Figure S8 (A) Reads per million 350 300 250 200 150 Abundance of different isoforms in reproductive tissues Rest UUAGAUUCACGCACAAACUCA UUAGAUUCACGCACAAACUCU CUAGAUUCACGCACAAACUCG UUAGAUUCACGCAGAAACUCG UUAGAUUCACGCACAAACUCG 100 50 cco ppa sma mqu cru gbi pab nad afi pam zma mac mgi sbi zma pvi sit hvu tae osa vvi csi cpa gar ath cma mtr pvu sla lsa mgu nta phy can sly stu 0 (B) % abundance of different isoforms in reproductive tissues 100% 90% Reads per million 80% 70% 60% 50% Rest UUAGAUUCACGCACAAACUCA UUAGAUUCACGCACAAACUCU CUAGAUUCACGCACAAACUCG UUAGAUUCACGCAGAAACUCG UUAGAUUCACGCACAAACUCG 40% 30% 20% 10% cco ppa sma mqu cru gbi pab nad afi pam zma mac mgi sbi zma pvi sit hvu tae osa vvi csi cpa gar ath cma mtr pvu sla lsa mgu nta phy can sly stu 0% Figure S8. Abundance and sequence diversity of miR403 members across plant families in reproductive tissues. a abundance of miR403. Color bars represent most abundant forms of miR403 in reproductive tissues. b Percentage abundance of miR403 across plant families.
© Copyright 2026 Paperzz