Figure 4. Ideal E. coli plasmid with the XPC gene inserted and

Title: Understanding the XPC Gene in Tetrahymena thermophila
Lisa Cillessen and Kelly Irwin, Fall 2008
Abstract: This project will focus on the gene XPC found in humans. It is important for humans
to study XPC, as it is essential to the repair of damaged DNA and DNA lesions through
nucleotide excision repair (NER). During the NER process, XPC is one of the first to notice
damaged DNA1. In order to minimize mutations, it is vital to repair damaged DNA as quickly as
possible. Scientists are learning that mutations cause most cancers; therefore, in the medical
aspect, XPC is an important gene to understand. Even though this is an important gene in
humans, it is not ethical to conduct a fair amount of the experiments necessary to understand the
gene on humans. Therefore, to study the important aspects of human research scientists use
model organisms. In this project, Tetrahymena thermophila is the model organism. Tetrahymena
is very small and easily cultured quickly. This model organism also allows for relatively easy
gene “knock-outs” and “tagging”2. This project uses Tetrahymena DNA to prepare the coding
sequence of the XPC gene for replication and cloning for further use in experiments.
Introduction: The basis of this project is to clone the gene XPC in order to store and use later,
possibly by other scientists. The investigation into the XPC gene is on the raise among many
scientists. This increase is due to the understanding that if the nucleotides damaged by UV lights
are not repaired quickly; they lead to skin cancer. One example is the loss of the NER process
leading to xeroderma pigmentosum, a disease characterized by an increase in the risk of skin
cancer and lesions3. The XPC gene recognizes lesions and other damages to the nucleotides in
order for speedy repair. Quick recognition of damaged DNA is essential for the NER process to
work effectively and remove any harmful changes from DNA before they replicate and have the
chance to develop into cancer. As the general population pushes for a cure to cancer, a better
understanding of the XPC gene and the way it works can bring about a positive outcome for
those suffering from skin cancer.
For the procedures in this project, one will learn how to complete basic micro and molecular
biology laboratory procedures including those listed here: This laboratory explores the
bioinformatics of the gene XPC. In doing so, one finds a gene sequence and homolog. Using this
information throughout the laboratory creates a better understand of the gene being studied.
DNA from Tetrahymena is isolated and the quantity is determined in order to proceed to the next
step and be able to calculate the correct master mix for Polymerase Chain Reaction (PCR). PCR
allows for the replication of the XPC gene, which is then cloned to produce multiple identical
copies. These copies can be stored in E. coli plasmid and used later, or by a different scientist.
Before the plasmid is ready for any research, however, it is purified and a restriction enzyme
digest was ran to determine which plasmids contain the XPC gene.
Methods/Procedure:
*For full description of all the procedures, the BMS 110 Honors Fall 2008 Laboratory Handouts
may be consulted located in the composition notebook for this project.
Bioinformatics: Molecular Computational Tools
During the “Bioinformatics” laboratory, XPC was chosen as the gene to be studied throughout
the semester. Using the National Center for Biotechnology Information (NCBI), the amino acid
sequence was obtained for the gene of interest. From here, the Tetrahymena homolog was
located and sequenced in the Tetrahymena Genomic Database. This sequence is a reference for
the rest of the project.
Tetrahymena Genomic DNA Isolation
After obtaining a culture of Tetrahymena, it is important to centrifuging the culture to force the
cells into a pellet in order to pour off the supernatant (unwanted fluid, mainly the liquid media)
leaving only the cells behind. Complete this process quickly so that the Tetrahymena do not
swim away. One of the important steps in this laboratory is adding Urea Lysis Buffer. The Lysis
causes cell death by filling the cells with too much water and the membrane can no longer stay
intact. This is essential in isolating the DNA since the membrane helps protect the DNA. One
goes on to add 600μL of phenol:chloroform and centrifuge the mixture, pulling off the aqueous
layer to continue isolating the DNA. Adding NaCl reduces the carbohydrates in the product. The
DNA is then precipitate by adding isopropyl and centrifuge to collect the DNA. The addition of
ethanol removes all the unwanted salt. After centrifuging the ethanol wash, the DNA pellet is air
dried to ensure the removal of ethanol. The DNA is then re-suspended in TE buffer. Finally,
RNase A is added to the DNA mixture and incubated at 37oC for 10 minutes.
Quantification of Genomic DNA
Using spectrophotometric measurements, one may quantify the amount of DNA that has been
isolated. Running a test at the wavelength of 260nm allows the nucleic acid concentration to be
calculated. A second reading at wavelength 280nm gives a reading of the concentration of the
nucleic acid and proteins in the sample. In order to prepare the sample for such readings, dilution
of the DNA ensures enough solution for an accurate spectrophotometeric reading. After allowing
the spectrophotometer to warm up and running a blank to set the machine to accurate readings.
Place 0.1mL of dilution in the cuvette for reading. Using the A260 and A280 readings, the
concentration of DNA is calculated.
Polymerase Chain Reaction (PCR)
PCR allows one to copy a great number of a desired section of DNA in a short time period. To
begin this process, the concentration from the previous laboratory is used in order to determine
the amount of DNA to add to the “master mix”—the PCR mixture contains enough to complete
three separate annealing temperatures. Beginning the preparation of the master mix, add the
buffer (MgCl2) and dNTPs. Adding a calculated amount of sterile, distilled water guarantees
enough solution in the microfuge tube for accurate readings. TF-sense-(tagging forward) primer
[XPC-TF (34-MER; TM=55°C)5’-CAC CCT CGA GGA TTC AAA TGA AGA TCT TGA TTT
C-3’] and TR-antisense-(tagging reverse) primer [XPC-TR (33-MER; TM=59°C)5’-CCT AGG
TCA CAT ACT TAT TTT ATT TTA TCT ATC-3’] are added. These primers are specific to the
XPC gene in order that this is the portion of the DNA maybe copied. An enzyme, Physion
polymerase (1.50μL), is added in order to start the reaction-this should be the last ingredient
added to the mix besides the DNA. After completion of the master mix and evenly distributing it
into three microfuge tubes (50μL each), add the DNA to each individual tube. The tubes are
placed in a program thermocycler to heat the reactions for 1 minute at 98oC and then 34 cycles of
20 seconds at 98oC, 25 seconds at primer annealing temperature (60oC, 56.2oC, 52.2oC, and
50oC), and 1.5 minutes polymerase at 72oC. Once the cycles are completed, hold the reactions at
72oC for 10 minutes before chilling at 4oC.
Agarose Gel Electrophoresis
Running an agarose gel allows one to be able to tell if the PCR in the previous laboratory worked
correctly or not and which temperature was best for annealing. *Due to time constraints, the
laboratory instructor prepared the agarose gels; therefore, the experiment began with preparing
the gel. Fill the electrophoresis chamber with 1X TAE until it just covered the top of the gel, and
remove the comb creating the wells in the gel. In order to have a comparison for the PCR
products, add a control (1kb ladder) to lane one. Add a sample of each PCR product to a small
dot of 10X sample dye, mixing on Parafilm before pipetting to their respective lanes. After
loading each well, connect the chamber to the power source at 90 volts. The black end is closest
to the wells as DNA is negative therefore runs to red. After the bands run three-fourths of the
way down the gel (roughly an hour), stop the process and view the gel at under a UV light (if the
gel is ran at a lower voltage for a longer period, the results will be clearer). From the picture, one
can determine if the determine which PCR product is best by the intensity of the band and
whether or not there are any primer dimers at the bottom of the gel. In addition, the gene XPC
has roughly 3100 base pairs; therefore, the product would as well want 3100 base pairs compared
to the standard to be accurate.
TOPO Cloning and E. coli Transformation
To begin the TOPO cloning reaction, add PCR product, salt solution, sterile water, and the
TOPO vector together. Allow this to sit for 10 minutes, giving time for cloning. Add the cloning
product to the E. coli and iced for 10 minutes; heat shock for 30 seconds, and immediately place
in ice. Add SOC Medium to the E. coli mixture and place in the shaking incubator for an hour at
37oC. In order to watch the cultures grow, place the majority of the mixture (between threefourths and four-fifths) in a dish of kanamycin. Add the remainder of the mixture to a separate
dish of kanamycin. They are place in the incubator overnight at 37oC.
Construction of Plasmid Map and Restriction Enzyme Digestion Design
Using the Gene Construction Kit, create a plasmid map with the XPC genes sequence inserted
into the plasmid. From this plasmid map, the program labels specific sequence markers for the
different restriction enzyme sites. Knowing the different restriction enzymes located in the XPC
gene, HindIII was selected, as its palindromic sequence was located three times throughout the
XPC portion of the plasmid. After selecting a restriction enzyme, ideal gel bands for HindIII
were determined. This information will be useful in the next experiment.
Plasmid Purification and Restriction Enzyme Digest
Before purifying the plasmid, six colonies of E. coli were transferred from the cloning
transformation plate and grown in liquid bacteria. To do so, one at a time, pick six colonies from
the cloning plate and dot on a fresh gridded plate (These new isolated colonies correspond to E.
coli being tested for XPC and if positive for XPC may be used in further experiments). Once
dotted on the new plate, mix the remaining colony with liquid bacteria and kanamycin and place
in the 37oC shaking incubator overnight. This processes sets up the purification of the plasmid.
In order to obtain the cells with possible XPC gene inserted, each culture is evenly pipetted into
three different microfuge tubes (1.5mL each). By centrifuging each tube, the cells separate from
the liquid bacteria. Add the Buffer P1 to one tube for each culture, the pellet resuspended, and
transferred to the next tube in the culture. Again resuspending the pellet and transferring to the
next culture. After completing this process in the third tube (now down to one tube per culture),
add the Buffer P2 and invert tube to mix (the solution turns blue). This buffer is a lysis buffer,
used to break opened the cells. In order to neutralize the solution and to establish protein
denaturing, add buffer N3 and invert creating a homogenous precipitant. A QIAprep spin column
gathers the plasmid. Apply washes of Buffer PB and Buffer PE to rid the product of protein.
Finally, wash the column with Elution Buffer to stabilize the pH. This produces purified plasmid.
Run a restriction enzyme digest in order to determine if the XPC gene was truly inserted into the
plasmid of the colonies selected. Mix a cocktail of 10X Buffer, RE #1 (HindIII), and water for
the digest. Add 2μL of plasmid for each culture to its respective cocktail mixture and mix by
pipetting. Incubate the reactions over night at 37oC. The following day, add 10X dye to each tube
and a gel ran to determine if the gene XPC was present. The bands that appear on the gel
determine the presence of XPC. HindIII cuts XPC into base pairs of 4000, 1400, and 400.
Results:
To begin the project, the genomic sequence of XPC was obtained (Figure 1). Using different
databases, including NCBI, BLAST, and the Tetrahymena Genomic Database, the genomic
sequence of Tetrahymena XPC was obtained. This sequence is used throughout the project in
various aspects. The sequence provides a reference point in determining the correct primers to
use during PCR and it also tells the number of base pairs located in the gene. Besides PCR, the
sequence is also used in creating the plasmid maps and determining the different restriction
enzymes. For these reasons and many more, it is vital to this project to have a genomic sequence
of the gene being studied.
After obtaining the genomic sequence for Tetrahymena, the process of working with
Tetrahymena began. After isolating the DNA, it was important to quantify the DNA. Knowing
the actual amount of DNA obtained from the culture is helpful when piecing together the master
mix for PCR. The DNA is quantified using a spectrophotometer. The first recording (260nm)
measures the nucleic acid concentration while the second (280nm) measures the nucleic acid and
proteins. These readings are used to determine the concentration of DNA within the sample
(Table 1).
Once obtaining the isolated DNA and calculating the proper values for each of the components
in the PCR master mix, the mixture is completed and ran through an agarose gel. This gel
separates the DNA fragments according to base pairs size. Figures 2 and 3 show the agarose gels
for the PCR products ran for our products as well as the other groups working with XPC,
respectively. Since our products did not work properly, we will be working with the other groups
second product for the remainder of the project in order to save time.
After completing PCR, the XPC gene was inserted into E. coli plasmid. This allows for easy
storage and possible usage by other scientists. Ideally, completing the TOPO cloning and
transformation into E. coli, the only colonies that will grow in the Petri dish will have the XPC
gene inserted in them. Table 2 shows the results in the number of colonies for each of our plates.
However, a negative control was also ran developing 16 colonies. Theoretically this means 16
colonies on each plate are due to factors other than the XPC gene. Due to this information, the
plates cannot be used. Therefore, the plates from the other group working with XPC will be used
for the restriction enzyme testing.
While allowing the colonies to full develop and mature, a plasmid map with restriction enzymes
labeled and an ideal gel band for the selected restriction enzyme (HindIII) were constructed
using a Gene Construction Kit (Figures 4 and 5, respectively). The plasmid map with restriction
enzymes gave a visible picture of the process hopefully occurring in the E. coli colonies. This
map is also used to determine an appropriate restriction enzyme to use to determine if the gene
XPC was inserted into the E. coli plasmid. After selecting HindIII to work with, the ideal gel
band was created. This serves as a reference point when running the gel for the restriction
enzyme digest. The plasmid would have a successful insertion of the XPC gene if the restriction
enzyme poses the same key bands.
After selecting six different E. coli colonies to work with, the colonies are purified and a
restriction enzyme digest ran. Completing the restriction enzyme digest will prove whether the
XPC gene is inserted into the plasmid or not. Figure 6 shows the results of the gel ran from the
restriction enzyme digest. Ideally, bands would have been seen at 4000, 1400, and 400 base
pairs. Due to the lack of the results, even thought the other group using XPC conducted a
different restriction enzyme digest, their information is still comparable (Figure 7, located in the
addendum).
CACCCTCGAGGATTCAAATGAAGATCTTGATTTCAATGATGAATTTGAAGAAGTAGA
TGAAAAATAAAATGAAGATAGGATAAGCTTTGGATCTGATGACGAAAATAATTAGT
AGAAGTAATCAGATTCAGAAGATAATCTCTATTTTGATAATAAAATCAAAAATAATA
AAAAATAAAAAAATAAATTGGAAGACAGCTATGAAGATGATAGAATGATTAATGAA
GATGAAAATTAAGATATCGATTTTTTAAATGCCATTTGTAATAAAGATGAAGAAGGT
TAAAAAAACATGAGAGAAGACTTTTTAAGTTTGATTAAAACTGCAGGAGATGATGA
TACAATTCAGAAATTAATGTAAGAAAGACAACAATTAGGTAGAACTGAAGGAGGGA
GAGAGAATCCTCATATTATTAAAGAATAAATGATTCTTGAGAAAATGCTTGCAAAAC
AAAAAAGATATGATGAAATTATGTATGAAAAAGAAAAGCTTGAATTTCTAAAAAAA
ACTAGAAAGATTCGCTAAAATCCAGAAGAATACAGGAATTTTATTAAGTGTTTTGTA
TTATGCGAAATTTCTTCTACTTTCTACTTTCTATAGTCTCATTTGGAAGATGAGTATTT
AAAAGCTAAGATAATATCTTAATTTTCTTTAAAAGATTTAAATTTTTTACTTTCCATG
AAAAACTATCCTGAAAAATACTCAACTAGAAGTATTATAAAAACTGTTAATTATCAC
ATATAGCAATACTTTACTTATAAATGGAAGAAAGAATAAATTGAATTTCATAAAAAT
TTAGATGAAGGAATAGAGGTAGGCTACTCTTAAATGACATTAATTGCCTTGATCTTA
TTTGAATTTATTGGTATGAAAGTTAGATTTTCCAAAATTGTAGACATGAGATACCTC
AACCTTGACAAAAAACACAATTCAAGGATCAAAGAAAGTAAAAGAAGTTCAAATTA
GTCTTAAGAATCCACACATAGCAATTAAAAGCGTACTAGAGAATCTATAGTAAGTA
GTGTTGTTTAAAATAAGAGAGCTGCACGTTTTTCAGATATGGCTTCTAGAATTACTG
CTAAAATAATGAATTAGGTATAATAATTAGTTAAATATTAAAAAAAGGAATATTTAT
TTAATTTTTATAGACTTAAATGATAGAAGATTAAATAGATAGTGATTAAAGTGACAG
TGATGATGAAGATTATTAAACAAAAAAAAATGATAAAAAATAATAATAAAAAGAA
AGCAATGATTTATTTGACCAAATGCTGTCAAATTTTAAGTTTGATAAAAAAAGCACT
AACAATTCATCAATGATTAGTTTTAGTAATTAAAAAAAAAATTAACAAGAAGAAGA
TTCAATTGTTTCAACTGCCTCATCTACCTTTTAGACTGATCCTAAAAAATTTGATTTT
AGAAAGTATTTAAATAAAGGAAAAAAGCAAGATGATGATAAAAGCTCCTTATTGAA
AATAGATAACTAAACATAAAAATAAGAAGAAGAAGAAATTAAATTAGTTAATAAAA
AATTAAGTAATTTGAAGAAGTTAGATAGTTTATCTGATGGTAAATTAAAATTAGATA
ACATTAAATTTATTTTAATAATTAAATTTAATAGTAGAAAAATGCGAAAGCGAAGTT
GAAAAAGAAGAGGAAACTTTAAATCCATTTAATTTTGCTTTTTCTAAAAAAAAATTT
AAAAAGACTTAACAGGGTAGATTTTTAATTATTTTAATTTTAATTAATTATGTCATTT
TTTTAAGACTTAATATAGACTTAGTAGACAAATTAAACAGAATAGGATTCAAAGCTT
TTGGAAAATGACTAAAATTAATAACAATAAAAGTTATTAAAAAGTGATTTCTATCAA
AGTTCTGAAATAAAGTATTGGCTTGAAGTTTATGATGAAAAGAGTTAGCAATGGATT
TGTTTTGATGCTGTTTAGAATGAAATTTTAGAAAGATTCTAAATTTTGTTAAAATAAA
ATAGTATACCTGTTTTATTCATAGTTGGATATAATAAATTAGAATTTAAAAATGAAA
AATTAAAAGAATATGTTCATAACAAAAGATCTATGAAAAATTTGTTTTTATTTGATA
TTACTGATATACACTGTGATAGGTATCCGAAAATTTAGGTAAGTAGAAGAGAGTTGA
ATTTCGATTATTGGTGGAAAAATCTTCTTTAACATGTTTCATTTCTTGGAAATCCAGA
ATTACTATAAGACGAATATGTAAAATGTTATTTATAATAAATTATATTATTTATTATA
TAAAAAATAGAAACCCTAAGTAATTAGTGAAAGAGAAACAAAAATATAAATGTAAA
AATCTTAAATCCCTTAATCATATCCTGAGTTTAAAGCAAGTGAAATTTATATTACTA
AGTCAATGCTTTAAAAGTATTAAGGTTTACATCCAAATGCATAAAAGACAAATCTTA
CATTTAAAGACGAAGACGTAAGCAACTATGCTATTAACATTTATTATAATAAATTAA
TAAAAAAAAGGTATATTTTAAAGAATATGTCGTTGATTTGCATGCAAAAACTAGATG
GAGATCCTACTAAAGATCAGTTAAGCCTGATGAGAAGCCTGTTAAATAGGTTCAATC
GATTTTAGGTAACAAAAAAATGGTAGATTTGTTTGGATTCTGGTAAACTGAAGAGTT
AGTATACAAAATCAGAGATGATGGAACTCTCCCAAGAAATGAATATGGTAACTGGG
AGGTAATTTTAATTAAAATTATTATAATTTGTTTGTTTGATTTAAATTAAATAAAAAT
AAAATTTAATTTAATTAAACTCTCTCTTTAAAATCAAATTCTTATTTAGACGTTTGCT
GGTGATCCACCTGAAGGAACAGTTTTGATTGAAATCTAAGGATTACCTAAGTTGCTA
AAAAAACATAACATAGAGTATGTAGAAGCAGTTTGCGGATTTGAATCGACAGCATC
TGGTAGATCTCATGTGGTTAAAAATGGTATACTAGCCCACAAGAAAGATGAAGAAA
GAATAAGATAAATTTATTAAGATAACTATGAAATTATGAAAGCTCAGTAAGCAGAA
AATCTTAAAAAAGAGCTTATGGGATTTTGGAGAAAAATATTTAAAGGAGTTTTACTG
AAAAAGAGTATTTCAGATAGATAAAATAAAATAAGTATGTGACCTAGG
Figure 1. Genomic Sequence for the Tetrahymena XPC (T.t. XPC Genomic = 3176 bp or
cDNA = 2819 bp). The primers used in PCR are highlighted, the introns are black, and the
exons are red.
Table 1. Quantification of Genomic DNA.
A260
A280
1.354
0.767
[DNA] = 50μg/mL x absorbance at 260nm x 100 = 6.77μg/μl
1000μL/mL
S
1
2
3
4
5
Figure 2. Agarose Gel Electrophoresis for XPC.
The standard on the left with no bands in the
other lanes shows how the PCR did not
work correctly. (Lane 1 60oC; lane 2 52.4oC;
lane 3 56.2oC; lane 4 60oC; lane 5 50oC)
S
1
2
3
4
Figure 3. Agarose Gel Electrophoresis for XPC.
The standard on the left gives for comparison
to the bands of the PCR product. The band in
lane 2 will be the one used in this project. Its
annealing temperature was 50.0oC and
contains 3,000 base pairs.
*The wells are labeled “S” for the standard and lanes 1-5 for the different PCR products. A
standard 1kb ladder is provided in the middle for reference. Due to the lack of PCR product in
Figure 2, PCR product from another group will be used to carry out the rest of the project, Figure 3.
Table 2. E. coli transformation of the TOPO cloning reaction with Tt. XPC.
50μL
200μL
5 colonies
3 colonies
Figure 4. Ideal E. coli plasmid with the XPC gene
inserted and restriction enzymes labeled. In this
project, the restriction enzyme HindIII will be used to
cut the gene. The green sections are the exons and the
black are the introns of the genomic sequence.
1
2
3
4
5
6
Figure 5. Ideal gel bands for the
restriction enzyme HindIII
digest. Bands located at 4000,
1400, and 400 base pairs.
S
Figure 6. Gel of E. coli
colonies using the
restriction enzyme
HindIII. Lanes 1-6 are
samples of the purified
colonies while lane 7 is the
standard.
Discussion:
During the “Bioinformatics” laboratory, the genomic sequence for the gene XPC in Tetrahymena
thermophila was used throughout the rest of the project (Figure 1). The primers used in the PCR
master mixture were determined from the genomic sequence. In addition, when viewing the PCR
products after electrophorisis, the number of base pairs located in the genomic sequence are the
number of base pairs compared to the standard that are being looked for.
Once working with Tetrahymena cells, the genomic DNA was able to be isolated and
quantification determined. The isolation plays an important role as in order for the rests of the
procedures to run smoothly, the DNA needs to be isolated from the cells, organelles, and various
other proteins and particles. Quantifying the DNA allowed the concentration of the DNA to be
calculated (Table 1). This is important because in order to obtain a clean PCR product, one must
know the concentration of the DNA to create an accurate master mix. Also, if not enough DNA
is present, one can repeat the isolation and quantification processes again for better results.
Using the isolated and quantified Tetrahymena DNA, the PCR for the replication of the XPC
gene was completed. By running the products in an agarose gel against a standard, the outcomes
of the procedure were determined. The blank gel showed that something went wrong in the PCR
laboratory (Figure 2). It cannot be determined the exact error that occurred but some have been
hypothesized. As the other group studying XPC obtained data from the gel, it is most likely the
error is due to human error. Since very small amounts of DNA were being added to the mixes, if
the DNA was not inserted into the bottom of the microfuge tubes, it may have evaporated or was
not mixed into the rest of the reaction. Obtaining bad primers is most likely ruled out since the
other group working with XPC had PCR product. The only way for bad primers is if the other
group contaminated them. To save time from repeating the experiment and determining the exact
error, the product from one of the PCR from the other group studying XPC will be used for the
rest of the experiment (Figure 3).
After TOPO cloning the PCR product and transforming the cloning reaction into E. coli, the
E.coli colonies will be used to determine if the XPC gene was inserted into the plasmid of E.
coli. The number of E. coli colonies that grew in the dishes was less than expected. The negative
control produce 16 colonies while there were only 3 and 5 colonies on the dishes being studied
for 200μL and 50μL, respectively (Table 2). A few things could cause this. Firstly, the PCR
product was borrowed from another group; they may not have given the correct microfuge tube
for the PCR product needing to be studied. This is highly possible as only two of the four
products ran gave a usable product. Secondly, since the PCR product used was the less accurate
of the two products obtained, there may be some problems in the product. When viewing the gel,
some streaks below the primary line may indicate some impurities. Thirdly, the PCR product
may have needed the full time on all of the incubations since it was not the best PCR product
instead of the shortened times used due to time constraints of laboratory time. Due to this low
number of colonies, it would be best to continue working with the other group’s product from
this laboratory as they obtained more colonies. With more colonies, they have a greater chance
of collecting a colony not caused by the error in the negative control.
Constructing a plasmid map gave a visual picture of what the plasmid should look like with the
gene XPC inserted (Figure 4). Even though this is not a literal picture, it is helpful in
understanding the concept of what was supposed to be occurring during the E. coli
transformation. The map with restriction enzymes allowed for selection of the restriction enzyme
used to cut the plasmid to determine whether XPC was inserted or not. In this project, HindIII
was selected, as it was present three times throughout the XPC gene. The ideal bands gel gives a
comparison for when the gel with the restriction enzyme is ran (Figure 5). If these bands are
present, most likely XPC was inserted into the respective plasmid.
By viewing the gel, the brightest band was found at the bottom just above 3,000 base pairs
compared to the standard and 1kb ladder (Figure 6). From this, it can be determined that none of
the colonies chosen had the XPC gene inserted into the plasmid, as there was an error in the
procedure or with the restriction enzyme. The other group using a different restriction enzyme as
well did not have success inserting the XPC gene into the E. coli colonies (Figure 7); therefore,
there is a great possibility that there were a high number of colonies located on the dish not
containing the XPC gene.
Conclusion:
From the information gathered from the restriction enzyme digest, we were not successful in
inserting the XPC gene into the E. coli plasmid. The first step in trying to produce an actual
product would to be to return to the purification of the plasmid. Since the other group had one
successful colony, there might be another. If after multiple attempts fail, the restriction enzyme
might need to be tested to determine if it is actually working. If still no success, we would need
to return to the PCR step. This is where the project fell apart in the first place.
Addendum:
S
1
2
3
4
5
6
Figure 7. Gel of other
group working with XPC
and the same plate of
colonies. Lane 3 shows that
the restriction enzyme
BglII cut a gene sequence
other than XPC as the
bands do not mirror those
of the ideal band gel. *S
stands for the standard and
lanes 1-6 with their
respective colonies.
Wang, Qi-En et al. “DNA repair factor XPC is modified by SUMO-1 and ubiquitin following UV irradiation.”
Nucleic Acids Research, 2005. Vol. 33, No. 13. Oxford Press: 19 July 2005. 4023-4034.
2
Orias, Eduardo. “Introduction to the Genetics of Tetrahymena.” Tetrahymena Genome Database. 12 Feb. 1997.
<http://www.ciliate.org/genetics.shtml#Tetrahymena>. 8 Oct. 2008.
3
Fitch, Maureen E. et al. “In Vivo Recruitment of XPC to UV-induced Cyclobutane Pyrimidine Dimers by the
DDB2 Gene Product.” The Journal of Biological Chemistry. Vol. 278, No. 47. The American Society for
Biochemistry and Molecular Biology, Inc.: 21 Nov. 2003. 46906-46910.
1