Arch Microbiol (2016) 198:149–159
DOI 10.1007/s00203-015-1172-6
ORIGINAL PAPER
Dissolved inorganic carbon uptake in Thiomicrospira crunogena
XCL‑2 is Δp‑ and ATP‑sensitive and enhances RubisCO‑mediated
carbon fixation
Kristy J. Menning1 · Balaraj B. Menon2,3 · Gordon Fox1 · USF MCB4404L 2012 ·
Kathleen M. Scott1 Received: 20 August 2014 / Revised: 30 October 2015 / Accepted: 11 November 2015 / Published online: 18 November 2015
© Springer-Verlag Berlin Heidelberg 2015
Abstract The gammaproteobacterium Thiomicrospira
crunogena XCL-2 is an aerobic sulfur-oxidizing hydrothermal vent chemolithoautotroph that has a CO2 concentrating mechanism (CCM), which generates intracellular
dissolved inorganic carbon (DIC) concentrations much
higher than extracellular, thereby providing substrate for
carbon fixation at sufficient rate. This CCM presumably
requires at least one active DIC transporter to generate
the elevated intracellular concentrations of DIC measured
in this organism. In this study, the half-saturation constant
(KCO2) for purified carboxysomal RubisCO was measured
(276 ± 18 µM) which was much greater than the KCO2 of
whole cells (1.03 µM), highlighting the degree to which the
CCM facilitates CO2 fixation under low CO2 conditions. To
clarify the bioenergetics powering active DIC uptake, cells
Communicated by Erko Stackebrandt.
USF MCB4404L 2012 are: P. Wanjugi, M. Abdel-Rahim, M.
B. Alak, L. J. Astatrjan, V. Bihary, F. Blazekovic, C. Cabrera,
G. Camper, T. Chase, J. Dox, A. Echevarria, Q. A. Fisher, C.
Georgeades, I. E. Heller, A. N. Hewlett, A. E. Justus, M. Kemp,
M. Kondoff, J. P. Martin, E. McClenthan, G. R. Nicolas, J.
Paoletti, S. Schuler, M. Skopis, S. R. Subar, E. R. Trebour.
Electronic supplementary material The online version of this
article (doi:10.1007/s00203-015-1172-6) contains supplementary
material, which is available to authorized users.
* Kathleen M. Scott
[email protected]
1
Department of Integrative Biology, University of South
Florida, 4202 East Fowler Avenue, Tampa, FL 33620, USA
2
Department of Chemistry and Biochemistry, The University
of Southern Mississippi, Hattiesburg, MS, USA
3
Present Address: Schepens Eye Research Institute, Harvard
Medical School, Boston, MA, USA
were incubated in the presence of inhibitors targeting ATP
synthesis (DCCD) or proton potential (CCCP). Incubations
with each of these inhibitors resulted in diminished intracellular ATP, DIC, and fixed carbon, despite an absence of
an inhibitory effect on proton potential in the DCCD-incubated cells. Electron transport complexes NADH dehydrogenase and the bc1 complex were found to be insensitive
to DCCD, suggesting that ATP synthase was the primary
target of DCCD. Given the correlation of DIC uptake to the
intracellular ATP concentration, the ABC transporter genes
were targeted by qRT-PCR, but were not upregulated under
low-DIC conditions. As the T. crunogena genome does
not include orthologs of any genes encoding known DIC
uptake systems, these data suggest that a novel, yet to be
identified, ATP- and proton potential-dependent DIC transporter is active in this bacterium. This transporter serves to
facilitate growth by T. crunogena and other Thiomicrospiras in the many habitats where they are found.
Keywords Hydrothermal vent · Chemolithoautotroph ·
Carbon concentrating mechanism · Thiomicrospira ·
Calvin cycle · Carbon fixation
Introduction
Chemolithoautotrophs are primary producers at deepsea hydrothermal vents, and their activities are particularly high where hydrothermal fluid mixes with seawater.
Hydrothermal fluid is hot (>250 °C), acidic (pH 4), has
elevated dissolved inorganic carbon (DIC) concentrations
(~30 mM), and carries electron donors, including hydrogen
sulfide (>4 mM; Childress et al. 1993). It is often diluted
by seawater entrained in the crust before emission from the
sea floor; dilute hydrothermal fluid temperature (2–40 °C)
13
150
and chemical composition (pH ~ 6, 4 mM DIC, ~0.1 mM
sulfide) reflect this mixing (Childress et al. 1993). As this
dilute vent fluid flows into the cold (2–4 °C), alkaline
(pH ~ 8), oxic seawater, turbulent eddies form, causing
erratic conditions in which the concentration of the molecules needed to support chemolithoautotrophy oscillate
broadly over time. The concentration of CO2, for example,
can fluctuate between 0.02 and 1 mM in a matter of seconds to days (Johnson et al. 1988; Goffredi et al. 1997).
One adaptation to manage fluctuations in CO2 availability
is a CO2 concentrating mechanism (CCM). CCMs allow
autotrophic organisms to accumulate elevated intracellular DIC concentrations when environmental availability of
DIC is low (Dobrinski et al. 2005; Badger et al. 2006).
Thiomicrospira crunogena XCL-2 is an aerobic sulfuroxidizing chemolithoautotrophic gammaproteobacterium
with the first noncyanobacterial CCM to be characterized
(Dobrinski et al. 2005). It has been isolated from hydrothermal vents in both the Atlantic and Pacific Oceans and
is one of the fastest growing chemolithoautotrophs known
(Jannasch et al. 1985). This growth rate is high even when
the concentration of DIC in the growth medium drops to
0.1 mM. Cells grown under these conditions can accumulate intracellular DIC to 100× higher than extracellular in
an energy-dependent manner, suggesting the presence of
active DIC transporters (Dobrinski et al. 2005). The CCM
in T. crunogena also includes a form IA RubisCO packaged into carboxysomes with a carboxysomal carbonic
anhydrase encoded by csoSCA (Scott et al. 2006; Dobrinski et al. 2010, 2012). CsoSCA appears to facilitate carbon
fixation but not DIC uptake (Dobrinski et al. 2010) and is
found in an operon with the genes encoding the carboxysome shell proteins and form IA RubisCO (Scott et al.
2006); form II RubisCO, as well as a second, presumably noncarboxysomal form IA RubisCO, are encoded
elsewhere on the chromosome and are preferentially transcribed under high CO2 conditions (Dobrinski et al. 2012).
Carboxysomes are a key component of the CCMs in
cyanobacteria; however, it is the arsenal of DIC-transporters that are responsible for generating the elevated intracellular DIC concentrations that facilitate carboxysome
function (Badger et al. 2006; Price et al. 2009). In cyanobacteria, there are three families of well-characterized DIC
transporters currently known to contribute to CCMs. Under
severe DIC limitation, the primary, ATP-hydrolyzing ABC
transporter BCT1, encoded by cmpABCD, is expressed in
freshwater cyanobacteria (Badger et al. 2006; Price et al.
2009). The Na+-dependent secondary transporter, BicA,
is a member of the SulP family, which has medium-to-low
affinity for bicarbonate (Price et al. 2004). BicA is inducible in Synechococcus sp. PCC 7002, but appears to be constitutively expressed in Synechocystis sp. PCC 6803 (Price
et al. 2004; Eisenhut et al. 2007). Another high-affinity,
13
Arch Microbiol (2016) 198:149–159
inducible Na+–HCO3− symporter, SbtA, is expressed by
cyanobacteria under low-DIC conditions (Espie and Kandasamy 1994; Shibata et al. 2002).
In addition to these bicarbonate transporters, many
cyanobacteria have CO2 hydration complexes associated with the thylakoid or cell membrane. Two forms
of this complex have been described: NDH-I3 (inducible, high affinity) and NDH-I4 (low affinity, constitutively
expressed) (Shibata et al. 2001; Maeda and Price 2002).
Both are believed to couple the hydration of CO2 to exergonic electron transfer to the quinone pool; coupling the
hydration to an exergonic redox reaction precludes the possibility of the complex catalyzing the dehydration backreaction (Price 2011). The electron donor powering these
complexes is unknown. The function of these complexes
is believed to convert any noncarboxysomal, cytoplasmic
CO2 to HCO3− to prevent it from diffusing out of the cell;
presumably, the rate of carboxysomal uptake and fixation
of the CO2 ‘recaptured’ by the CO2 hydration complexes
exceeds the rate of abiotic HCO3− dehydration back to CO2
(Price 2011). These complexes consist of many of the proteins of the respiratory NAD(P)H dehydrogenase complex
NDH-I (NdhA–C, NdhE, NdhG–O; (Battchikova and Aro
2007). Cyanobacteria whose genomes encode CO2 hydration complexes have several paralogous copies of genes
encoding NdhD and NdhF proteins (e.g., ndhD1, ndhD2,
ndhD3, ndhD4). The NdhD3 and NdhF3 proteins are part
of the NDH-I3 complex, while NdhD4 and NdhF4 occupy
the NDH-I4 complex (Battchikova and Aro 2007). CupA
(NDH-I3 complex) and CupB proteins (NDH-I4 complex)
are unique to CO2 hydration complexes and may function
in CO2 hydration (Price 2011).
The T. crunogena genome encodes many transporters,
including 10 apparent operons for ABC influx transporters composed of genes for an ATP-hydrolyzing subunit,
transmembrane subunit, and a solute-binding subunit.
The remaining ATP-dependent transporters appear to be
involved in protein secretion, H+, Na+, or other cation
efflux (Scott et al. 2006). Additionally, fifty-eight secondary transporters representing 28 transporter families,
including one SulP family transporter, are present in the
T. crunogena genome. Oligonucleotide microarrays with
probes designed for all of the genes in the T. crunogena
genome did not identify any transporters whose gene transcripts were more abundant when cells were cultivated
under low-DIC conditions (Dobrinski et al. 2012).
T. crunogena constructs carboxysomes and generates
elevated intracellular DIC concentrations when grown
under low-DIC conditions (Dobrinski et al. 2005, 2012);
the objective of this study was to elucidate the degree to
which transmembrane DIC uptake facilitates carbon fixation and illuminate the nature of the contribution to DIC
uptake by cellular bioenergetics (ATP, as well as proton
Arch Microbiol (2016) 198:149–159
potential, (Δp), comprised of membrane potential (ΔΨ)
and ΔpH).
Materials and methods
Carboxysomal RubisCO was purified and its half-saturation constant (KCO2) and Vmax were measured, in order to
compare the enzyme half-saturation constant to that previously measured in whole cells. To determine whether DIC
uptake is powered by proton potential or ATP hydrolysis,
T. crunogena cells were incubated with a protonophore
(CCCP) or an ATP synthase inhibitor (DCCD). To clarify
whether the correlation between intracellular ATP concentrations and DIC uptake was due to the activity of an ABC
transporter, prior microarray results for ABC transporter
genes (Dobrinski et al. 2012) were verified via qRT-PCR to
determine whether their transcript levels were sensitive to
the abundance of DIC during growth, as might be expected
for a DIC transporter.
Reagents
Tritiated water, NaH14CO3, 14C-methylamine hydrochloride, and 14C-D-sorbitol were purchased from MP
Biomedicals. The metabolic inhibitors carbonyl cyanide m-chlorophenylhydrazone (CCCP) and N,N′dicyclohexylcarbodiimide (DCCD) were obtained from
Sigma. 14C-tetraphenylphosphonium bromide was purchased from American Radiolabeled Chemicals, Inc.
Cultivation of T. crunogena
T. crunogena XCL-2 (Jannasch et al. 1985) was cultivated at room temperature (~20 °C) in 40 mM thiosulfatesupplemented artificial seawater (TASW, pH 8) as previously described (Dobrinski et al. 2005). For carboxysomal
RubisCO purification, an 8 L batch culture was grown to
late exponential phase before harvesting. For investigating
the effects of metabolic inhibitors on DIC uptake and fixation, T. crunogena was cultivated under DIC limitation in
TASW in chemostats (~0.1 mM DIC in the growth chamber; New Brunswick Scientific BioFlo 110) at a dilution
rate of 0.1 h−1. A dO2/pH controller was used to control
aeration with O2 to maintain culture oxygen concentrations
(~20–50 μM), and titration with 10 N KOH to maintain
the pH (=8). To determine whether transcript abundance
for solute-binding components of ABC transporters was
sensitive to the DIC concentration present during growth,
cells were cultivated both in DIC-limited chemostats (as
described above) and high-DIC chemostats (50 mM DIC,
dilution rate of 0.1 h−1, sparged with 5 % v/v CO2 in O2 as
needed; (Dobrinski et al. 2005).
151
Carboxysomal RubisCO purification
T. crunogena cells (8 L) were harvested and resuspended
in 15 ml of TEMB buffer (10 mM TRIS, 1 mM EDTA,
10 mM MgSO4, 20 mM NaHCO3−) containing 2 mg ml−1
lysozyme, and 0.2 μM phenylmethylsulfonyl fluoride. The
cell suspension was inverted several times after addition
of 15 ml of nonionic detergent B-PER II (Pierce Scientific). The cell slurry was then sonicated (Branson model
450 sonifier, constant duty cycle, power output = 7, 10 s).
A 150 μl portion of 1 mg ml−1 bovine pancreatic DNase
I solution in TEMB buffer was added. The sonicated cell
lysate was then agitated for 30 min at room temperature
(~20 °C, Reliable Scientific D55 tilting platform shaker, 60
cycles per min) and centrifuged at 10,000×g for 10 min.
The resulting cell pellet was resuspended in 30 ml TEMB
buffer, which was then sonicated (4 × 30 s bursts, 1 min
cooling intervals between bursts). Nonidet P-40 (final concentration = 1 % v/v) was added to the sonicated lysate to
solubilizate membranes and stirred for 1 h at room temperature. The sonicated lysate was centrifuged at 10,000×g
for 10 min. The resulting supernatant was centrifuged at
48,000×g for 30 min, and the resulting pellet was resuspended in 3 ml TEMB buffer and centrifuged at 1000×g for
3 min. The supernatant from this centrifugation was highly
enriched in carboxysomes and was loaded onto a 36 ml
10–60 % w/v continuous sucrose gradient in TEMB buffer
prepared using a gradient former (Bethesda Research Laboratories). Gradients were centrifuged in a swinging bucket
rotor (Beckman JS 28.38, 104,000×g, 30 min, 4 °C). A
milky white band of purified carboxysomes formed at the
middle of the gradient and was harvested. After adjusting
the volume to ~36 ml with TEMB buffer, the carboxysome
suspension was centrifuged at 150,000×g for 2 h at 4 °C
in a Type 70Ti rotor (Beckman). The resulting pellet was
resuspended in 1 ml TEMB buffer and stored at 4 °C until
further use.
To purify RubisCO from these carboxysome preparations, they were freeze-thawed multiple times to disrupt the
carboxysome shell and release the RubisCO. Ruptured carboxysome shells were removed by centrifugation (~30 min,
4 °C, 14,000×g). RubisCO purity was verified via SDSPAGE; gels were stained with coomassie brilliant blue to
visualize proteins (Sambrook and Russell 2001).
RubisCO activity was determined via 14CO2 fixation as
in Scott et al. (2007). To verify whether carboxylase activity
was proportional to the amount of enzyme present, activity
was assayed at a range of protein concentrations (0–13 μg).
To determine the pH range favorable for RubisCO activity, it was necessary to remove the influence of pH on the
CO2 concentration (e.g., RubisCO activity would appear
elevated at low pH and diminished at high pH due to elevated CO2 abundance at lower pH). To accomplish this, an
13
152
isotopic disequilibrium method was used, as described in
(Scott et al. 2004).
To determine the KCO2 and Vmax, an assay buffer pH of 7.5
was chosen to accommodate higher CO2 concentrations (it
was anticipated that the KCO2 value would be high), while still
maintaining a pH value favorable to enzyme activity. Four
independent RubisCO assays were performed using the same
RubisCO preparation. The concentrations of CO2 present in
these incubations were calculated from the pH values and
DIC concentrations as in Yokota and Kitaoka (1985). KCO2
and Vmax were calculated from the carbon fixation rates and
CO2 concentrations using least-squares nonlinear regression
as implemented in XLStatistics 10.05.30 (http://www.deakin.
edu.au/~rodneyc/XLStatistics; XLent Works, Australia).
Effect of metabolic inhibitors on DIC uptake
and fixation
Cells were cultivated in chemostats under DIC limitation
(TASW growth medium; 0.1 mM DIC, 7.6 mM (NH4)2SO4
(Dobrinski et al. 2005). One culture was used to conduct
pilot experiments to determine appropriate concentrations
and exposure times for the inhibitors. Three independent
cultures were used to measure the impact of the inhibitors
on DIC uptake.
Cultures were harvested via centrifugation (5000×g,
4 °C, 10 min). Thiosulfate was removed by washing the
cell pellet three times with thiosulfate-free and DIC-free
TASW medium (pH 8). The cell pellet was resuspended
in thiosulfate-free and DIC-free TASW (OD600 ~ 4) and
bubbled with CO2-free air for ~15–30 min until the DIC
concentration was undetectable by gas chromatography
(Dobrinski et al. 2005).
This cell suspension was divided into three aliquots: one
was incubated with 1 mM of the ATP synthase inhibitor
DCCD, the second aliquot was incubated with 10 μM of
the protonophore CCCP, and the third portion was without
an inhibitor, but was amended with DMSO to 0.1 % v/v to
act as a solvent control, as both the DCCD and CCCP solutions were prepared in this solvent. Cell suspensions were
incubated on ice for 1 h under CO2-free air before use in
incubations. These inhibitor concentrations and exposure
times were determined by pilot experiments to reliably
result in an effect on ATP, ΔΨ, and intracellular pH (data
not shown).
Intracellular pH, ΔΨ, intracellular ATP, and DIC uptake
and fixation were measured for cells incubated at room
temperature (~20 °C) under four conditions: (1) in the
absence thiosulfate (2) presence of thiosulfate (40 mM), (3)
10 µM CCCP (plus thiosulfate) or (4) 1 mM DCCD (plus
thiosulfate). All incubations had a final concentration of
0.1 % v/v DMSO to control for the solvent added with the
DCCD or CCCP.
13
Arch Microbiol (2016) 198:149–159
To determine whether the inhibitors were affecting their
targets (CCCP: intracellular pH and ΔΨ; DCCD: [ATP]),
intracellular pH, ΔΨ, and cellular ATP concentrations were
measured. Silicone oil centrifugation (SOC) was used to
measure intracellular pH and ΔΨ; for this technique, cells
incubated with appropriate radiolabel were pipetted into
screw-cap 0.6-ml centrifuge tubes which had been preloaded with 20 μl of a dense killing solution (1:2 v/v triton:
1 M glycine, pH 3 for incubations with 14C-methylamine,
pH 10 for all others) overlain with 65 μl silicone oil (Dow
Chemicals SF1156) (Dobrinski et al. 2005). When this
three-layered system is centrifuged (40 s, maximum speed),
the cells carry their contents through the silicone and into
the killing solution. The tube is immediately frozen with
liquid nitrogen, and the bottom layer (containing the cells)
is clipped into a scintillation tube with scintillation cocktail
to quantify the radiolabel contained in the cells.
To measure intracellular pH via SOC, cells were incubated in TASW supplemented with DMSO (solvent control)
or inhibitors dissolved in DMSO (10 μM CCCP or 1 mM
DCCD), and 2 mM (specific activity 56 mCi mmol−1)
14
C-methylamine as described in Dobrinski et al. (2005).
ΔΨ was measured via SOC, using tetraphenylphosphonium bromide (TPP), which diffuses across the cell membrane and accumulates in the cytoplasm in proportion to
the ΔΨ (Rottenberg 1979; Olsson et al. 2003). Incubation conditions were identical to those noted above, but
were amended with 14C-tetraphenylphosphonium bromide to a concentration of 20 mM with a specific activity
of 5 mCi mmol−1. ATP was measured in cells incubated
as above for SOC. A 20 µl portion of each cell suspension
was added to 400 µl of incubation buffer. After 30 s, 10 μl
of the suspension was stirred into 90 μl of 95 °C distilled
water and incubated at 95 °C for 2 min in a thermocycler,
after which it was cooled on ice and stored at −80 °C. ATP
was quantified four times for each treatment using a commercially available bioluminescence kit (SIGMA #FL-AA)
and luminometer (Promega, Glomax 20/20).
DCCD has been shown to inhibit electron transport in
the NDH-1 and cytochrome bc1 complexes in some organisms (Yagi 1987; Wang et al. 1998), so it was necessary to
verify that the primary target for this inhibitor in T. crunogena cells was the intracellular ATP pool and not cellular reductant levels (e.g., NAD/NADH or ubiquinone/
ubiquinol). Cell membrane vesicles were prepared from T.
crunogena cultivated under DIC limitation, using a protocol modified from (Sinegina et al. 2005). Approximately
100 mg of cells were suspended in 5 ml of buffer containing 50 mM HEPES at pH 7, 100 mM KCl, 0.5 mM EDTA,
and 0.5 mM PMSF. Cells were sonicated until lysed and
centrifuged at 10,000 g for 20 min at 4 °C. The supernatant
was centrifuged at 35,000 g for 30 min, the resulting pelleted cell membrane vesicles were resuspended in 500 µl
Arch Microbiol (2016) 198:149–159
153
of buffer containing 25 mM bis-tris-propane at pH 6 and
10 mM betaine, and were flash-frozen using liquid nitrogen
and stored at −80 °C.
NDH-1 activity was assayed, three times for each treatment (Sinegina et al. 2005), with the following modified procedure. Thawed membrane vesicles (20 µl) were
added to 1 ml of buffer containing 25 mM HEPES (pH
7.5), 200 µM NADH, and 3.5 mM NaCN, and substrate
(50 µM decylubiquinone). To test for inhibition by DCCD,
1 mM DCCD was added to the sample and incubated on
ice for 1 h. NADH oxidation was followed at 340 nm
(ε = 6.2 mM−1 cm−1). To measure any NADH oxidation not mediated by NDH-1 (other enzymes, or nonbiological reactions), parallel assays were conducted without
ubiquinone.
Cytochrome bc1 complex activity was assayed similarly to Rotsaert et (al. 2008) by the reduction of 50 µM
cytochrome c in a buffer containing 50 mM KH2PO4
(pH 6), 250 mM sucrose, 0.2 mM EDTA, 0.1 % BSA,
and 50 µM decylubiquinol. Decylubiquinol was synthesized by dissolving decylubiquinone in ethanol and adding to a buffer (50 mM KH2PO4 pH 6, 250 mM sucrose,
0.2 mM EDTA, 1 mM NaCN, and 0.1 % BSA) to a concentration of 620 µM (Trumpower and Edwards 1979).
Sodium borohydride was added to a concentration of
5.3 mM and incubated for 1 h until H2 bubbles stopped
forming. Cell membrane vesicles were incubated for 1 h
with and without 1 mM DCCD. Cytochrome bc1 complex
activity was monitored by tracking cytochrome c reduction (ε = 21.5 mM−1 cm−1 at 550 nm) in the presence
of 50 µM decylubiquinol. As for the NDH-1 complex,
cytochrome c reduction was verified to be due to the bc1
complex, and not alternative enzymatic or chemical reactions, by repeating the assay in the absence of decylubiquinol. Cytochrome c reduction was measured three times for
each treatment (without substrate, uninhibited with substrate, and with substrate and inhibitor). Both NDH-1 and
cytochrome bc1 activities were measured at room temperature (~20 °C).
Tcr_1153). Both genes in both operons were assayed for
transcript abundance.
One solute-binding protein gene (Tcr_1153) had
sequence similarity to those involved in cyanobacterial
HCO3− as well as NO3−-uptake (Fig. S1). Typically, T.
crunogena is cultivated with ammonium as a nitrogen
source (see above). To elucidate whether this gene (and
others) was responsive to the concentration of DIC or to
NO3−, cells were cultivated in chemostats under three different conditions: (1) DIC-limited (DIC = 0.1 mM, 13 mM
NaNO3), (2) NO3−-limited (DIC = 50 mM, 0.5 mM
NO3−), (3) NH3-limited (DIC = 50 mM; NH3 = 0.5 mM).
Once cultures had reached steady state, they were harvested
by centrifugation (5 min, 10,000×g, 4 °C), flash-frozen in
liquid nitrogen, and stored at −80 °C until use.
RNA was isolated from these cells using the RiboPureBacteria kit (Ambion, Inc.), and relative transcript abundance was determined via SYBR Green RT-PCR, using the
QuantiTect SYBR Green RT-PCR kit (Qiagen, Inc.), and
primers listed in Table 1. The ΔΔCT method was used to
compare the relative amounts of transcripts in RNA isolated from cells grown in different chemostats, using 16S
transcript levels as the calibrator (Livak and Schmittgen
2001; Dobrinski et al. 2012). The csoSCA gene, which
encodes a carboxysomal carbonic anhydrase, has higher
transcript abundances in DIC-limited cells (Dobrinski et al.
2010, 2012). Therefore, transcript abundance for this gene
was determined in parallel with the solute-binding protein genes, as a positive control for CCM induction under
DIC-limited growth. When gene transcript abundance was
compared for cells cultivated in the presence of different
nitrogen sources (NH3 vs. NO3−), the gene encoding a solute-binding protein from an ABC transporter (Tcr_2079)
was used as a negative control, as it is part of a gene cluster
encoding the enzymes for metabolizing phosphonate (Scott
et al. 2006), making it unlikely to be sensitive to nitrogen
sources.
Solute‑binding protein transcript abundance
For the effects of inhibitors on pH, ΔΨ, ATP, NDH-1, and
cytochrome bc1 complex, treatment groups were compared
using a one-way ANOVA in SPSS Statistics 19, with a significance level of α ≤ 0.05. To analyze the effects of inhibitors on DIC uptake and fixation, the results from the three
independent cultures were combined by treating them as an
experiment with randomized block design, with subsamples within treatments. Each culture was a block, and there
were four treatments per block (−thiosulfate, +thiosulfate,
CCCP, DCCD). Since the data were too heteroscedastic
for analysis of variance to be appropriate, generalized least
squares, implemented in R, was used on natural log-transformed data (Amemiya 1985; Walker and Smith 2009).
All genes from the T. crunogena genome likely to encode
solute-binding proteins for ABC transporters were collected from TransportDB (http://www.membranetransport.
org; (Ren et al. 2007). Solute-binding protein genes that
were present in apparent operons with other genes encoding the other components of ABC transporters (transmembrane and ATP-binding subunits) were selected, and their
transcript abundance under low- versus high-DIC growth
conditions was quantified (see below). In two cases, two
genes encoding solute-binding proteins were present in the
apparent operons (Tcr_0981 and Tcr_0982; Tcr_1152 and
Statistical analysis
13
154
Arch Microbiol (2016) 198:149–159
Table 1 Fold change in transcript abundance for genes encoding ABC transporter solute-binding proteins in Thiomicrospira crunogena
Locus taga
Predicted substrate(s)
Tcr_0033
NO3−, RSO3−, HCO3− TGCCGATGAAAGC- Low/high DIC
CAAAGTGGTTC
TTGGTTGCTGACGGGTAAGGGTAA
(911–1052)
Low/high DIC
Phosphate
AGCAGCTGTTGTCTCTAACCCTGT
TGCCCATAGCGTCATCAAGTTTGC
(36–174)
GCGTTGGTTCAGC- Low/high DIC
Zn+2
CGTATTTGGAT
ACGCTTTGAGATGAGACGGACGAA
(88–193)
?
AGCTTCCTTTGGA- Low/high DIC
TACGTCAGCCT
AATACACATCGTCTGCACCGGGTT
(278–370)
Toluene tolerance
GACGAAAGCACAG- Low/high DIC
CAAGATGCGTT
ATTGCCATCTGCTTGGGTGACTTC
(267–438)
Low/high DIC
ATAGTGGTTGTGCNO3−
CACCCTCAAGT
AGTGACAGCTGTGCCGCATTTAAC
(493–609)
AAGCCGGAACGATC- Low/high DIC
NO3−
GAAGGGTATT
TGCGGATCGTCGTGTTGGGATATT
(686–859)
Tcr_0544
Tcr_0577
Tcr_0981
Tcr_0982
Tcr_1152
Tcr_1153
qRT-PCR primers (prod- Comparisonc
uct location on gene)b
NO3−
1.01 (0.52–1.95)
NO3−
1.10 (0.06–2.03)
NO3−
0.94 (0.56–1.59)
NO3−
1.12 (0.061–2.05)
NO3−
0.94 (0.37–2.37)
NO3−
1.12 (0.07–1.77)
NO3−
0.86 (0.65–1.14)
High DIC
NO3−
73 (41–132)
Tcr_1153
NO3−
(Primers listed above)
Tcr_1182
Dipeptides
AATTTCTTCGCGCCGATTCCTTGG
AAACCGGATTCGGGATAGAAGCCA
(715–908)
Tcr_1800
NO3−, RSO3−, HCO3
NO3−
0.54 (0.39–0.74)
Tcr_1927
MoO−2
4
Low/high DIC
TACAGTGATTGGCCAGGATGGGTT
ATCGATTTGTCCAGCTGCGAATGC
(94–231)
TTGCACATGCCTTC- Low/high DIC
CAATACGTGG
AAACCGGACTATTCGGGTCAACCA
(500–589)
NO3−
0.90 (0.73–1.12)
Tcr_2079
Phosphonate
Low/high DIC
NO3−
0.59 (0.19–1.81)
13
GCCATGATTATTGCCGCAGACGTT
ATAGGGCAGGATCAATAGCGCCTT
(472–646)
NO3−/NH3
Low/high DIC
Nutrient in commond Fold change in transcript
abundance (95 % CI)
0.66 (0.30–1.49)
Arch Microbiol (2016) 198:149–159
155
Table 1 continued
Locus taga
Predicted substrate(s)
qRT-PCR primers (prod- Comparisonc
uct location on gene)b
Nutrient in commond Fold change in transcript
abundance (95 % CI)
Tcr_2079
Phosphonate
Metal ions
High DIC
NO3−
0.45 (0.36–0.57)
Tcr_2149
NO3−/NH3
ACGACCCTCAGAAT- Low/high DIC
GAAGCGAGTT
TGCAATCCTCGCACCTCCATATCA
(443–629)
TCTAAGGCAGACC- Low/high DIC
CTACACATCAA
CGCCGCTTTATGGTCATCACT
(759–819)
NO3−
232 (165–327)
Tcr_0841 (csoSCA) N/A
16S
N/A
(primers listed above)
1.18 (0.79–1.77)
CGAATATGCTCTACG- (qRT-PCR calibrator)
GAGTAAAGGT
CGCGGGCTCATCCTTTAG
(109–163)
a
IMG gene locus tag designations
b
Primers are presented F first, and R second
c
Cells were grown in chemostats. Low DIC chemostats were DIC-limited (0.1 mM) and had high nitrogen concentrations (13 mM NO3− or
NH3); high DIC (50 mM) chemostats were nitrogen-limited (0.5 mM NO3− or NH3)
d
‘Nutrient in common’ indicates that the two populations of cells that were compared with respect to transcript abundance either used the same
nitrogen source (‘NO3−’) or were both cultivated under high-DIC conditions (‘high DIC’)
For qRT-PCR, Ct values from three aliquots of an RNA
sample were determined, and the average and standard
deviation were calculated. Error was propagated from the
Ct values using standard statistical methods.
holoenzyme (L8S8) is 5.22 × 105 g mol−1. From this, and
factoring in the presence of eight active sites per holoenzyme, the kcat for this enzyme is 0.27 s−1.
Effect of metabolic inhibitors on DIC uptake
and fixation
Results
Carboxysomal RubisCO purification and Michaelis–
Menten kinetics
Carboxysomes (Fig. 1a) and carboxysomal RubisCO
(Fig. 1b) were successfully purified from T. crunogena.
Two bands are apparent after SDS-PAGE of enzyme
released from carboxysomes by freeze-thaw treatment
(Fig. 1b); their molecular weights are consistent with those
predicted from the sequences of the genes encoding the
large (51.9 kDa; cbbL) and small (13.4 kDa; cbbS) subunits
of T. crunogena carboxysomal RubisCO.
Assay carbon fixation rates were dependent on the
amount of purified RubisCO added (Fig. S1) and were zero
when ribulose 1,5-bisphosphate was omitted. RubisCO
activity was highest from pH 7–8.5 (Fig. 1c). The KCO2
of the purified carboxysomal RubisCO was 276 µM
(SD ± 18) and the Vmax was 252 nmol CO2 min−1 mg protein−1 (SD ± 7; Fig. 1d). Based on the SDS-PAGE gel and
sequences of cbbL and cbbS, the molecular mass of the
The expected impacts of CCCP and DCCD on their target
parameters in intact cells (intracellular pH, ΔΨ, and ATP)
were apparent (Table 2). Thiosulfate presence alkalinized
intracellular pH, brought ΔΨ to more negative values, and
increased ATP, as expected given that T. crunogena can use
thiosulfate as a donor for its electron transport chain. Relative to thiosulfate-energized cells, the addition of the protonophore CCCP diminished intracellular pH and drove ΔΨ
to more positive values, as expected, due to proton entry
into the cells. ATP concentrations were low in the presence
of this inhibitor, possibly due to diminishment of the proton
potential necessary to drive ATP synthase. DCCD addition
also diminished intracellular ATP concentrations, likely due
to direct interaction of this inhibitor with ATP synthase.
DCCD did not inhibit the activities of NADH dehydrogenase or the cytochrome bc1 complex (Table 3), suggesting that its major impact on the cells was due to its interaction with ATP synthase and not secondary effects due
to inhibition of the activities of electron transport chain
complexes.
13
156
Arch Microbiol (2016) 198:149–159
Fig. 1 Thiomicrospira crunogena carboxysomal RubisCO purification and characterization. a Transmission electron micrograph of
purified carboxysomes. Samples were stained with 1 % w/v ammonium molybdate and observed under a transmission electron microscope at ×30,000 magnification. b SDS-PAGE analysis of RubisCO
purified from carboxysomes. Left lane molecular weight standards
(Fisher BioReagents EZ-Run Prestained Rec Protein Ladder). Right
lane 14 μg purified carboxysomal RubisCO, stained with coomassie brilliant blue. c Response of RubisCO activity to assay pH. Error
Table 2 Physiological
parameters for DIC-limiteda
Thiomicrospira crunogena cells
treated with inhibitorsb
bars indicate the standard error of the CO2 fixation rates. d Response
of RubisCO activity to the concentration of CO2. Results from four
independent experiments are shown with different symbols. The curve
is the rectangular hyperbola resulting from incorporating the average KCO2 (276 μM) and Vmax (252 nmol min−1 mg protein−1) from
the four experiments into the Michaelis–Menten equation. For d,
rate measurement precision was very high; consequently, error bars
indicating the SE of the CO2 fixation rates are very short and are
obscured by the symbols
Treatment
40 mM Na2S2O3
Intracellular pHc
ΔΨ (mV)
ATP (mM)
No inhibitor
No inhibitor
10 μM CCCP
−
+
+
7.15 ± 0.04a
7.67 ± 0.05b
7.13 ± 0.04a
−94 ± 6a
−131 ± 2b
−105 ± 2c
0.36 ± 0.04a
4.46 ± 0.92b
0.32 ± 0.08a
1 mM DCCD
a
7.77 ± 0.22b
+
−127 ± 2b
1.45 ± 0.11c
Extracellular DIC = 0.1 mM
b
Mean values are provided ±SD (n = 4)
c
Values with different superscripts (a, b, c) are significantly different from each other (Scheffe test,
α = 0.05)
Inorganic carbon uptake and fixation by T. crunogena
cells is stimulated by the presence of thiosulfate (Fig. 2,
Fig. S2) as previously noted (Dobrinski et al. 2005).
When thiosulfate was added, cells generated intracellular
13
DIC concentrations ~15× higher than extracellular; in
its absence, it was only 2×. Both inhibitors reduced the
amounts of fixed carbon, which is consistent with the Calvin-Benson cycle’s requirements for ATP, diminished in the
Arch Microbiol (2016) 198:149–159
Table 3 Thiomicrospira
crunogena NDH-1 and
cytochrome bc1 complex
activity in the absence and
presence of DCCD
157
NDH-1 (µmol s−1 ±SD)
Cytochrome bc1 (µmol s−1 ±SD)
−Substratea
31.2 (n = 1)
0.1 ± 0.4 (n = 3)
272 ± 48 (n = 3)
3.6 ± 0.3 (n = 3)
+Substrate +1 mM DCCD
309 ± 41 (n = 3)
3.4 ± 0.3 (n = 3)
+Substrate
a
Substrates are 50 μM decylubiquinone or decylubiquinol for NDH-1 and cytochrome bc1 complexes,
respectively
conditions. Transcripts of Tcr_1153, which is homologous
both to the cognate genes of the cyanobacterial bicarbonate
and nitrate ABC transporters, were not responsive to DIC
concentrations during growth (Table 1). Instead, Tcr_1153
transcripts were more abundant when nitrate was present as
the nitrogen source than with ammonium. As expected, the
gene from a likely phosphonate transporter was insensitive
to both DIC abundance and nitrogen source (Table 1).
Discussion
Fig. 2 Effects of thiosulfate and metabolic inhibitors on the concentrations of intracellular fixed carbon and dissolved inorganic carbon
(DIC) in Thiomicrospira crunogena cells incubated in the presence
of 0.1 mM DIC. ‘−TS’ = 0 mM thiosulfate, ‘+TS’ = 40 mM thiosulfate, ‘+CCCP’ = 40 mM thiosulfate + 10 μM carbonyl cyanide
m-chlorophenyl hydrazine, ‘+DCCD’ = 40 mM thiosulfate + 1 mM
N,N′-dicyclohexylcarbodiimine. Error bars indicate 95 % confidence
intervals; lowercase letters over the error bars indicate significant
differences (Tukey’s test, p < 0.05) among fixed carbon (a, b, c) and
intracellular DIC (d, e) values
presence of either CCCP or DCCD (Table 2), and NAD(P)
H, which is presumably diminished by CCCP due to inhibition of reverse electron transport caused by collapse of the
cellular proton potential. Both inhibitors also diminished
the concentrations of intracellular DIC; cells treated with
CCCP had intracellular DIC concentrations ~1.5× higher
than extracellular, while those incubated with DCCD had a
3.5× gradient (Fig. 2).
ABC transporter solute‑binding protein transcript
abundance
None of the genes encoding solute-binding proteins, which
were present near genes encoding the membrane and ATPbinding components of ABC transporters, demonstrated
a measurable increase in transcript abundance when cells
were grown under conditions inducing the CCM (Table 1).
It was anticipated that if any were involved in DIC uptake,
their transcript levels would be higher under low-DIC conditions. The positive control, encoding the carboxysomal
carbonic anhydrase (csoSCA), demonstrated a >200-fold
increase in transcript abundance under DIC-limiting growth
A comparison of enzyme and whole cell KCO2 values is
consistent with active DIC transport by T. crunogena. The
carboxysomal RubisCO KCO2 (276 µM) was much higher
than the KCO2 of whole cells (1.03 µM; (Dobrinski et al.
2005). Indeed, it is rather high for a form I RubisCO, which
typically ranges from 22 to 180 μM in bacteria (Viale et al.
1990; Larimer and Soper 1993; Hernandez et al. 1996;
Horken and Tabita 1999; Badger and Bek 2008) but is on
par with other form IA and IB RubisCOs found in organisms with carboxysomes and CCMs (173–293 μM, with
one extremely high value of 750 μM by Prochlorococcus marinus RubisCO; (Badger 1980; Badger et al. 1998;
Scott et al. 2007; Dou et al. 2008; Marcus et al. 2011).
In the absence of active uptake, the KCO2 for whole cells
should be similar to or greater than that of the carboxysomal RubisCO since the intracellular CO2 will be similar to
or lower than extracellular. The kcat (0.27 s−1) is lower than
that measured for other enzymes (0.4–11.4 s−1; (Badger
1980; Badger et al. 1998; Scott et al. 2007; Dou et al. 2008;
Marcus et al. 2011), which may indicate that some of the
proteins had been inactivated during the complex enzyme
purification process (e.g., multiple centrifugations, and carboxysome freeze-thaw).
DIC accumulation by T. crunogena cells is sensitive
both to the proton gradient and ΔΨ, as well as to intracellular ATP concentrations (Table 2; Fig. 2). Collapsing the
proton gradient and ΔΨ with CCCP had the most dramatic
effect on DIC uptake and fixation; the addition of DCCD
also had a marked effect on both parameters. Given that
CCCP collapses the proton potential and also diminishes
the intracellular ATP concentration, the effect of this inhibitor on DIC uptake and fixation could be due to either of
13
158
these effects. Given that DCCD specifically targets ATP
synthase, it appears that intracellular DIC accumulation is
sensitive to intracellular ATP concentrations when the proton potential and intracellular pH are still intact.
Multiple models for coupling proton potential and/
or ATP to DIC uptake are possible (Fig. S3). The
mechanism(s) for DIC uptake by T. crunogena are likely
to depart from those described for cyanobacteria, as genes
orthologous to those encoding cyanobacterial DIC uptake
systems are not present in the T. crunogena genome (Table
S1). Given the apparent sensitivity of DIC uptake to ATP
concentrations, an ABC transporter seemed a likely candidate. In the T. crunogena genome, the genes that were the
best match for those encoding BCT1, the cyanobacterial
ABC transporter responsible for bicarbonate uptake, probably encode a nitrate transporter as they were responsive to
NO3− availability in the growth medium (Table 1) and are
in an apparent operon with genes encoding enzymes necessary for assimilatory nitrate reduction (Fig. S4). Nitrate
uptake by this system is further supported by phylogenetic
analysis of the T. crunogena gene encoding the solute-binding component of this putative ABC transporter; the gene
falls within a well-supported clade with other solute-binding components whose neighboring genes encode nitrate
reductase, and distinct from the clade containing the cyanobacterial solute-binding proteins from the BCT1 bicarbonate transporter (Fig. S4).
Reliance on an ATP-sensitive transporter could be
assumed to be more energetically expensive in T. crunogena than utilizing a secondary transporter. Genome data
are consistent with T. crunogena relying on the periplasmic
Sox system to oxidize thiosulfate to sulfuric acid (Scott
et al. 2006), resulting in periplasmic proton accumulation (Friedrich et al. 2001). The majority of the electrons
abstracted from thiosulfate by the Sox system are transferred to the terminal oxidase (cytochrome cbb3 oxidase;
(Scott et al. 2006); the cbb3 complex contributes to proton potential by using these electrons to consume cytoplasmic protons as it reduces O2 to H2O, while also acting
as a vectoral proton pump (Rauhamaki et al. 2012). This
two-component electron transport chain (Sox complex and
cytochrome cbb3 oxidase) is likely responsible for generating cellular proton potential during lithotrophic growth by
T. crunogena with thiosulfate as the electron donor (Scott
et al. 2006). Intuitively, the most efficient strategy for DIC
uptake would be to use a secondary transporter to directly
couple this Δp to uptake. Instead, it appears that the energy
stored in the transmembrane proton potential is communicated to the DIC uptake system by using the Δp to power
ATP synthase. In general, energy conversion results in
some energy loss as heat. However, given that ATP synthase appears to convert virtually all of the energy from
proton entry into the cell to ADP phosphorylation (Toyabe
13
Arch Microbiol (2016) 198:149–159
et al. 2011), energy losses incurred with this added step
may be minimal.
A comparison of the carboxysomal RubisCO KCO2 to
the whole cell KCO2 makes it clear that DIC transport is
essential to the function of the CCM in T. crunogena but
the identity of the transporter or transporters responsible
for HCO3− uptake is unclear. The presence of carboxysomes, which are also found in cyanobacteria suggests
that chemolithoautotrophs like T. crunogena have CCMs
that function similarly to those that have been characterized in cyanobacteria. Once identified, the genes encoding
the DIC uptake system(s) in noncyanobacterial autotrophs
are certain to provide insight into the ecophysiology
and evolution of DIC uptake in autotrophic microorganisms across the many phyla and habitats where they are
present.
Acknowledgments We are tremendously thankful to the National
Science Foundation for their support of this project (NSFMCB-0643713 to K.M.S.). We would also like to thank Gordon Cannon and Sabine Heinhorst for helpful discussions and for the use of
their facilities for carboxysome studies, and the anonymous reviewers for their insightful suggestions, which improved the quality of this
manuscript.
References
Amemiya T (1985) Advanced econometrics. Harvard University
Press, Cambridge
Badger MR (1980) Kinetic properties of ribulose 1,5-bisphosphate
carboxylase/oxygenase from Anabaena variabilis. Arch Biochem Biophys 201:247–254
Badger MR, Bek EJ (2008) Multiple RubisCO forms in proteobacteria: their functional significance in relation to CO2 acquisition by
the CBB cycle. J Exp Bot 59:1525–1541
Badger MR et al (1998) The diversity and coevolution of RubisCO,
plastids, pyrenoids, and chloroplast-based CO2-concentrating
mechanisms in algae. Can J Bot 76:1052–1071
Badger MR, Price GD, Long BM, Woodger FJ (2006) The environmental plasticity and ecological genomics of the cyanobacterial
CO2 concentrating mechanism. J Exp Bot 57:249–265
Battchikova N, Aro E (2007) Cyanobacterial NDH-1 complexes:
multiplicity in function and subunit composition. Physiol Plant
131:22–32
Childress JJ et al (1993) Inorganic carbon uptake in hydrothermal
vent tubeworms facilitated by high environmental pCO2. Nature
362:147–169
Dobrinski KP, Longo DL, Scott KM (2005) A hydrothermal vent
chemolithoautotroph with a carbon concentrating mechanism. J
Bacteriol 187:5761–5766
Dobrinski KP, Boller AJ, Scott KM (2010) Expression and function
of four carbonic anhydrase homologs in the deep-sea chemolithoautotroph Thiomicrospira crunogena. Appl Environ Microb
76:3561–3567
Dobrinski KP, Enkemann SA, Yoder SJ, Haller E, Scott KM (2012)
Transcription response of the sulfur chemolithoautotroph Thiomicrospira crunogena to dissolved inorganic carbon limitation.
J Bacteriol 194:2074–2081
Dou Z, Heinhorst S, Williams E, Murin E, Shively J, Cannon G (2008)
CO2 fixation kinetics of Halothiobacillus neapolitanus mutant
Arch Microbiol (2016) 198:149–159
carboxysomes lacking carbonic anhydrase suggest the shell acts
as a diffusional barrier for CO2. J Biol Chem 283:10377–10384
Eisenhut M, Schubert EVWLJH, Bauwe BWIH (2007) Long-term
response toward inorganic carbon limitation in wild type and
glycolate turnover mutants of the cyanobacterium Synechocystis
sp. strain PCC 6803. Plant Physiol 144:1946–1959
Espie GS, Kandasamy RA (1994) Monensin inhibition of Na+dependent HCO3− transport distinguishes it from Na+-independent HCO3− transport and provides evidence for Na+/
HCO3− symport in the cyanobacterium Synechococcus UTEX
625. Plant Physiol 104:1419–1428
Friedrich CG, Rother D, Bardischewsky F, Quentmeier A, Fischer J
(2001) Oxidation of reduced inorganic sulfur compounds by bacteria: emergence of a common mechanism? Appl Environ Microbiol 67:2873–2882
Goffredi SK, Childress JJ, Desaulniers NT, Lee RW, Lallier FH, Hammond D (1997) Inorganic carbon acquisition by the hydrothermal vent tubeworm Riftia pachyptila depends upon high external
P-CO2 and upon proton-equivalent ion transport by the worm. J
Exp Biol 200:883–896
Hernandez JM, Baker SH, Lorbach SC, Shively JM, Tabita FR (1996)
Deduced amino acid sequence, functional expression, and
unique enzymatic properties of the form I and form II ribulose
bisphosphate carboxylase/oxygenase from the chemoautotrophic
bacterium Thiobacillus denitrificans. J Bacteriol 178:347–356
Horken K, Tabita FR (1999) Closely related form I ribulose bisphosphate carboxylase/oxygenase molecules that possess different CO2/O2 substrate specificities. Arch Biochem Biophys
361:183–194
Jannasch H, Wirsen C, Nelson D, Robertson L (1985) Thiomicrospira
crunogena sp. nov., a colorless, sulfur-oxidizing bacterium from
a deep-sea hydrothermal vent. Int J Syst Bacteriol 35:422–424
Johnson KS, Childress JJ, Hessler RR, Sakamoto-Arnold CM, Beehler CL (1988) Chemical and biological interactions in the Rose
Garden hydrothermal vent field. Deep Sea Res 35:1723–1744
Larimer FW, Soper TS (1993) Overproduction of Anabaena 7120 ribulose-bisphosphate carboxylase/oxygenase in Escherichia coli.
Gene 126:85–92
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2-ΔΔCT method.
Methods 25:402–408
Maeda S, Price MRBGD (2002) Novel gene products associated with
NdhD3/D4-containing NDH-1 complexes are involved in photosynthetic CO2 hydration in the cyanobacterium, Synechococcus
sp PCC7942. Mol Microbiol 43:425–435
Marcus Y, Altman-Gueta H, Wolff Y, Gurevitz M (2011) Rubisco
mutagenesis provides new insight into limitations on photosynthesis and growth in Synechocystis PCC6803. J Exp Bot
62:4173–4182
Olsson K, Keis S, Morgan H, Dimroth P, Cook G (2003) Bioenergetic
properties of the thermoalkaliphilic Bacillus sp. strain TA2.A1. J
Bacteriol 185:461–465
Price GD (2011) Inorganic carbon transporters of the cyanobacterial
CO2 concentrating mechanism. Photosynth Res 109:47–57
Price G, Woodger F, Badger M, Howitt S, Tucker L (2004) Identification of a SulP-type bicarbonate transporter in marine cyanobacteria. Proc Natl Acad Sci USA 101:18228–18233
Price GD, Badger MR, Woodger FJ, Long BM (2009) Advances in
understanding the cyanobacterial CO2-concentrating-mechanism (CCM): functional components, Ci transporters, diversity,
genetic regulation and prospects for engineering into plants. J
Exp Bot 59:1441–1461
Rauhamaki V, Bloch DA, Wikstrom M (2012) Mechanistic stoichiometry of proton translocation by cytochrome cbb(3). Proc Natl
Acad Sci USA 109:7286–7291. doi:10.1073/pnas.1202151109
159
Ren Q, Chen K, Paulsen IT (2007) TransportDB: a comprehensive
database resource for cytoplasmic membrane transport systems
and outer membrane channels. Nucl Acids Res 35:D274–D279
Rotsaert F, Ding M, Trumpower B (2008) Differential efficacy of
inhibition of mitochondrial and bacterial cytochrome bc1 complexes by center N inhibitors antimycin, ilicicolinH and funiculosin. Biochim Biophys Acta 1777:211–219
Rottenberg H (1979) The measurement of membrane potential and
ΔpH in cells, organelles, and vesicles. In: Colowick SP, Kaplan
NO (eds) Methods in enzymology. Elsevier, New York, pp
547–569
Sambrook J, Russell DW (2001) Molecular cloning: A laboratory
manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor
Scott KM, Schwedock J, Schrag DP, Cavanaugh CM (2004) Influence
of form IA RubisCO and environmental dissolved inorganic carbon on the δ13C of the clam-bacterial chemoautotrophic symbiosis Solemya velum. Environ Microbiol 6:1210–1219
Scott KM et al (2006) The genome of deep-sea vent chemolithoautotroph Thiomicrospira crunogena. PLoS Biol 4:1–17
Scott KM, Henn-Sax M, Longo D, Cavanaugh CM (2007) Kinetic
isotope effect and biochemical characterization of form IA
RubisCO from the marine cyanobacterium Prochlorococcus
marinus MIT9313. Limnol Oceanogr 52:2199–2204
Shibata M et al (2001) Distinct constitutive and low-CO2-induced
CO2 uptake systems in cyanobacteria: genes involved and their
phylogenetic relationship with homologous genes in other organisms. Proc Natl Acad Sci 98:11789–11794
Shibata M et al (2002) Genes essential to sodium-dependent bicarbonate transport in cyanobacteria. J Biol Chem 277:18658–18664
Sinegina L, Wikstrom M, Verkhovsky M, Verkhovskaya M (2005)
Activation of isolated NADH:ubiquinone reductase I (complex I) from Escherichia coli by detergent and phospholipids.
Recovery of ubiquinone reductase activity and changes in EPR
signals of iron-sulfur clusters. Biochemistry 44:8500–8506
Toyabe S, Watanabe-Nakayama T, Okamoto T, Kudo S, Muneyuki
E (2011) Thermodynamic efficiency and mechanochemical
coupling of F-1-ATPase. Proc Natl Acad Sci USA 108:17951–
17956. doi:10.1073/pnas.1106787108
Trumpower B, Edwards C (1979) Purification of a reconstitutively
active iron-sulfur protein (oxidation factor) from succinate
cytochrome c reductase complex of bovine heart mitochondria. J
Biol Chem 254:8697–8706
Viale AM, Kobayashi H, Akazawa T (1990) Distinct properties of
Escherichia coli products of plant-type ribulose-1,5-bisphosphate carboxylase/oxygenase directed by two sets of genes from
the photosynthetic bacterium Chromatium vinosum. J Biol Chem
265:18386–18392
Walker AFZENINJ, Smith AASGM (2009) Mixed effects models and
extensions in R. Springer, New York
Wang Y, Obungu V, Beattie D (1998) Dicyclohexylcarbodiimide
inhibits proton pumping in ubiquinol:cytochrome c oxidoreductase of Rhodobacter sphaeroides and binds to aspartate-187 of
cytochrome b1. Arch Biochem Biophys 352:193–198
Yagi T (1987) Inhibition of NADH-ubiquinone reductase activity by
N, N’-dicyclohexylcarbodiimide and correlation of this inhibition with the occurrence of energy-coupling site 1 in various
organisms. Biochemistry 26:2822–2828
Yokota A, Kitaoka S (1985) Correct pK values for dissociation constant of carbonic acid lower the reported Km values of ribulose
bisphosphate carboxylase to half. Presentation of a nomograph
and an equation for determining the pK values. Biochem Biophys Res Commun 131:1075–1079
13