Supplementary information Thermodynamic prediction of stoichiometry Calculations for Ph oxidation coupled to partial denitrification followed Rittmann and McCarty (2001). ΔG values were obtained from Helgeson et al. (1998) with the 5 exception of Ph and Pr, which were determined using the group contribution method as described in Mavrovouniotis (1991). 10 15 ΔGpc = energy of formation of pyruvate from substrate ΔGpc = 35.09 - ΔGsubstrate, n = -1 if ΔGpyruvate synthesis < 0, n = +1 if ΔGpyruvate synthesis > 0 ΔGp = energy for the formation of cellular material from pyruvate ΔGp = 18.8 kJ/e- eq with NH4+ as a N source (5) ε: efficiency of energy transfer, 0.4 – 0.7 for anaerobic heterotrophs ΔGcell synth = (ΔGpyruvate synth/ εn) + (ΔGpyruvate synth/ εn) ΔGR = reaction free energy of the coupled electron acceptor and donor ΔGR = ΔGdenitrification – ΔGPh oxidation A = # eq of the electron donor oxidized per eq of cell synthesis A = [(ΔGpyruvate synth/ εn) + (ΔGcell synth/ εn)]/ε ΔGR fS0 = e- eq cell mass /e- eq donor fe0 = e- eq cell mass/ e- eq acceptor fS0 = 1/(1 +A) fe0 = 1 - fS0 (1) (2) (3) (4) (6) (7) (8) (9) (10) (11) (12) (13) 20 25 30 NO3- + 2H+ + 2e- NO2- + H2O 6(-CH3) + 10(–CH2) + 4(–CH) C20H42 C20H42 + 60H2O 20HCO3- + 142H+ + 122e6(-CH3) + 9(-CH2) + 4(-CH) C19H40 C19H40 +57H2O 19HCO3- + 135H+ + 116e- ΔG = -81.52 kJ/e- eq ΔG = 107.76 kJ/mol ΔG = 19.57 kJ/e- eq ΔG = 99.97 kJ/e- eq ΔG = 16.62 kJ/e- eq For Ph with ε = 0.7: ΔGpyruvate synth = (35.09 kJ/e- eq) – (107.76 kJ/e- eq) = -72.63 kJ/e- eq ΔGcell synth = (-72.63 kJ/e- eq /0.7) + (18.8 kJ/e- eq /0.7) = -76.9 kJ/e- eq ΔGR = (-81.52 kJ/e- eq) – (19.57 kJ/e- eq) = -101.09 kJ/e- eq A = [(-72.63 kJ/e- eq) /0.7 + (18.8 kJ/e- eq) /0.7] /[ 0.7*-101.09 kJ/e- eq] = 1.09 fS0 = 1/(1 + 1.09) = 0.48 fe0 = 1 – 0.48 = 0.52 For Ph with ε = 0.4: (14) (15) (16) (17) (18) (19) (20) (21) (22) (23) 35 40 ΔGcell synth = (-72.63 kJ/e- eq /0.4) + (18.8 kJ/e- eq /0.4) = -134.58 kJ/e- eq A = [(-72.63 kJ/e- eq) /0.4 + (18.8 kJ/e- eq) /0.4] /[ 0.4*-81.52 kJ/e- eq] = 3.33 fS0 = 1/(1 + 2.62) = 0.23 fe0 = 1 – 0.46 = 0.77 Electron acceptor 0.5NO3- + H+ + e- 0.5NO2- + 0.5H2O Electron donor 0.01C20H42 + 0.6H2O 0.2HCO3- + 1.42H+ + eCell synthesis 0.25HCO3- + 0.05NH4+ + 1.2H+ + e- 0.05C5H7O2N + 0.65H2O (24) (25) (26) (27) (28) (29) 45 For Ph with ε = 0.7: 0.01C20H42 + 0.26NO3- + 0.024NH4+ + 0.028H2O 0.08HCO3- + 0.024C5H7O2N + 0.26NO2- + 0.32H+ (28) NO3-: HCO3- = 3.25 (30) 50 For Ph with ε = 0.4: 0.01C20H42 + 0.39NO3- + 0.012NH4+ + 0.07H2O 0.14HCO3- + 0.012C5H7O2N + 0.39NO2- + 0.37H+ (31) NO3-: HCO3- = 2.70 (32) 55 60 65 70 For Pr with ε = 0.7: ΔGpyruvate synth = (35.09 kJ/e- eq) – (99.97 kJ/e- eq) = -64.88 kJ/e- eq ΔGcell synth = (-64.88 kJ/e- eq /0.7) + (18.8 kJ/e- eq /0.7) = -65.83 kJ/e- eq ΔGR = (-81.52 kJ/e- eq) – (16.62 kJ/e- eq) = -98.14 kJ/e- eq A = [(-64.88 kJ/e- eq) /0.7 + (18.8 kJ/e- eq) /0.7] /[ 0.7*-98.14 kJ/e- eq] = 0.96 fS0 = 1/(1 + 0.96) = 0.49 fe0 = 1 – 0.49 = 0.51 (33) (34) (35) (36) (37) For Pr with ε = 0.4: ΔGcell synth = (-64.88 kJ/e- eq /0.4) + (18.8 kJ/e- eq /0.4) = -115.2 kJ/e- eq A = [(-64.88 kJ/e- eq) /0.4 + (18.8 kJ/e- eq) /0.4] /[ 0.4*-98.14 kJ/e- eq] = 2.93 fS0 = 1/(1 + 2.93) = 0.25 fe0 = 1 – 0.25 = 0.75 (38) (39) (40) Electron acceptor (1) 0.5NO3- + H+ + e- 0.5NO2- + 0.5H2O Electron donor (2) 0.01C19H40 + 0.57H2O 0.19HCO3- + 1.35H+ + eCell synthesis (3) 0.25HCO3- + 0.05NH4+ + 1.2H+ + e- 0.05C5H7O2N + 0.65H2O (41) (42) (43) 75 For Pr with ε = 0.7: 0.01C19H40 + 0.25NO3- + 0.026NH4+ 0.063HCO3- + 0.026C5H7O2N + 0.25NO2- + 0.25H+ + 0.007H2O (44) NO3 : HCO3 = 3.92 (45) 80 For Pr with ε = 0.4: 0.01C19H40 + 0.38NO3- + 0.013NH4+ + 0.33H2O 0.13HCO3- + 0.013C5H7O2N + 0.38NO2- + 0.3H+ (46) NO3 : HCO3 = 2.94 (47) 85 Ph and Pr degradation rate constant calculations Pr degradation rate constants were calculated from the loss of Pr over 40 days. Pr concentration at any time point was determined by using the stoichiometry determined for ε = 0.7 or ε = 0.4 and the moles of DIC measured. The ratio of DIC to Pr was 6.25 for ε = 0.7, and 12.75 for ε = 0.4. We applied zero, first and second-order 90 models to explain the kinetics of Pr degradation. Based up the R2 values of linear fits to the Pr degradation models and for comparison with described hydrocarbon biodegradation rate constants (Grossi et al., 2000; Larter et al., 2003), we report the first order rate constant. For Pr, k = 1.1 yr-1 (r2 0.76, n=8) to 2.5 yr-1 (r2 0.77, n = 8). Values used in determining the linear fit (time = k*ln[Pr] +b) are reported in Table 95 S-2. Ph degradation rate constants were calculated as described for Pr. The ratio of DIC to Ph was 8.0 for ε = 0.7, and 14.25 for ε = 0.4. For Ph, k = 0.10 yr-1 (r2 0.83, n=15) to 0.20 yr-1 (r2 0.83, n = 15). Values used for determining the rate constant are reported in Table S-3. 100 Analysis of labeled Ph purity and yield Growth of 28 l Haloferax sulfurifontis SD1 resulted in 33.4 g lyophilized biomass. A modified Bligh-Dyer extraction and acid methanolysis of the biomass yielded 60.9 mg saponified material. After derivatization with BSTFA, analysis with GC-MS revealed the saponified material to be archaeol (S-1). Assignment of 105 archaeol followed MS fragmentation patterns of Teixidor and Grimalt (1992) and Steihl et al. (2005). Major MS fragments (m/z) of the archaeol-TMS derivative include: the M+. (724 m/z); M – C20H41 (445 m/z); M – C20H41OH (426 m/z); M – C20H41OSi(CH3)3 (369 m/z); C20H41 (278 m/z); and CH2CHCH2OSi(CH3)3 (130 m/z). After treatment of archaeol with HI, extraction with benzene recovered 50.0 110 mg phytyl iodide. Initially, the phytyl iodide extract had a distinct purple color, but became faintly yellow following a second extraction with benzene and 5% sodium thiosulfate. Reductive dehalogenation of phytyl iodide with Zn and CH3CO2H produced 39.8 mg Ph. GC-MS showed Ph to be the dominant peak, but also showed the presence of several additional peaks (Fig. S-2). Purification with Supelclean LC- 115 Si SPE tubes (6 ml, Supelco, Bellefonte, PA) resulted in the elution of 22.2 mg Ph. GC-MS showed a single peak, assigned as phytane from comparison with the NIST 08 mass spectra library (Fig. S-2). 120 Fig. S-1. Total ion chromatogram and mass spectrum of saponified 13C-labeled diphytanyl glycerol diether from Haloferax sulfurifontis SD1. Fig. S-2. Total ion chromatogram and mass spectra of 13C-labeled Ph before and 125 after SPE purification. Fig. S-3. Quantitative FISH counts of isoprenoid degrading enrichment over the course of seven transfers, showing the fraction of DAPI stained cells hybridizing to a 130 Pseudomonas stutzeri probe (Pseu15, triangles), a Commamonas probe (Cte659, squares) and a Bacteriodales probe (CFB719b, diamonds). Error bars represent ±1 standard deviation based upon the counting of a minimum of 1000 cells. 135 Fig. S-4. (A) Keeling plot of δ13C for DIC produced during incubations on 13Clabeled Ph vs 1/[DIC]. Data points represent average of 3 replicate incubations and error bars are ± 1 standard deviation. (B) Contribution of background carbon (δ13C 40‰) and 13C-labeled Ph (δ13C +325‰) to DIC production in a two component mixture. Background carbon is the major source of DIC produced in the initial 0-20 140 days, while 13C-labeled Ph is the source of DIC throughout the remainder of the incubation. Table S-1 Oligonucleotide probes used. Formamide Probe Target group Sequence (5’ 3’) Target site Reference (%) (Amann et al., EUB338a Most Bacteria GCTGCCTCCCGTAGGAGT 0 – 50 16S (338-355) 1995) EUB338- (Daims et al., Planctomycetales IIa GCAGCCACCCGTAGGTGT 0 – 50 16S (338-355) 1999) EUB338- (Daims et al., Verrucomicrobiales IIIa GCTGCCACCCGTAGGTGT (Simplicispira sp.) 16S (338-355) 1999) (Schleifer et al., Comamonadaceae CTE659 0 – 50 TTCCATCCCCCTCTGCCG 40 16S (659-676) 1992) Pseudomonas Pseu15 GCAAGCTCCACTCATCCGCT stutzeri CFB719b Bacteriodales a Combined 145 (Demaneche et AGCTGCCTTCGCTATCGG in equimolar amounts to make EUBMIX. 35 16S (64-83) al., 2008) 30 16S (719-737) This study Table S-2 Values used for Pr first-order rate constant determination. ε = 0.7 n=8 150 ε = 0.4 Time (days) HCO3(µM) Pr (µM) ln[Pr] Pr (µM) ln[Pr] 0 0 729.0 6.59 729.0 6.59 7 508.9 647.6 6.47 689.1 6.54 20 1152.6 544.6 6.30 638.6 6.46 39 1078.6 556.5 6.32 644.4 6.47 0 0 729.0 6.59 729.0 6.59 7 565.3 638.6 6.46 684.7 6.53 20 1040.5 562.5 6.33 647.4 6.47 39 1154.7 544.3 6.30 638.5 6.46 Table S-3 Values used for Ph degradation first-order rate constant determination. ε = 0.7 n = 18 155 ε = 0.4 Time (days) HCO3(µM) Ph (µM) ln[Ph] Ph (µM) ln[Ph] 0 0 699.8 6.55 699.8 6.55 7 13.7 697.7 6.55 698.6 6.55 20 35.0 695.5 6.54 697.3 6.55 47 58.5 692.5 6.54 695.7 6.54 82 118.8 686.9 6.53 692.5 6.54 120 341.4 660.0 6.49 677.4 6.52 0 0 699.8 6.55 699.8 6.55 7 11.4 698.3 6.55 699.0 6.55 20 43.8 694.3 6.54 696.7 6.55 47 72.0 690.8 6.54 694.7 6.54 82 177.6 677.5 6.52 687.3 6.53 120 387.6 651.3 6.48 672.5 6.51 0 0 699.8 6.55 699.8 6.55 7 13.7 698.0 6.55 698.8 6.55 20 26.7 696.4 6.55 697.9 6.55 47 45.2 694.1 6.54 696.6 6.55 82 76.2 690.2 6.54 694.4 6.54 120 318.3 660.0 6.49 677.4 6.52 References 160 Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiology Reviews 59, 143-169. Daims, H., Bruhl, A., Amann, R., Schleifer, K.-H., Wagner, M., 1999. The domainspecific probe EUB338 is insufficient for the detection of all Bacteria: development and evaluation of a more comprehensive probe set. Systematic and Applied Microbiology 22, 434-444. 165 170 175 Demaneche, S., Sanguin, H., Pote, J., Navarro, E., Bernillon, D., Mavingui, P., Wildi, W., Vogel, T.M., Simonet, P., 2008. Antibiotic-resistant soil bacteria in transgenic plant fields. Proceedings of the National Academy of Sciences USA 105, 3957-3962. Grossi, V., Raphel, D., Hirschler-Rea, A., Gilewicz, M., Mouzdahir, A., Bertrand, J.C., Rontani, J.-F., 2000. Anaerobic biodegradation of pristane by a marine sedimentary bacterial and/or archaeal community. Organic Geochemistry 31, 769. Helgeson, H.C., Owens, C.E., Knox, A.M., Richard, L., 1998. Calculation of the standard molal thermodynamic properties of crystalline, liquid, and gas organic molecules at high temperatures and pressures. Geochimica et cosmochimica acta 62, 985-1081. Larter, S., Wilhelms, A., Head, I., Koopmans, M., Aplin, A., Di Primio, R., Zwach, C., Erdmann, M., Telnaes, N., 2003. The controls on the composition of biodegraded oils in the deep subsurface—part 1: biodegradation rates in petroleum reservoirs. Organic Geochemistry 34, 601-613. 180 Mavrovouniotis, M.L., 1991. Estimation of standard Gibbs energy changes of biotransformations. The Journal of Biological Chemistry 266, 14440-14445. Rittmann, B.E., McCarty, P.L., 2001. Environmental Biotechnology: Principles and Applications. McGraw-Hill. 185 190 Schleifer, K.H., Amann, R., Ludwig, W., Rothemund, C., Springer, N., Dorn, S., 1992. Nucleic acid probes for the identification and in situ detection of pseudomonads. In: Galli, E., Silver, S., Withold, B. (Eds.), Pseudomonas: Molecular Biology and Biotechnology. American Society for Microbiology, Washington, pp. 127134. Stiehl, T., Rullkötter, J., Nissenbaum, A., 2005. Molecular and isotopic characterization of lipids in cultured halophilic microorganisms from the Dead Sea and comparison with the sediment record of this hypersaline lake. Organic Geochemistry 36, 1242-1251. 195 Teixidor, P., Grimalt, J.O., 1992. Gas chromatographic determination of isoprenoid alkylglycerol diethers in archaebacterial cultures and environmental samples. Journal of Chromatography A 607, 253-259.
© Copyright 2024 Paperzz