerobiosis [27,28].
SUT2 is homologous to SUT1 and both genes are also involved
in sterol uptake [27]. It has been proposed that the transcriptional
induction of hypoxic genes is via a physical interaction between
Sut1p and Ssn6p, releasing the aerobic repression caused by
the Tup1p–Ssn6p complex [28]. However, this competitive
mechanism does not explain the observed increase in IXR1
transcription during hypoxia, as the mRNA levels in this condition
did not differ greatly between the Δsut1 or Δsut2 mutants and the
wild-type strain BY4741 (Figure 1A).
Aerobic and hypoxic expression of IXR1 depends alternatively on
the transcriptional activators Ecm22p and Upc2p
In order to determine whether the increased hypoxic expression
of IXR1 was mediated by Upc2p and/or Ecm22p (transcriptional
factors previously proposed as positively regulating hypoxic or
anaerobic genes in S. cerevisiae) IXR1 expression was analysed by
Northern blotting in strains deficient in the regulators Upc2p and
Ecm22p. Upc2p was first characterized as a hypoxic activator of
the anaerobic DAN genes [29] and UPC2 expression increases in
oxygen-limited conditions [12,30]. The sequences of Ecm22p and
Upc2p are similar and these factors are known to be responsible
Transcriptional regulation of IXR1
239
for the basal and induced expression respectively of yeast ERG
(ergosterol biosynthesis) genes [12]. Synthesis of sterols and
haem depend upon molecular oxygen, so their intracellular
levels are potentially indicators of oxygen levels in the cellular
environment [12]. The results shown in Figure 1(A) indicate
that Upc2p and Ecm22p act differently upon IXR1 expression
under aerobic and hypoxic conditions; Ecm22p was necessary for
full aerobic expression and Upc2p for full hypoxic expression.
The role of Upc2p in hypoxic activation of IXR1 was also
confirmed by a second experimental approach. The wild-type
strain BY4741 and its derivative Δupc2 were transformed with
the reporter construct pIXR1::MEL1. IXR1 hypoxic expression,
was significantly decreased in the Δupc2 strain, from 18 +
− 1.00
to 10.00 +
0.03
α-galactosidase
units.
−
Ixr1p is necessary for hypoxic repression of ROX1, and Upc2p
controls the aerobic/hypoxic expression of ROX1 and IXR1
respectively
As Rox1p contributes to the transcriptional regulation of IXR1
(Figure 1A), and transcription of ROX1 and IXR1 are oppositely
regulated by oxygen, we decided to test whether Ixr1p might also
control ROX1 expression. Figure 1(B) shows that hypoxic ROX1
expression was increased 5.3-fold in the Δixr1 strain compared
with the wild-type strain (3.2 compared with 0.6).
Taking into account our results showing Upc2p and Ecm22p
are important for IXR1 expression during the change from
aerobiosis to hypoxia, we also used the Δupc2 and Δecm22
strains in the Northern analysis of ROX1 expression (Figure 1B).
The results revealed new interconnections among the regulatory
factors Upc2p, Ixr1p and Rox1p. Upc2p controls the hypoxic
expression of ROX1 and IXR1 in opposite ways; during hypoxia
the strain Δupc2 shows increased ROX1 expression (Figure 1B)
and decreased IXR1 expression (Figure 1A).
Ixr1p and the hypoxic induction of IXR1
Some transcriptional factors related to the aerobic–hypoxic
response in yeast are known to exert regulatory control upon
their own transcription. This is the case with Rox1p, which
maintains negative retro-control under aerobic conditions [31],
and Hap1p, which in monomer form represses its own promoter
during anaerobiosis [32]. In view of these precedents, we decided
to investigate whether IXR1 expression was auto-regulated.
The wild-type strain BY4741 and its derivative ixr1 were
transformed with the pIXR1::MEL1 construct and α-galactosidase
activity was measured in the transformed cells under aerobic and
hypoxic conditions. The hypoxic induction of the IXR1 reporter
was absent in the Δixr1 strain (Figure 2A) and this result indicated
that Ixr1p did also regulate the IXR1 promoter. However, it had
no effect during aerobiosis (results not shown).
To further elucidate the mechanism of Ixr1p auto-regulation, we
performed deletion analyses of the IXR1 promoter to identify the
region necessary for hypoxic expression of Ixr1p. Serial deletions
of the IXR1 promoter (called D0–D5) were obtained by using
PCR. The exact start nucleotide of each deletion is represented
in Figure 2(B) and all constructs extended to the nucleotide at
− 6. Reporter activity was measured in the transformants and the
results revealed that the region extending from nucleotides − 557
to − 376 is the most important for hypoxic expression of IXR1
(Figure 2B). In silico analysis of this region with RSA (regulatory
sequence analysis) tools (http://liv.bmc.uu.se/rsa-tools/) revealed
that it contains AR1 (anaerobic response element 1) sequences for
putative binding of Ecm22p or Upc2p [29] and also two sequences
Figure 2 Analysis of the IXR1 promoter region involved in the Ixr1p hypoxic
activation
IXR1 expression during aerobiosis and hypoxia was measured using MEL1 under the
control of the IXR1 promoter as the reporter gene. Transformed yeast cells were grown in
CM−Ura under hypoxic conditions, as defined in the Experimental section, until the D 600
reached 0.8–1.0. α-Galactosidase activity was assayed in permeabilized cells. (A) Effect
of IXR1 disruption on the activity of the IXR1 promoter fused to the reporter gene MEL1
(pIXR1::MEL1) in hypoxic conditions. pMELα, control plasmid. (B) Hypoxic expression of
MEL1 under the control of different regions of the IXR1 promoter. The first nucleotide in the
promoter fragment in the reporter constructs (D0 to D5) is indicated in brackets relative to
the transcription start site. pMELα, control plasmid. (C) Sequence of the IXR1 promoter
section that is important for hypoxic expression. Putative AR1-binding (box) and IXR1-binding
(underlined) sequence(s) are marked in the figure. Bold upper-case letters represents coincidence
with the consensus sequnce [29,33].
with similarity to the consensus AArcmrgRAGCGGkG (uppercase represents the core, more conserved sequence, and lowercase the more poorly conserved sequence) for Ixr1p binding [33]
(Figure 2C).
To test the binding of Ixr1p to the IXR1 promoter, the protein
was purified using the YEpFLAG-1TM system (Figure 3A). EMSA
assays showed that Ixr1p binds in vitro to the IXR1 promoter
region extending from nucleotides − 520 to − 432 (Figure 3B),
which is consistent with the area determined as important for
hypoxic induction in the deletion analyses (Figure 2B). The
retarded band was obtained under two different assay conditions
(Figure 3B, lanes W) and was not obtained using a promoter
region extending from nucleotides − 390 to − 319 used as
negative control (Figure 3B, lane N). The retarded band is
specific, as shown by the competition experiments depicted in
Figure 3(C). EMSA assays were also performed with total protein
extracts obtained from wild-type and Δixr1 mutant cells grown
under aerobiosis and hypoxia and a labelled DNA fragment
including the IXR1 promoter region extending from nucleotides
− 520 to − 432 (Figure 3D). These results showed a specific
band that did not appear in the Δixr1 strain. This retarded
band was observed under both aerobic and hypoxic conditions
(Figure 3D).
In vivo binding of Ixr1p and Rox1p to the IXR1 and ROX1 promoters
In order to further support the results on IXR1 hypoxic autoinduction, Ixr1p binding to the IXR1 promoter and IXR1 and
ROX1 cross-regulation ChIP assays were carried out with the
c The Authors Journal compilation c 2010 Biochemical Society
240
Figure 3
R. Castro-Prego and others
In vitro binding of Ixr1p to the IXR1 promoter
(A) Purification of Ixr1p with the YEpFLAG-1TM system. M, molecular mass markers; 1, first enriched eluate; 2, second purified eluate. The expected size of Ixr1p is indicted. (B) EMSA assays
carried out with 3 or 2 μg purified Ixr1p factor as indicated. C, control without protein; W, binding reaction with the labelled DNA fragment IXR1 promoter extending from nucleotides − 520
to − 432; N, negative control, binding reaction with the labelled DNA fragment of the IXR1 promoter extending from nucleotides − 390 to − 319. The temperature at which the reaction was
performed is also indicated. rt, room temperature (17 ◦C). (C) Competition EMSA experiments. C, control without protein; W, binding without competitor; U, binding in the presence of an
unspecific competitor; S × 20, binding in the presence of a specific competitor with a 20-fold molar excess; S × 100, binding in the presence of a specific competitor in 100-fold molar
excess. Unspecific and specific competitors are defined in the Experimental section. (D) EMSA assays carried out with protein extracts from wild-type (wt) or Δixr1 yeast cells grown in
aerobiosis or hypoxia and using a labelled DNA fragment extending from nucleotides − 520 to − 432 in the IXR1 promoter. The retarded band obtained in each experiment is indicated by an
arrow.
yeast strains Z1580 (expressing c-Myc-tagged Ixr1p) and Z1465
(expressing c-Myc-tagged Rox1p) grown in aerobic and hypoxic
conditions. The IXR1 promoter region selected to test the binding
of the transcriptional regulators included the section previously
characterized as the in vitro Ixr1p-binding site (Figure 3). The
ROX1 promoter region selected in these assays (from nucleotides
− 428 to − 254) had also been previously shown as necessary for
Rox1p binding and involved in aerobic Rox1p auto-repression
[31].
Figure 4(A) shows that Ixr1p bound to the IXR1 promoter and
that the binding was quantitatively higher during hypoxia than
during aerobiosis. This is in accordance with the induced IXR1
hypoxic transcription and with the role of Ixr1p as auto-inducer
of the IXR1 promoter in this condition. Figure 4(A) also show
that Rox1p binds to the IXR1 promoter, but in this case its binding
was higher during aerobic conditions, as expected given ROX1
transcription is aerobically induced [31].
Binding of Ixr1p to the ROX1 promoter also increased during
hypoxia in contrast with Rox1p, which binds the ROX1 promoter
principally during aerobiosis (Figure 4B).
Ixr1p and the oxidative stress response mediated by peroxides
Several connections between the hypoxic and the oxidative stress
responses in S. cerevisiae have previously been reported [34].
In the search for new functions of IXR1, we verified that Ixr1p
is related to the oxidative stress response. The wild-type strain
BY4741 and its derivatives ixr1 and Δyap1 (a positive control
for sensitivity to peroxides) were grown in CM. From these initial
cultures, serial dilutions were prepared and cells were grown on
CM plates with various concentrations of H2 O2 . The strain ixr1
was less resistant to oxidative stress caused by 1 or 2 mM H2 O2
(Figure 5A), so Ixr1p is important for conferring resistance to
such stress.
c The Authors Journal compilation c 2010 Biochemical Society
The wild-type strain BY4741 and its derivative yap1 were
transformed with the pIXR1::MEL1 construct and grown in
CM−Ura . α-Galactosidase activity was determined before and after
addition of 1 mM H2 O2. As shown in Figure 5(B), there was a
3–4-fold induction in reporter activity by H2 O2 in the wild-type
transformed cells which was absent in the yap1 strain. As Yap1p
is a transcriptional activator of genes regulated by oxidative stress
[35], this suggests that the induction of IXR1 by H2 O2 is mediated
by Yap1p.
DISCUSSION
The regulation of Ixr1p transcription is of general interest not
only for the yeast community, but also for clinical researchers
because Ixr1p mediates the cytotoxicity of the anticancer
drug cisplatin in yeasts [1]. Ixr1p has similarities to other
HMG proteins from various species, including Rox1p from
S. cerevisiae and the human HMG proteins B1 (Swiss-Prot
accession number P09429) and B2 (Swiss-Prot accession number
P26583). In humans, a nuclear protein complex containing B1,
B2 and other factors is involved in the cytotoxic response
to DNA modified by incorporation of anticancer nucleoside
analogues [36]. Moreover, the HMG protein B1 interacts
with sterol-regulatory-element-binding proteins to enhance their
DNA binding [37], and it has recently been suggested that
it functions as a new cofactor for HNF (hepatocyte nuclear
factor)-1α [38]. The study of the mechanism of yeast IXR1
transcriptional regulation will hopefully offer further avenues
to advance understanding on similar processes in its human
homologues.
The present study shows that IXR1 mRNA levels in S. cerevisiae
are controlled by oxygen availability, increasing during hypoxia.
During aerobiosis, low levels of IXR1 expression are maintained
by Rox1p (Figure 1A). In the present paper we also show that
Transcriptional regulation of IXR1
Figure 4
In vivo binding of Ixr1p and Rox1p to the IXR1 and ROX1 promoters
(A) ChIP experiment to demonstrate binding to the IXR1 promoter. (B) ChIP experiment
to demonstrate binding to the ROX1 promoter. ChIP experiments were performed as
described in the Experimental section. I, ChIP using strain Z1580, expressing the
c-Myc-tagged Ixr1p; R, ChIP using strain Z1465, expressing the c-Myc-tagged Rox1p; A,
aerobiosis culture; H, hypoxic culture condition. Addition or omission of rabbit anti-IgG
antibody or the specific anti-(c-Myc) antibody (Ab) to the immunoprecipitation reactions
is indicated by + or − . IN, PCR amplification from input; IP, PCR amplification from
immunoprecipitates.
Ixr1p is necessary for the expression of IXR1 during hypoxia.
The IXR1 promoter region from nucleotides − 557 to − 376
is necessary for hypoxic expression (Figure 2) and contains
two sequences that resemble the degenerate consensus proposed
for Ixr1p binding [33]. Purified Ixr1p specifically binds to the
region containing those sequences (Figures 3B and 3C). Using
whole cell extracts we found that the same band is formed
during both aerobiosis and hypoxia (Figure 3D). ChIP assays
indicate that Ixr1p binds in vivo to the IXR1 promoter in
aerobiosis and that binding increases during hypoxia (Figure 4A).
The fact that Ixr1p also binds to the IXR1 promoter during
aerobiosis suggests that a structural modification in the regulator
and/or interactions with other proteins may be necessary in
order to produce the change to an activating hypoxic form,
but further experimental work will be required to confirm this
hypothesis.
As Rox1p represses IXR1 during aerobiosis (Figure 1A) and
Ixr1p represses ROX1 during hypoxia (Figure 1B), we propose
a model of transcriptional adaptation from aerobiosis to hypoxia
that involves cross-regulation between ROX1 and IXR1. Such a
241
cross-regulation model is also supported by the observed in vivo
binding to their respective promoters (Figures 4A and 4B). It is
interesting to note that Ixr1p and Rox1p are two HMG proteins,
which regulate transcription of specific groups of aerobic and
hypoxic target genes, and therefore their cross-regulation has wide
consequences in the adaptation of yeast cells from aerobiosis to
hypoxia.
The shift between transcriptional regulation, mediated by
Rox1p or Ixr1p, might be related to other signals in the transition
from aerobiosis to hypoxia. We have found that Ecm22p and
Upc2p activate IXR1 transcription during aerobiosis and hypoxia
respectively (Figure 1A) and that Upc2p represses, directly
or indirectly, ROX1 transcription during hypoxia (Figure 1B).
Upc2p and Ecm22p regulate the expression of many of the ERG
genes [39,40], as well as the transcription of several hypoxically
expressed genes, including genes involved in anaerobic cell wall
reorganization and anaerobic sterol uptake [30,41,42]. Although
UPC2 expression increases during hypoxia, this increase is
reportedly a consequence of sterol depletion rather than of haem
decrease [12]. It has been suggested that Upc2p and Ecm22p
share similar functions but act at different times. Ecm22p is
generally more abundant at target promoters; however, when
sterols are depleted, Ecm22p levels drop and Upc2p replaces it
[43].
A summary of the different regulators that control IXR1
expression during aerobiosis and hypoxia is depicted in Figure 6.
In aerobiosis, it has been previously reported that transcription
of IXR1 is necessary to preclude expression of hypoxic genes
[4,9]. According to the results in the present paper, this
low-level IXR1 expression depends on a balance between
repression, mediated via Rox1p acting on the IXR1 promoter,
and activation of the promoter, mediated via Ecm22p. During
transition from aerobic to hypoxic growth, Ecm22p could be
replaced by Upc2p as reported previously [43]. This, together
with the Ixr1p auto-activation mechanism, would increase
IXR1 expression and ROX1 repression and hence adaptation to
hypoxia.
Until now, our knowledge of the function of Ixr1p as a
transcriptional regulator was mostly limited to a repressor effect
over hypoxic genes under aerobic conditions thus preventing their
function [4,9]. The fact that IXR1 expression increases during
hypoxia suggests it has further functions. This hypoxic function
of IXR1 is not essential for the cells because the null strain
ixr1::kanMX4 is able to grow in hypoxia with an ergosterol
supplement (results not shown). It has been reported that the
mRNA levels of several stress-response genes in S. cerevisiae also
increase during hypoxia [6,34,44]. While searching for a growthrelated phenotype in the IXR1 knockout strain, we found that
Ixr1p is also necessary for resistance to oxidative stress generated
by H2 O2 (Figure 5A). A target of Ixr1p, the hypoxic gene SRP1,
which is repressed by Ixr1p under aerobic conditions, has also
been shown to be regulated by Yap1p during hypoxia [9]. In our
α-galactosidase assays (Figure 5B) we found that IXR1 expression
is moderately activated by H2 O2 and this induction is Yap1pdependent.
In conclusion, the IXR1 promoter is controlled directly
or indirectly by different regulators that have previously
been implicated in transcriptional control upon changes in
oxygen concentration. As a consequence of changes in oxygen
availability, the cellular levels of haem, sterol and ROS (reactive
oxygen species) are altered. The IXR1 promoter may serve as
a relay sensing the global input of these individual changes,
integrating the haem signal through Rox1p, the sterol signal
through Ecm22p and the Upc2p and the ROS signal through
Yap1p.
c The Authors Journal compilation c 2010 Biochemical Society
242
Figure 5
R. Castro-Prego and others
IXR1 expression and oxidative stress caused by peroxides
(A) Resistance to H2 O2 in the wild-type (wt), ixr1 and yap1 strains. Serial dilutions of the cells (1, 10 −1 , 10−2 , 10−3 , 10−4 , 10−5 ; from left to right) were made from an initial culture of
D 600 = 0.05 and were grown at 30 ◦C for three days on CM plates (- - -) or CM plates with different concentrations of H2 O2 as specified. (B) Expression of the reporter gene MEL1 under the IXR1
promoter after H2 O2 treatment and in wild-type (wt) and yap1 strains. An aliquot of culture at D 600 =0.8 was saved for further analysis (0 min) and H2 O2 was added to the medium to a final
concentration of 1 mM. New aliquots were collected 15, 30, 45 and 60 min later and α-galactosidase activity determined. pMELα, control plasmid.
construction used in Ixr1p purification and performed the protein purifications. Isabel
Carneiro carried out the protein extractions, Western analysis and ChIP assay.
Isabel González-Siso and M. Esperanza Cerdán designed the study and the wrote the
manuscript.
FUNDING
This research was supported by the Ministerio de Ciencia e Innovación, co-financed by
FEDER (CEE) [grant numbers BFU2006–03961, BFU2009–08854]; and by the Xunta de
Galicia [grant number CONSOLIDACION C. E. O. U. 2008/008].
REFERENCES
Figure 6
Model of the aerobic and hypoxic control of IXR1 expression
Factors that directly or indirectly control IXR1 transcription in aerobiosis or hypoxia and IXR1
and ROX1 cross-regulation. See the Discussion section for further details.
ACKNOWLEDGEMENTS
We thank BioMedES (http://www.biomedes.co.uk/) for revision of the English
language. We thank Professor Richard A. Young (Massachusetts Institute of Technology,
Cambridge, U.S.A.) for the S. cerevisiae strains Z1580 and Z1465. We also thank Emilie
Dambroise, a student from the Erasmus exchange programme, who initially helped in the
construction of pIXR1::MEL1.
AUTHOR CONTRIBUTION
Raquel Prego made the constructs for the analysis of the IXR1 promoter, tested
their activity in different conditions and mutant strains and carried out the statistical
analysis of data. She also tested the Δixr1 phenotypes. Mónica Lamas-Maceiras
performed the Northern blotting and EMSA assays. Pilar Soengas made the
c The Authors Journal compilation c 2010 Biochemical Society
1 Brown, S. J., Kellett, P. J. and Lippard, S. J. (1993) Ixr1, a yeast protein that binds to
platinated DNA and confers sensitivity to cisplatin. Science 261, 603–605
2 McA’Nulty, M. M. and Lippard, S. J. (1996) The HMG-domain protein Ixr1 blocks
excision repair of cisplatin–DNA adducts in yeast. Mutat. Res. 362, 75–86
3 McA’Nulty, M. M., Whitehead, J. P. and Lippard, S. J. (1996) Binding of Ixr1, a yeast
HMG-domain protein, to cisplatin–DNA adducts in vitro and in vivo . Biochemistry 35,
6089–6099
4 Lambert, J. R., Bilanchone, V. W. and Cumsky, M. G. (1994) The ORD1 gene encodes a
transcription factor involved in oxygen regulation and is identical to IXR1, a gene that
confers cisplatin sensitivity to Saccharomyces cerevisiae . Proc. Natl. Acad. Sci. U.S.A.
91, 7345–7349
5 Kastaniotis, A. J. and Zitomer, R. S. (2000) Rox1 mediated repression. Oxygen dependent
repression in yeast. Adv. Exp. Med. Biol. 475, 185–195
6 Becerra, M., Lombardı́a-Ferreira, L. J., Hauser, N. C., Hoheisel, J. D., Tizón, B. and
Cerdán, M. E. (2002) The yeast transcriptome in aerobic and hypoxic conditions: effects
of hap1, rox1, rox3 and srb10 deletions. Mol. Microbiol. 43, 545–555
7 Sertil, O., Kapoor, R., Cohen, B. D., Abramova, N. and Lowry, C. V. (2003) Synergistic
repression of anaerobic genes by Mot3 and Rox1 in Saccharomyces cerevisiae . Nucleic
Acids Res. 31, 5831–5837
Transcriptional regulation of IXR1
8 Klinkenberg, L. G., Mennella, T. A., Luetkenhaus, K. and Zitomer, R. S. (2005)
Combinatorial repression of the hypoxic genes of Saccharomyces cerevisiae by DNA
binding proteins Rox1 and Mot3. Eukaryotic Cell 4, 649–660
9 Bourdineaud, J. P., De Sampaio, G. and Lauquin, G. J. (2000) A Rox1-independent
hypoxic pathway in yeast. Antagonistic action of the repressor Ord1 and activator Yap1 for
hypoxic expression of the SRP1/TIR1 gene. Mol. Microbiol. 38, 879–890
10 Deckert, J., Rodriguez Torres, A. M., Simon, J. T. and Zitomer, R. S. (1995) Mutational
analysis of Rox1, a DNA-bending repressor of hypoxic genes in Saccharomyces
cerevisiae . Mol. Cell. Biol. 15, 6109–6117
11 Deckert, J., Khalaf, R. A., Hwang, S. M. and Zitomer, R. S. (1999) Characterization of the
DNA binding and bending HMG domain of the yeast hypoxic repressor Rox1. Nucleic
Acids Res. 27, 3518–3526
12 Davies, B. S. and Rine, J. (2006) A role for sterol levels in oxygen sensing in
Saccharomyces cerevisiae . Genetics 174, 191–201
13 Lee, T. I., Rinaldi, N. J., Robert, F., Odom, D. T., Bar-Joseph, Z., Gerber, G. K., Hannett,
N. M., Harbison, C. T., Thompson, C. M., Simon, I. et al. (2002) Transcriptional regulatory
networks in Saccharomyces cerevisiae . Science 298, 799–804
14 Zhang, L. and Guarente, L. (1994) HAP1 is nuclear but is bound to a cellular factor in the
absence of heme. J. Biol. Chem. 269, 14643–14647
15 Zitomer, R. S. and Hall, B. D. (1976) Yeast cytochrome c messenger RNA: in vitro
translation and specific immunoprecipitation of the CYC1 gene product. J. Biol. Chem.
251, 6320–6326
16 Melcher, K., Sharma, B., Ding, W. V. and Nolden, M. (2000) Zero background yeast
reporter plasmids. Gene 247, 53–61
17 Ramil, E., Freire-Picos, M. A. and Cerdán, M. E. (1998) Characterization of promoter
regions involved in high expression of KlCYC1. Eur. J. Biochem. 256, 67–74
18 Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,
248–254
19 Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) Transformation of intact yeast cells
treated with alkali cations. J. Bacteriol. 153, 163–168
20 Ryan, M. P., Jones, R. and Morse, R. H. (1998) SWI-SNF complex participation in
transcriptional activation at a step subsequent to activator binding. Mol. Cell. Biol. 18,
1774–1782
21 González-Domı́nguez, M., Freire-Picos, M. A., Ramil, E., Guiard, B. and Cerdán, M. E.
(2000) Heme-mediated transcriptional control in Kluyveromyces lactis . Curr. Genet. 38,
171–177
22 ter Linde, J. J., Liang, H., Davis, R. W., Steensma, H. Y., van Dijken, J. P. and Pronk, J. T.
(1999) Genome-wide transcriptional analysis of aerobic and anaerobic chemostat
cultures of Saccharomyces cerevisiae . J. Bacteriol. 181, 7409–7413
23 Kwast, K. E., Lai, L. C., Menda, N., James, III, D. T., Aref, S. and Burke, P. V. (2002)
Genomic analyses of anaerobically induced genes in Saccharomyces cerevisiae :
functional roles of Rox1 and other factors in mediating the anoxic response. J. Bacteriol.
184, 250–265
24 Ter Linde, J. J. and Steensma, H. Y. (2002) A microarray-assisted screen for potential
Hap1 and Rox1 target genes in Saccharomyces cerevisiae . Yeast 19, 825–840
25 Zitomer, R. S. and Lowry, C. V. (1992) Regulation of gene expression by oxygen in
Saccharomyces cerevisiae . Microbiol. Rev. 56, 1–11
26 Mennella, T. A., Klinkenberg, L. G. and Zitomer, R. S. (2003) Recruitment of Tup1–Ssn6
by yeast hypoxic genes and chromatin-independent exclusion of TATA binding protein.
Eukaryotic Cell 2, 1288–1303
27 Ness, F., Bourot, S., Regnacq, M., Spagnoli, R., Berges, T. and Karst, F. (2001) SUT1 is a
putative Zn[II]2 Cys6 -transcription factor whose upregulation enhances both sterol uptake
and synthesis in aerobically growing Saccharomyces cerevisiae cells. Eur. J. Biochem.
268, 1585–1595
243
28 Regnacq, M., Alimardani, P., El Moudni, B. and Berges, T. (2001) SUT1p interaction with
Cyc8p (Ssn6p) relieves hypoxic genes from Cyc8p–Tup1p repression in Saccharomyces
cerevisiae . Mol. Microbiol. 40, 1085–1096
29 Cohen, B. D., Sertil, O., Abramova, N. E., Davies, K. J. and Lowry, C. V. (2001) Induction
and repression of DAN1 and the family of anaerobic mannoprotein genes in
Saccharomyces cerevisiae occurs through a complex array of regulatory sites. Nucleic
Acids Res. 29, 799–808
30 Abramova, N. E., Cohen, B. D., Sertil, O., Kapoor, R., Davies, K. J. and Lowry, C. V. (2001)
Regulatory mechanisms controlling expression of the DAN/TIR mannoprotein genes
during anaerobic remodeling of the cell wall in Saccharomyces cerevisiae . Genetics 157,
1169–1177
31 Deckert, J., Perini, R., Balasubramanian, B. and Zitomer, R. S. (1995) Multiple elements
and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces
cerevisiae . Genetics 139, 1149–1158
32 Hon, T., Lee, H. C., Hu, Z., Iyer, V. R. and Zhang, L. (2005) The heme activator protein
Hap1 represses transcription by a heme-independent mechanism in Saccharomyces
cerevisiae . Genetics 169, 1343–1352
33 MacIsaac, K. D., Wang, T., Gordon, D. B., Gifford, D. K., Stormo, G. D. and Fraenkel, E.
(2006) An improved map of conserved regulatory sites for Saccharomyces cerevisiae .
BMC Bioinformatics 7, 113
34 Dirmeier, R., O’Brien, K. M., Engle, M., Dodd, A., Spears, E. and Poyton, R. O. (2002)
Exposure of yeast cells to anoxia induces transient oxidative stress. Implications for the
induction of hypoxic genes. J. Biol. Chem. 277, 34773–34784
35 He, X. J. and Fassler, J. S. (2005) Identification of novel Yap1p and Skn7p binding sites
involved in the oxidative stress response of Saccharomyces cerevisiae . Mol. Microbiol.
58, 1454–1467
36 Krynetski, E. Y., Krynetskaia, N. F., Bianchi, M. E. and Evans, W. E. (2003) A nuclear
protein complex containing high mobility group proteins B1 and B2, heat shock cognate
protein 70, ERp60, and glyceraldehyde-3-phosphate dehydrogenase is involved in the
cytotoxic response to DNA modified by incorporation of anticancer nucleoside analogues.
Cancer Res. 63, 100–106
37 Najima, Y., Yahagi, N., Takeuchi, Y., Matsuzaka, T., Sekiya, M., Nakagawa, Y.,
Amemiya-Kudo, M., Okazaki, H., Okazaki, S., Tamura, Y. et al. (2005) High mobility group
protein-B1 interacts with sterol regulatory element-binding proteins to enhance their DNA
binding. J. Biol. Chem. 280, 27523–27532
38 Yu, M., Wang, J., Li, W., Yuan, Y. Z., Li, C. Y., Qian, X. H., Xu, W. X., Zhan, Y. Q. and Yang,
X. M. (2008) Proteomic screen defines the hepatocyte nuclear factor 1α-binding partners
and identifies HMGB1 as a new cofactor of HNF1α. Nucleic Acids Res. 36, 1209–1219
39 Vik, A. and Rine, J. (2001) Upc2p and Ecm22p, dual regulators of sterol biosynthesis in
Saccharomyces cerevisiae . Mol. Cell. Biol. 21, 6395–6405
40 Germann, M., Gallo, C., Donahue, T., Shirzadi, R., Stukey, J., Lang, S., Ruckenstuhl, C.,
Oliaro-Bosso, S., McDonough, V., Turnowsky, F. et al. (2005) Characterizing sterol defect
suppressors uncovers a novel transcriptional signaling pathway regulating zymosterol
biosynthesis. J. Biol. Chem. 280, 35904–35913
41 Abramova, N., Sertil, O., Mehta, S. and Lowry, C. V. (2001) Reciprocal regulation of
anaerobic and aerobic cell wall mannoprotein gene expression in Saccharomyces
cerevisiae . J. Bacteriol. 183, 2881–2887
42 Wilcox, L. J., Balderes, D. A., Wharton, B., Tinkelenberg, A. H., Rao, G. and Sturley, S. L.
(2002) Transcriptional profiling identifies two members of the ATP-binding cassette
transporter superfamily required for sterol uptake in yeast. J. Biol. Chem. 277,
32466–32472
43 Davies, B. S., Wang, H. S. and Rine, J. (2005) Dual activators of the sterol biosynthetic
pathway of Saccharomyces cerevisiae : similar activation/regulatory domains but different
response mechanisms. Mol. Cell. Biol. 25, 7375–7385
44 Ter Linde, J. J., Regnacq, M. and Steensma, H. Y. (2003) Transcriptional regulation of
YML083c under aerobic and anaerobic conditions. Yeast 20, 439–454
Received 28 September 2009; accepted 6 October 2009
Published as BJ Immediate Publication 6 October 2009, doi:10.1042/BJ20091500
c The Authors Journal compilation c 2010 Biochemical Society