Journal of Vector Ecology
Vol. 35, no. 2
363
Polymerase chain reaction (PCR) identification of rodent blood meals confirms
host sharing by flea vectors of plague
Heather A. Franklin, Paul Stapp, and Amybeth Cohen
Department of Biological Science, California State University, Fullerton, CA 92831, U.S.A.
Received 21 January 2010; Accepted 21 August 2010
ABSTRACT: Elucidating feeding relationships between hosts and parasites remains a significant challenge in studies of
the ecology of infectious diseases, especially those involving small or cryptic vectors. Black-tailed prairie dogs (Cynomys
ludovicianus) are a species of conservation importance in the North American Great Plains whose populations are extirpated
by plague, a flea-vectored, bacterial disease. Using polymerase chain reaction (PCR) assays, we determined that fleas
(Oropsylla hirsuta) associated with prairie dogs feed upon northern grasshopper mice (Onychomys leucogaster), a rodent that
has been implicated in the transmission and maintenance of plague in prairie-dog colonies. Our results definitively show that
grasshopper mice not only share fleas with prairie dogs during plague epizootics, but also provide them with blood meals,
offering a mechanism by which the pathogen, Yersinia pestis, may be transmitted between host species and maintained
between epizootics. The lack of identifiable host DNA in a significant fraction of engorged Oropsylla hirsuta collected from
animals (47%) and prairie-dog burrows (100%) suggests a rapid rate of digestion and feeding that may facilitate disease
transmission during epizootics but also complicate efforts to detect feeding on alternative hosts. Combined with other
analytical approaches, e.g., stable isotope analysis, molecular genetic techniques can provide novel insights into host-parasite
feeding relationships and improve our understanding of the role of alternative hosts in the transmission and maintenance of
disease. Journal of Vector Ecology 35 (2): 363-371. 2010.
Keyword Index: Cynomys ludovicianus, host-parasite feeding interactions, multi-host pathogens, Onychomys leucogaster,
Yersinia pestis.
INTRODUCTION
A central problem in the study of the ecology of infectious diseases within diverse communities is determining
the roles of different vector and host species (Fenton
and Pederson 2005, Keesing et al. 2006). A complete
understanding of host-vector feeding relationships is critical
for determining the likelihood of an outbreak of disease
(epizootic), as well as the rate and extent of its spread.
Detailed investigations of feeding relationships between
cryptic vectors and hosts often reveal the involvement of less
common or previously unrecognized hosts (e.g., Kilpatrick
et al. 2006, Brisson et al. 2008). For most diseases, however,
including many zoonoses and diseases of conservation
importance, these relationships remain poorly understood.
Plague is a disease of wild rodents caused by the
bacterium Yersinia pestis and transmitted primarily by the
bites of fleas (Gage and Kosoy 2005). The introduction of
plague to the United States in the early 20th century has
had important conservation consequences because the
black-tailed prairie dog (Cynomys ludovicianus), a species
that profoundly affects the functioning and biodiversity of
grassland ecosystems, is highly susceptible to the disease
(Stapp et al. 2004). Because mortality is so high (>90%;
Cully and Williams 2001), it is unlikely that prairie dogs can
maintain the pathogen locally between epizootics, leading
some to argue that another rodent species that is resistant to
plague may act as an enzootic host (Anderson and Williams
1997, Cully et al. 1997, Gage and Kosoy 2005, but see Pauli
et al. 2006). Several rodent species found in prairie-dog
colonies show resistance to plague mortality (Holdenried
and Quan 1956, Lechleitner et al. 1968, Anderson and
Williams 1997), but to date there is little direct evidence
that these species are fed upon by fleas that transmit Y. pestis
to prairie dogs (Gage and Kosoy 2005, Salkeld and Stapp
2008a).
The northern grasshopper mouse (Onychomys
leucogaster; Figure 1) is found throughout western North
America, including much of the area where plague occurs
(Thomas 1988). Grasshopper mice use burrows of other
animals and are common in prairie-dog colonies (Stapp
2007). They are resistant to plague mortality in the laboratory
(Holdenried and Quan 1956, Thomas et al. 1988), and
individuals with serological evidence of exposure to Y. pestis
have been captured alive in the field (Stapp et al. 2008).
Grasshopper mice are also unusual because, across their
range, they harbor an extremely high diversity of fleas (57
species, Thomas 1988). Most rodent fleas are associated with
one or a few closely related primary hosts (Marshall 1981,
Traub 1985). A primary host is defined as a host species that
provides appropriate conditions for a flea to successfully
reproduce (Krasnov 2008); however, in practical terms, the
determination of a flea’s primary host is usually based on
repeated field collections of the flea from a particular host,
rather than on laboratory trials. A secondary host is defined
as a species that occurs in the same area as the flea’s primary
364
Journal of Vector Ecology
Figure 1. The northern grasshopper mouse (Onychomys
leucogaster) is a small, omnivorous rodent commonly
found on black-tailed prairie dog colonies in western North
America.
host and is exposed to that flea species on a regular basis
(Krasnov 2008). When a flea feeds from a secondary host,
its feeding success may be altered, resulting in a smaller
blood meal and a slower rate of engorgement and digestion,
which may ultimately reduce survival and reproduction
compared to feeding on a primary host (Marshall 1981,
Krasnov 2008). The ability of grasshopper mice to serve as a
secondary host for fleas associated with prairie dogs could
indicate an important role in the spread of plague.
In northern Colorado, the black-tailed prairie dog
is the primary host of Oropsylla hirsuta; these fleas are
routinely collected from prairie dogs (Brinkerhoff et al.
2006, Tripp et al. 2009) and their burrows (Salkeld and Stapp
2008b). The thirteen-lined ground squirrel (Spermophilus
tridecemlineatus), another rodent common in prairie-dog
colonies (Stapp 2007), is the primary host of Thrassis fotus,
a flea typically associated with ground-dwelling sciurids
(Traub 1985, Thomas 1988). Neither rodent species harbors
many flea species, and they rarely share fleas (Figure 2).
In contrast, grasshopper mice captured in prairie-dog
colonies are infested with their primary flea, Pleochaetis
exilis (Hubbard 1968, Thomas 1988), and also significant
numbers of T. fotus and O. hirsuta (Figure 2; Salkeld and
Stapp 2009, Stapp et al. 2009). Interestingly, O. hirsuta loads
increase markedly during epizootics, suggesting that fleas
switch to grasshopper mice upon the death of their primary
hosts (Stapp et al. 2009). Using polymerase chain reaction
(PCR) assays, Stapp et al. (2009) detected Y. pestis in P.
exilis and O. hirsuta combed from grasshopper mice during
plague epizootics, suggesting that mice could be infected
by, or be a source of, Y. pestis infection for O. hirsuta, and
therefore prairie dogs. However, stable isotope analysis of
gut contents of O. hirsuta collected from grasshopper mice
suggested that they mostly contained prairie-dog blood
(Stapp and Salkeld 2009), which implies that grasshopper
December 2010
mice may transport O. hirsuta between burrows but not
provide significant blood meals.
Molecular genetic techniques, including PCR, have
been increasingly used to identify the sources of blood
meals in arthropod vectors, such as mosquitoes and ticks
(e.g., Humair et al. 2007, Kilpatrick et al. 2006, Kent and
Norris 2005, Wickramasekara et al. 2008), but until recently
(Woods et al. 2009) have not been used to identify blood
meals of fleas. We used PCR and gel electrophoresis to
identify blood meals of fleas collected from primary and
secondary rodent hosts on prairie-dog colonies. Specifically,
we examined blood meals of O. hirsuta (hereafter, Oropsylla),
T. fotus (Thrassis), and P. exilis (Pleochaetis), combed from
black-tailed prairie dogs, thirteen-lined ground squirrels
and northern grasshopper mice, respectively. We also
identified blood meals of Oropsylla and Thrassis combed
from grasshopper mice to determine if these fleas feed upon
grasshopper mice. Additionally, we examined blood meals
of Oropsylla collected from prairie-dog burrows to further
determine if Oropsylla feeds on other rodents, which may
increase its survival when prairie dogs are absent. The
presence of grasshopper-mouse blood in Oropsylla would
provide evidence that Oropsylla is a source of Y. pestis
infection for grasshopper mice and a bridging vector for
interspecific transmission of plague.
MATERIALS AND METHODS
To identify the type of host blood found in fleas, DNA
in flea blood meals was compared to DNA from blood
Figure 2. Proportional representation of flea species combed
from black-tailed prairie dogs, northern grasshopper mice,
and thirteen-lined ground squirrels, the three most common
rodents on prairie-dog colonies on the Pawnee National
Grasslands, CO. Values in parentheses (N) are the total
numbers of fleas combed from each rodent species. Other
flea species identified were mostly Oropsylla tuberculata
cynomuris and Pulex simulans for prairie dogs, and six
other flea species for grasshopper mice. Data from Tripp et
al. (2009) for prairie dogs and P. Stapp (unpublished data,
2004-2008) for grasshopper mice and ground squirrels.
Vol. 35, no. 2
Journal of Vector Ecology
(genomic DNA) of each of the three focal rodent species
using PCR. Oropsylla, Pleochaetis, and Thrassis were tested
in three groups: individual fleas combed from their primary
hosts; individual Thrassis and Oropsylla combed from
grasshopper mice; and pooled Oropsylla collected from
burrows prior to and during plague epizootics, when large
numbers of fleas and hosts were still present. Included in
the samples were 15 Pleochaetis and Oropsylla (combed
from eight different grasshopper mice) that had previously
tested positive for Y. pestis (Stapp et al. 2009). When blood
meals could not be identified using species-specific primers,
a generalized primer was used to screen for DNA of other
potential hosts at our study site, which were expected to be
uncommon. Ground squirrels and grasshopper mice made
up 65% of rodent captures and often were the only species
captured at our sites (Stapp et al. 2009).
Collection and identification of fleas
Field work was conducted at the Pawnee National
Grasslands, located 61 km northeast of Fort Collins, CO,
U.S.A. Fleas were collected from live-trapped animals and
prairie-dog burrows between May-September 2004-2007
(see Stapp et al. 2009 for methods). Fleas were combed from
anesthetized animals or swabbed from burrows and placed
in cryotubes containing a mixture of Tween detergent and
saline solution. Blood was collected from the retro-orbital
sinus (small rodents) or by tail venipuncture (prairie dogs).
Flea and blood samples were stored frozen at -80° C. Animal
handling procedures were approved by the Institutional
Animal Care and Use Committee (06-R-03) at California
State University Fullerton, following American Society of
Mammalogists guidelines (Gannon et al. 2007).
Fleas were identified under a dissecting microscope
and given a blood meal score from 0-4, with 0 indicating no
blood meal and 4 indicating a fully engorged flea. Only fleas
with scores of 2-4 were included in our analyses. Fleas from
animals were analyzed individually, whereas those from
burrows were analyzed in pools of two to five fleas from the
same burrow.
Molecular assays
To extract DNA from flea blood meals, fleas were
triturated by using a MM301 mixer mill (Retsch). Fleas
were placed in a 2 ml boiling tube containing 100µl of brainheart infusion broth (Becton, Dickinson and Company)
and three 3-mm sterile Pyrex glass beads. Fleas were milled
for 3.5 min at 20 beats/s. Ground flea samples were then
incubated at 96° C for 10 min and stored at -20° C. Genomic
DNA samples were obtained by extracting pure DNA from
rodent blood samples with a Qiagen DNeasy kit (Qiagen)
and stored at -20° C.
Three sets of species-specific primers were designed
to target the cytochrome b (cyt b) gene of each rodent
species. This region of mitochondrial DNA was chosen
because it was highly conserved, but also contained several
areas that differed among the three rodent species. Cyt
b sequences were obtained through the National Center
for Biotechnology Information (NCBI) database (Table
365
1). Once sequences were obtained, all three were aligned
in the program ClustalX (Conway Institute). Regions of
significant differences (differences between at least four
nucleotides) were located and used to design a speciesspecific primer set (Table 1). Each species-specific primer
set targeted areas with at least one difference in nucleotides
at both the 5’ and 3’ ends, as well as one to two differences
in the middle of the sequence. Species-specific primer sets
were designed to produce a specific-sized PCR product
(Table 1). A generalized primer was designed to produce
a same-sized DNA fragment for the three focal rodent
species (165 bp; Figure 3). In addition, when run in a NCBI
BLAST search, the generalized primer was 94-98% similar
to other possible mammalian hosts at our site, including
the deer mouse (Peromyscus maniculatus), Ord’s kangaroo
rat (Dipodomys ordii), silky pocket mouse (Perognathus
flavus), hispid pocket mouse (Chaetodipus hispidus), red fox
(Vulpes vulpes), coyote (Canis latrans), and desert cottontail
(Sylvilagus audubonii). We therefore assumed that the
generalized primer would allow us to detect DNA of other
possible hosts. Although we have no data on rabbits or
coyotes, O. hirsuta are absent or rare (<2% of fleas on other
rodent species, P. Stapp, unpublished data). If no band was
produced using one of the species-specific primers but one
was detected for the generalized primer, we would interpret
this result as evidence that the flea fed on an unidentified
mammal. Absence of a band for the generalized primer was
considered evidence that there was no detectable host DNA
in the flea. All primers were synthesized by Sigma-Genosys.
PCR reactions contained 20 µl of a mixture consisting
of 1X GoTaq Flexi PCR buffer and 5 U/µl GoTaq Flexi
DNA polymerase (Promega), 5 mM MgCl2 , 200 µM
deoxynucleotide triphosphates (Promega), 1.2 µl of a given
flea blood-meal sample, and 5 µM of each primer (forward
and reverse). Three negative controls (two with genomic
DNA of the two rodent species not being tested and one
with master mix reagents only) and one positive control
(genomic DNA of the rodent species being tested) were
included in each test. All reactions that included genomic
DNA contained a final concentration of 40 ng/µl. DNA was
amplified using a Techgene TC-312 thermocycler (Techne).
Reactions with prairie-dog and grasshopper-mouse primers
were carried out with an initial denaturation step of 94oC
for 1 min, followed by 35 cycles of 1 min at 95° C, 1 min at
55° C, 1 min at 72° C, and a final extension step of 10 min
at 72° C. Ground-squirrel and generalized primers were run
with an initial denaturation step of 94° C for 1 min, followed
by 35 cycles of 1 min at 95° C, 1 min at 45° C, 1 min at 72° C,
and a final extension step of 10 min at 72° C.
PCR products were separated on Ethidium Bromide
(EtBr)-stained 2% agarose gels in a 1X TBE buffer solution
at 85 volts for 115 min. PCR products were visualized using
a Kodak Gel Logic 100 imaging system (Eastman Kodak
Company). The presence of DNA from a given species was
determined by visualization of a specific-sized, fluorescent
band on the gel, using a 25-bp DNA step ladder (Promega)
for reference. Each flea DNA sample was tested with the
three species-specific primers. Samples that did not yield
191
AF157892
AY195794
AF157870
Black-tailed prairie dog
(Cynomys ludovicianus)
Northern grasshopper mouse
(Onychomys leucogaster)
Thirteen-lined ground squirrel
(Spermophilus tridecemlineatus)
165
AAACATGAAACATTGGA
CCTCAAATTCATTCTACT
reverse
GATGATGGTGAAGTATAGG
reverse
forward
CTTATCTAAACAACGTAGC
TCGAATTAACCATCCGTAG
reverse
forward
CCCATCCAACATCTCAT
ACTGATGAGAAGGCTGTTGTG
reverse
forward
AACACTCGCAAAACCCAT
Sequence (5’ - 3’)
forward
Direction
480
332
1068
924
222
69
177
7
Location in
Sequence
Thirteen-lined ground squirrel
N
46
62
54
38
39
Flea species
Pleochaetis exilis
Oropsylla hirsuta
Thrassis fotus
Oropsylla hirsuta
Thrassis fotus
0
53 (20)
0
0
0
Black-tailed
prairie dog
0
0
52 (28)
53 (33)
83 (38)
Northern grasshopper mouse
72 (28)
0
2 (1)
0
0
Thirteen-lined ground squirrel
Journal of Vector Ecology
Black-tailed prairie dog
Northern grasshopper mouse
Source of fleas
% of fleas with host DNA
Table 2. Identification of host DNA in fleas combed from rodents associated with prairie dog colonies on the Pawnee National Grasslands, Colorado. Values are the percentage
of fleas containing DNA of a particular rodent host based on PCR assays with cyt b species-specific primers, with the number of fleas containing DNA of a particular host given
in parentheses. Primary host feeding relationships are shown in boldface, whereas entries in italics represent secondary host relationships for grasshopper mice. None of the
fleas that were negative with a species specific primer set tested positive for DNA from other potential mammalian hosts in the study area, based on PCR assays with a
generalized primer. N denotes sample size.
All species (generalized)
162
171
Fragment size
(bp)
Target host species
NCBI GenBank
Accession Number
Table 1. Sequences and location of the species-specific forward and reverse primer sets for the cyt b gene of three focal rodent species, and the generalized primer used to detect
the DNA of unidentified mammalian hosts in flea blood meals.
366
December 2010
Journal of Vector Ecology
Vol. 35, no. 2
367
a band when tested with the species-specific primers were
tested with the generalized primer.
RESULTS
Species-specific primers for the cyt b gene were designed
to produce a band that differed by approximately 10-20 bp
between the three focal rodent species when visualized on
an agarose gel. When tested with purified genomic DNA
collected from the three species, each species-specific
primer produced a band of the expected size for that species
(Figure 3, Table 1), and failed to amplify a cyt b fragment of
genomic DNA from the other two species.
Fleas collected from their primary host contained only
the DNA of that host. Most Pleochaetis (83%) combed from
grasshopper mice contained grasshopper-mouse DNA
(Table 2), as evidenced by a band at 171 bp (Figure 4 top,
lanes 3-11). No Pleochaetis tested positive using the prairiedog or ground-squirrel primers. Similarly, most Thrassis
(72%) combed from ground squirrels contained groundsquirrel DNA (Table 2), based on the presence of a band
at 162 bp when tested with thirteen-lined ground-squirrel
primers (Figure 4 bottom, lanes 3-11). No amplified DNA
fragments were observed when DNA from the blood meals of
these fleas was tested with the prairie-dog and grasshoppermouse primers. A much smaller fraction of Oropsylla (53%)
combed from prairie dogs contained prairie-dog DNA
(Table 2), based on the presence of a band at 191 bp (Figure 4
middle, lanes 3-11). Reactions that employed grasshoppermouse or ground-squirrel primers failed to amplify DNA
fragments. For all three rodent species, none of the fleas that
were negative in tests using species-specific primers tested
positive using the generalized primer.
Patterns of feeding on secondary hosts were similar
to those seen on primary hosts: fleas fed on the host
that carried them. Many (53%) Oropsylla combed from
grasshopper mice contained only grasshopper-mouse DNA
(Table 2), as evidenced by a band at 171 bp when tested
with grasshopper-mouse primers (Figure 5 top, lanes 3-11),
and no amplification of a DNA fragment when tested with
the prairie-dog or ground-squirrel primer. None of the
fleas that were negative in tests using grasshopper-mouse
primers tested positive using the generalized primer. A
similar fraction (52%) of the Thrassis from grasshopper
mice contained grasshopper-mouse DNA (Table 2, Figure 5
bottom). One Thrassis contained DNA of both grasshopper
mice and ground squirrels (Table 2, Figure 6 lane 9).
No Thrassis contained DNA from prairie dogs or other
mammalian hosts.
Most Pleochaetis (86%; N = 7) that had previously
tested positive for the plague bacterium Y. pestis (Stapp
et al. 2009) contained grasshopper-mouse DNA. None of
these fleas produced bands when tested with prairie-dog
or ground-squirrel primers, and none of the fleas that were
negative in tests using grasshopper-mouse primers tested
positive using the generalized primer. A smaller fraction
(25%; N = 8) of Oropsylla combed from grasshopper mice
that tested positive for Y. pestis (Stapp et al. 2009) were
Figure 3. DNA fragments generated with the generalized,
positive control primer set and genomic DNA isolated from
northern grasshopper mouse (lane 2), black-tailed prairie
dog (lane 3), and thirteen-lined ground squirrel (lane 4).
Lane 1 contains a 25-bp DNA step ladder, with arrows on
the left indicating fragments of 150 bp and 300 bp. The
arrow to the right indicates the size of the DNA fragment
generated with the generalized primer set (165 bp).
positive for grasshopper-mouse DNA. None of these fleas
contained DNA from prairie dogs, ground squirrels, or
other mammalian hosts. All three of the grasshopper mice
with Y. pestis-positive Pleochaetis were or eventually tested
seropositive for Y. pestis exposure using antibody tests (0,
31, 41 days after positive fleas collected), whereas only one
of the five grasshopper mice with Y. pestis-positive Oropsylla
tested seropositive (42 days later), although three of these
mice were only captured once (P. Stapp, unpublished data).
In contrast, none of the fed Oropsylla swabbed from
prairie-dog burrows (N = 230 fleas, tested in 94 pools)
contained any detectable host DNA, based on the absence
of bands on gels from tests with the three species-specific or
generalized primers (data not shown). The fact that all these
fleas had feeding status scores of 2-4, presumably as a result
of feeding on prairie dogs, suggests that their blood meals
had already been digested or degraded.
DISCUSSION
Our study demonstrates that PCR can be used to
identify the source of host blood meals in fleas. We found
that fleas usually fed upon the rodent that carried them,
regardless of whether the host was considered a primary
or secondary host. Pleochaetis (83%) and Thrassis (72%)
that were combed from their primary host consistently
had blood meals containing DNA of northern grasshopper
mice and thirteen-lined ground squirrels, respectively
(Table 2). When the remaining flea samples were tested for
the presence of other potential hosts using the generalized
primer, none of these samples yielded a detectable DNA
fragment, suggesting that these fleas contained blood meals
368
Journal of Vector Ecology
December 2010
Figure 4. Species-specific primers for the cyt b gene
amplify unique DNA fragments of flea blood meals
from their primary rodent hosts. Top: Pleochaetis
exilis collected from northern grasshopper mice.
Middle: Oropsylla hirsuta collected from blacktailed prairie dogs. Bottom: Thrassis fotus collected
from thirteen-lined ground squirrels. For all three
gels: lane 1, 25 bp DNA step ladder, with arrows
on the left indicating fragments of 150 bp and
300 bp; lane 2, genomic DNA of the target host
species; lanes 3-11, flea blood meal DNA; lane 12,
negative control (no DNA). The arrows to the right
of each gel indicate the size of the DNA fragment
generated with a species-specific primer set.
Figure 5. DNA fragments from flea blood meals of
Oropsylla hirsuta (top) and Thrassis fotus (bottom) after
feeding on a secondary host, the northern grasshopper
mouse. DNA fragments were amplified using the
grasshopper mouse cyt b primer set; the arrows to the
right indicate the size of the DNA fragment associated
with the grasshopper mouse (171 bp). For both gels:
lane 1, 25 bp DNA step ladder (with arrows on the left
indicating fragments of 150 bp and 300 bp); lane 2,
grasshopper-mouse genomic DNA; lanes 3-11, flea blood
meal DNA; lane 12, negative control (no DNA).
Figure 6. DNA fragments from blood
meals of Thrassis collected from
northern grasshopper mice tested
with the northern grasshopper-mouse
cyt b primer set (top) or the thirteenlined ground squirrel cyt b primer
set (bottom). For both gels: lane 1, 25
bp DNA step ladder, with arrows on
the left indicating fragments of 150
bp and 300 bp; lane 2, grasshoppermouse genomic DNA (171 bp; top)
or ground-squirrel genomic DNA
(162 bp; bottom); lanes 3-11, Thrassis
blood meal DNA; lane 12, negative
control (no DNA). The sample
positive for grasshopper mouse and
ground squirrel DNA is indicated
with a downward arrow (lane 9).
Vol. 35, no. 2
Journal of Vector Ecology
369
that had already been digested. A much smaller fraction
(53%) of blood meals of Oropsylla contained DNA of blacktailed prairie dogs, with 47% containing no detectable host
DNA (Table 2). The absence of amplifiable host DNA in so
many fleas, especially for Oropsylla, was unexpected, and
suggests differences in the rate of digestion of the blood
meal among flea species. Woods et al. (2009) showed that
the amount of detectable host DNA in the guts of the Asian
rat flea Xenopsylla cheopis Rothschild declined considerably
after about 72 h. They identified approximately 80% of the
blood meals of five different flea species, which is similar
to our findings for Pleochaetis and Thrassis. Thus, the lower
percentage of identifiable blood meals in Oropsylla (53%)
suggests that this species of flea either feeds less frequently
or takes smaller meals than Pleochaetis and Thrassis, or
that it digests host blood more quickly. Wilder et al. (2008)
reported high mortality of Oropsylla in the laboratory
when they were starved for more than two days, which
suggests a rapid rate of blood meal digestion. The need to
feed often implies that Oropsylla must quickly abandon a
dead host for a living one, perhaps indiscriminately, which
could make it an effective vector for epizootic spread.
A rapid digestive rate could also explain why no DNA
was detected in any Oropsylla collected from prairie-dog
burrows, which presumably had not fed as recently as the
fleas that were combed from live hosts. The fact that some
fleas that previously tested positive for Y. pestis contained no
detectable host DNA suggests that the plague pathogen may
remain in a flea’s gut after digestion of the blood meal, and
possibly serve as a source of infection.
Both Thrassis and Oropsylla, fleas associated with
ground squirrels and prairie dogs, respectively, but combed
from grasshopper mice, contained grasshopper-mouse
DNA. The proportion of fleas with detectable blood meals
(52%, 53%) was similar to or lower than that for these
fleas on their primary hosts (Table 2), perhaps indicating
a reduced feeding rate. The ability of northern grasshopper
mice to harbor and, presumably, provide blood meals
to such a wide variety of flea species (Stapp et al. 2009)
underscores this species’ reputation as a highly generalized
host, although the exact mechanism by which grasshopper
mice tolerate infestation by so many flea species remains
unknown. However, in a separate analysis, we found that
79% (11/14) of Thrassis and 33% (5/15) of Pulex sp. combed
from prairie dogs contained DNA from the prairie dogs but
not from any other mammals1. These results suggest that
feeding by fleas upon a secondary host may be common,
although it is not clear if blood meals obtained from such
hosts are adequate to ensure survival and reproduction.
On the surface, our results appear to differ from those of
Stapp and Salkeld (2009), who found, using stable nitrogen
isotope analysis, that Oropsylla combed from grasshopper
mice contained mostly prairie-dog blood. Based on a mixing
model, grasshopper-mouse blood contributed 42% to the
average nitrogen isotope signature of Oropsylla collected
from grasshopper mice. In the current study, the absence of
detectable prairie-dog DNA in all Oropsylla collected from
grasshopper mice may further support our contention that
a previous blood meal from a prairie dog would likely have
been digested by the time the flea had jumped to a mouse.
PCR may therefore be useful for identifying recent blood
meals, whereas stable isotope analysis is more effective
at detecting degraded or digested blood meals (Rasgon
2008), e.g., in burrow fleas, or meals integrated over longer
time periods. Ideally, a combination of molecular-genetic
methods and stable isotope analysis will provide the most
complete picture of a flea’s host-feeding relationships.
Lastly, our study demonstrates that grasshopper mice
can provide blood meals to Oropsylla, the primary flea of
prairie dogs, and thus serve as an important vector of plague
in our system. Several fleas collected from grasshopper mice
were positive for Y. pestis (Stapp et al. 2009), suggesting that
mice may be capable of infecting fleas and passing them
(and therefore, Y. pestis) to individuals of different species.
Combined with the observations that grasshopper mice are
common in prairie-dog colonies (Stapp 2007), share burrows
with prairie dogs2, and forage across social boundaries of
prairie-dog coteries (Stapp et al. 2009), it seems increasingly
likely that these mice are involved in epizootic transmission
of plague. In addition, because grasshopper mice are clearly
fed upon by Oropsylla and show heterogeneity to plague
mortality (Thomas et al. 1988, Stapp et al. 2008), they could
also serve as enzootic hosts to help maintain Y. pestis in
the absence of prairie dogs. The fact that grasshopper mice
and prairie dogs are fed upon by the same fleas provides
a mechanism by which Y. pestis can be transmitted from
grasshopper mice back to prairie dogs once a colony has
recovered. The relative rarity of Oropsylla on grasshopper
mice outside of epizootics (Stapp et al. 2009) suggests that
blood meals from mice may be inadequate to permit longterm survival and reproduction, but mice could provide
maintenance meals to fleas and contribute to long-term
persistence of Y. pestis, either in rodent or flea populations,
or other reservoirs. Future studies should clarify the roles
of different reservoirs in the maintenance of plague at the
landscape scale.
Franklin, H.A. 2010. PCR identification of mammalian
hosts of fleas: Implications for the transmission of plague in
prairie dog colonies. MS thesis, California State University,
Fullerton. 32 pp.
2
1
Acknowledgments
Our research was funded by the National Science
Foundation (EID-0327052, DEB-0217631), the California
State University Fund for Research, Scholarship and
Creative Activity, and the Department of Biological
Science at California State University Fullerton. We greatly
appreciate the help of D. Kite, J. Holm, C. Cannon, A.
Benson, H. Houghton, C. Knox, C. Wermager, and J. Kraft
Kraft, J.P. 2009. Movements of northern grasshopper mice
(Onychomys leucogaster): Implications for the spread of
plague. MS thesis, California State University, Fullerton. 76
pp.
Journal of Vector Ecology
370
with flea collections. E. Harp and D. Tripp provided prairiedog blood and flea samples. We are especially indebted to D.
Tripp, D. Salkeld, M. Woods, M. Antolin, R. Eisen, K. Gage
and M. Lindquist for their advice and assistance throughout
the project.
REFERENCES CITED
Anderson, S.H. and E.S. Williams. 1997. Plague in a
complex of white-tailed prairie dogs and associated
small mammals in Wyoming. J. Wildl. Dis. 33: 720-732.
Brinkerhoff, R.J., A.B. Markeson, J.H. Knouft, K.L. Gage,
and J.A. Montenieri. 2006. Abundance patterns of two
Oropsylla (Ceratophyllidae: Siphonaptera) species on
black-tailed prairie dog (Cynomys ludovicianus) hosts.
J. Vector Ecol. 31: 355-363.
Brisson, D., D.E. Dykhuizen, and R.S. Ostfeld. 2008.
Conspicuous impacts of inconspicuous hosts on the
Lyme disease epidemic. Proc. Royal Soc. B 275: 227235.
Cully, J.F. and E.S. Williams. 2001. Interspecific comparisons
of sylvatic plague in prairie dogs. J. Mammal. 82: 894905.
Cully, J.F., A.M. Barnes, T.J. Quan, and G. Maupin. 1997.
Dynamics of plague in a Gunnison’s prairie dog colony
complex from New Mexico. J. Wildl. Dis. 33: 706-719.
Fenton, A. and A.B. Pedersen. 2005. Community
epidemiology framework for classifying disease threats.
Emerg. Infect. Dis. 11: 1815-1821.
Gage, K.L. and M.Y. Kosoy. 2005. Natural history of plague:
perspectives from more than a century of research.
Ann. Rev. Entomol. 50: 505-528.
Gannon, W.L., R.S. Sikes, and the Animal Care and Use
Committee of the American Society of Mammalogists.
2007. Guidelines of the American Society of
Mammalogists for the use of wild mammals in research.
J. Mammal. 88: 803-823.
Holdenried, R. and S.F. Quan. 1956. Susceptibility of New
Mexico rodents to experimental plague. Publ. Hlth.
Rep. 71: 979-984.
Hubbard, C. A. 1968. Fleas of Western North America; Their
Relation to the Public Health. Hafner Publishing, New
York.
Humair, P., V. Douet, F.M. Cadenas, L.M. Schouls, I. Van
De Pol, and L. Gern. 2007. Molecular identification
of blood meal source in Ixodes ricinus ticks using 12s
rDNA as a genetic marker. J. Med. Entomol. 44: 869880.
Keesing, F., R.D. Holt, and R.S. Ostfeld. 2006. Effects of
species diversity on disease risk. Ecol. Letters 9: 485498.
Kent, R.J. and D.E. Norris. 2005. Identification of mammalian
blood meals in mosquitoes by a multiplexed polymerase
chain reaction targeting cytochrome b. Am. J. Trop.
Med. Hyg. 73: 336-342.
Kilpatrick, A.M., P. Daszak, M.J. Jones, P.P. Marra, and L.D.
Kramer. 2006. Host heterogeneity dominates West Nile
virus transmission. Proc. Royal Soc. B 273: 2327-2333.
December 2010
Krasnov, B.R. 2008. Functional and Evolutionary Ecology of
Fleas: A Model for Ecological Parasitology. Cambridge
University Press, Cambridge. 610 pp.
Lechleitner, R.R., L. Kartman, M.I. Goldenberg, and B.W.
Hudson. 1968. An epizootic of plague in Gunnison’s
prairie dogs (Cynomys gunnisoni) in south-central
Colorado. Ecology 49: 734-743.
Marshall, A.G. 1981. The Ecology of Ectoparasitic Insects.
Academic Press, New York. 459 pp.
Pauli, J.N., S.W. Buskirk, E.S. Williams, and W.H. Edwards.
2006. A plague epizootic in the black-tailed prairie dog
(Cynomys ludovicianus). J. Wildl. Dis. 42: 74-80.
Rasgon, J.L. 2008. Stable isotope analysis can potentially
identify completely-digested bloodmeals in mosquitoes. PLoS ONE 3: 1-3.
Salkeld, D.J., R.J. Eisen, P. Stapp, A.P. Wilder, L. Lowell, D.W.
Tripp, D. Albertson, and M.F. Antolin. 2007. The role of
swift foxes (Vulpes velox) and their fleas in prairie-dog
plague. J. Wildl. Dis. 43: 425-4311.
Salkeld, D.J. and P. Stapp. 2009. The effects of weather and
plague-induced die-offs of prairie dogs (Cynomys
ludovicianus Ord) on the fleas (Siphonaptera) of
northern grasshopper mice (Onychomys leucogaster
Wied). J. Med. Entomol. 46: 588-594.
Salkeld, D.J. and P. Stapp. 2008a. No evidence of deer mouse
involvement in plague (Yersinia pestis) epizootics of
prairie dogs. Vector Borne Zoonotic Dis. 8: 331-337.
Salkeld, D.J. and P. Stapp. 2008b. Prevalence and abundance
of fleas in black-tailed prairie dog burrows: Implications
for the transmission of plague (Yersinia pestis). J.
Parasitol. 94: 616-621.
Stapp, P. 2007. Rodent communities in active and inactive
colonies of black-tailed prairie dogs in shortgrass
steppe. J. Mammal. 88: 241-249.
Stapp, P., M.F. Antolin, and M. Ball. 2004. Patterns of
extinction in prairie-dog metapopulations: plague
outbreaks follow El Niño events. Front. Ecol. Environ.
2: 235-240.
Stapp, P. and D.J. Salkeld. 2009. Inferring host-parasite
feeding relationships using stable isotopes: Implications
for disease transmission and host specificity. Ecology
90: 3268-3273.
Stapp, P., D.J. Salkeld, R.J. Eisen, R. Pappert, J. Young, L.G.
Carter, K.L. Gage, D.W. Tripp, and M.F. Antolin. 2008.
Exposure of small rodents to plague during blacktailed prairie dog epizootics. J. Wildl. Dis. 44: 724-730.
Stapp, P., D.J. Salkeld, H.A. Franklin, J.P. Kraft, D.W. Tripp,
M.F. Antolin, and K.L. Gage. 2009. Evidence for the
involvement of an alternate rodent host in the dynamics
of introduced plague in prairie dogs. J. Anim. Ecol. 78:
807-817.
Thomas, R.E. 1988. A review of flea collection records from
Onychomys leucogaster, with observations on the role
of grasshopper mice in the epizoology of wild rodent
plague. Gr. Basin Nat. 48: 83-95.
Thomas, R.E., A.M. Barnes, T.J. Quan, M.L. Beard, L.G.
Carter, and C.E. Hopla. 1988. Susceptibility to Yersinia
pestis in the northern grasshopper mouse (Onychomys
Vol. 35, no. 2
Journal of Vector Ecology
leucogaster). J. Wildl. Dis. 24: 327-333.
Traub, R. 1985. Coevolution of fleas and mammals. In:
K.C. Kim (ed.). Coevolution of Parasitic Arthropods
and Mammals. pp. 331-361. John Wiley and Sons, New
York.
Tripp, D.W., K.L. Gage, J.A. Montenieri, and M.F. Antolin.
2009. Flea abundance on black-tailed prairie dogs
(Cynomys ludovicianus) increases during plague
epizootics. Vector Borne Zoonotic Dis. 9: 313-321.
Wickramasekara, S., J. Bunikis,V. Wysocki, and A.G.
Barbour. 2008. Identification of residual blood proteins
in ticks by mass spectrometry proteomics. Emerg.
Infect. Dis. 14: 1273-1275.
371
Wilder, A.P., R.J. Eisen, S.W. Bearden, J.A. Montenieri,
K.L. Gage, and M.F. Antolin. 2008. Oropsylla hirsuta
(Siphonaptera, Ceratophyllidae) can support plague
epizootics in black-tailed prairie dogs (Cynomys
ludovicianus) by early-phase transmission of Yersinia
pestis. Vector Borne Zoonotic Dis. 8: 359-367.
Woods, M.E., J.A. Montenieri, R.J. Eisen, N.S. Zeidner,
J.N. Borchert, A. Laudisoit, N. Babi, L.A. Atiku, R.E.
Enscore, and K.L. Gage. 2009. Identification of flea
blood meals using real-time polymerase chain reaction
targeting mitochondrial gene fragments. Am. J. Trop.
Med. Hyg. 80: 998-1003.