[CANCER RESEARCH 62, 3009 –3013, June 1, 2002]
Advances in Brief
T-cell Factor-4 Frameshift Mutations Occur Frequently in Human Microsatellite
Instability-high Colorectal Carcinomas but Do Not Contribute
to Carcinogenesis1
Stefan Ruckert,2 Elke Hiendlmeyer,2 Wolfgang M. Brueckl,2 Ursula Oswald, Kurt Beyser, Wolfgang Dietmaier,
Angela Haynl, Claudia Koch, Josef Rüschoff, Thomas Brabletz, Thomas Kirchner, and Andreas Jung3
Pathologisches Institut [S. R., E. H., U. O., A. H., C. K., T. B., T. K., A. J.] and Medizinische Klinik I [W. M. B.] der Friedrich-Alexander-Universität Erlangen-Nürnberg, D-91054
Erlangen; Institut für Pathologie, Klinikum Kassel, 34125 Kassel [K. B., J. R.]; and Pathologisches Institut der Universität Regensburg, 93053 Regensburg [W. D.], Germany
Abstract
Colorectal carcinomas with microsatellite instability accumulate errors
in short repetitive DNA repeats, especially mono and dinucleotide repeats.
One such error-prone A9 monorepeat is found in exon 17 of the TCF-4
gene. TCF-4 and ␤-catenin form a transcription complex, which is important for both maintenance of normal epithelium and development of
colorectal tumors. To elucidate the relevance of frameshift mutations in
the TCF-4 in colorectal carcinogenesis, a variety of investigations in
human tumors and cell lines was performed. It was found that mutations
in the TCF-4 A9 repeat do not contribute to tumorigenesis and seem to be
passenger mutations.
Introduction
Mutations of the tumor suppressor gene APC4 are found in the
majority of sporadic CRC (60 – 80%), mostly in the MCR (1). Sporadic CRC can be divided into two subgroups, based on the functional
status of their mismatch repair system. Colorectal tumors with defective mismatch repair, mostly because of deficits of hMLH-1 or
hMSH-2, cannot repair errors made by DNA polymerases in microsatellites, which are short DNA tandem repeats (2). These tumors
display a phenotype of MSI and comprise ⬃15% of all CRC. The
remaining 85% have stable microsatellites (MSS). About 60% of
colorectal MSI tumors accumulate frameshift mutations in A or, less
frequently, G-stretches in the MCR of APC, whereas ⬃80% of the
MSS tumors show mainly transitions or transversions in the same
region (3). The lower number of APC mutations in colorectal MSI
tumors is supplemented by mutations in other genes that are part of
the canonical WNT signal transduction pathway (4), which is linked
to colorectal carcinogenesis (1, 5), e.g., mutations are found in exon
3 of the ␤-catenin gene (6) or exon 7 of the axin-2/conductin gene (7)
in ⱕ25% of all MSI-H cases each and ⬃39% of MSI-H cases in exon
17 (8) of the TCF-4 gene (9). Mutations in the axin-2/conductin gene
and in most of the TCF-4 cases (8) are found in short monorepeats,
whereas mutations in the destruction box of the ␤-catenin gene are
Received 2/13/02; accepted 4/19/02.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported in part by grants from Wilhelm-Sander Stiftung (Az.: 99.065.1; to A. J.,
T. B., and T. K.), DFG: DI 722/1-1 (to W. D.), Deutsche Krebshilfe: Verbundprojekt
erbliches Dickdarmkarzinom (to J. R. and W. D.), and Krebshilfeprojekt: Erbliches Dickdarm-Karzinom (Fö-Nr. 70-2401-Rü1; to J. R.).
2
S. R., E. H., and W. M. B. contributed equally to this manuscript.
3
To whom requests for reprints should be addressed, at Pathologisches Institut,
Krankenhausstr. 8-10, 91054 Erlangen, Germany. Phone: 49 (9131)-8522610; Fax:
49 (9131)-8524745; E-mail: [email protected].
The abbreviations used are: APC, adenomatous polyposis coli; HMG, high mobility
group; CRC, colorectal cancer; CtBP, COOH-terminal-binding protein; Grg, groucho;
TLE, transduction-like enhancer of split; LEF, lymphocyte enhancer-binding factor; WT,
wild-type; MCR, mutation cluster region; MSI, microsatellite instability; MSI-H, microsatellite instability-high; MSS, microsatellite stability; TCF, T-cell factor; MLH, mutL
homologue; MSH, mutS homologue.
mostly transitions or transversions (6). Moreover, mutations in the
APC or ␤-catenin genes are found to be mutually exclusive (10).
Mutations in the tumor suppressor APC occur very early during CRC
development and are the rate-limiting step; thus, APC has been termed
the gatekeeper (5). Altogether, this indicates a high selection pressure
for the presence of the oncogenic transcription factor ␤-catenin in
colorectal carcinogenesis because of loss of degradation (1). Consequently, mutation of the A9 repeat in exon 17 of the TCF-4 gene
should result in a gain of transcriptional activity, e.g., via loss of
binding sites for suppressive molecules, such as CtBP (8) or Grg/TLE
family members (11), and concomitantly, loss of binding of chromatin
remodeling complexes containing Osa/Brahma (12). Such altered
TCF-4 molecules could have either a higher affinity for the binding of
␤-catenin or could facilitate the structural reorganization of chromatin
(13), thus leading to transcriptional activation. On the other hand,
TCF-4 mutations may have only modifying effects in the process of
colorectal carcinogenesis or may exhibit passenger mutations without
affecting carcinogenesis, as MSI-H tumors show a predisposition for
mutation of short monorepeats (14). Inactivation of TCF-4 by mutation seems to be rather unlikely, as mice lacking TCF-4 die shortly
after birth because of a general defect in the genetic maintenance
program of crypt cells of the small intestine (15). To investigate the
possible role of mutations in the A9 stretch in exon 17 of the TCF-4
gene for colorectal carcinogenesis in greater depth, we screened a
panel of 46 human MSI-H colorectal tumors for these TCF-4 mutations and alterations of the ␤-catenin gene exon 3 and compared this
spectrum of mutations with the morphology of the tumors. Next, we
performed transient transfection experiments using the TOP-FLASH
system as a readout for ␤-catenin activity. Finally, we generated a
mutated TCF-4 A8 (A8 repeat) using in vitro mutagenesis and compared its transactivation capacity with that of WT TCF-4 in the
TOP-FLASH system to shed light on the functional consequences of
this mutation for transactivation. It was revealed that mutations of the
A9 monorepeat in exon 17 of TCF-4 had no significant effect and thus
may contribute only marginally to the carcinogenesis of colorectal
tumors or are only passenger mutations (14).
Materials and Methods
Detection of MSI and Mutations in the TCF-4 and ␤-catenin Genes.
Paraffin-embedded tumor tissue of patients with CRC from the archives of the
Institutes for Pathology in Erlangen, Kassel, and Regensburg, Germany were
screened for MSI as described elsewhere (16). Briefly, tissue sections were
stained using monoclonal antibodies specific for MLH-1 (clone 168-1; PharMingen, Heidelberg, Germany) and MSH-2 (NA27; Oncogene, Schwalbach,
Germany). Cases displaying loss of either MLH-1 or MSH-2 expression were
tested for MSI using DNA isolated from microdissected areas containing
tumor or normal colonic epithelium as template, using hereditary nonpolyposis
colorectal carcinoma MSI Test kits (Roche Diagnostics, Mannheim, Germany)
following Roche’s recommendations. MSI-H was scored when at least two of
3009
Downloaded from cancerres.aacrjournals.org on July 31, 2017. © 2002 American Association for Cancer Research.
TCF-4 MUTATIONS IN MSI-H CRC
the markers BAT25, BAT26, D2S123, D5S346, or D17S250 were found to be
unstable in tumors compared with normal tissue. Tumors (46) fulfilling these
criteria were selected. The status of the A9 repeat of exon 17 in the TCF-4 gene
was tested using fragment analysis. Briefly, DNA obtained from normal or
tumor tissue by microdissection was used together with the primer pair
GTTTCTTGCCTCTATTCACAGATAACTC (6-FAM labeled) and GTTTCTTGTTCACCTTGTATGTAGCGAA (Interactiva, Ulm, Germany) in PCR
reactions [1 ⫻ Ampli-Taq Gold buffer, 1 unit of Ampli-Taq Gold (Applied
Biosystems, Weiterstadt, Germany), 2.5 mM MgCl2, 200 ␮M deoxynucleotide
triphosphates, and 200 nM primers; 35 cycles with annealing at 58°C and a
final extension step at 72°C for 45 min]. Both primers carried a GTTTCTT
sequence at their 5⬘ ends to suppress the addition of extra A residues at the 3⬘
end of the complementary DNA strand during PCR (17). Consequently, nearly
single peak fractions for A9 or A8 PCR product were seen after electrophoretic
separation using POP-4 (4% w/v performance optimized polymer) and short
capillaries on a Genetic Analyser 310 (all Applied Biosystems). Threshold
values discriminating the three possible allelic distributions of the A9 repeat in
the TCF-4 gene (A9/A9 ⫽ A9, A9/A8 ⫽ het, and A8/A8 ⫽ A8) were
generated by simply dividing the values of the A9 peaks by the A8 peaks
obtained from DNA isolated from CRC cell lines SW480 (A9), LS174T (het),
and Lovo (A8). All PCR products resulting in borderline values were confirmed by sequence analysis using the primer GTTCACCTTGTATGTAGCGAA and Big Dye terminator sequencing kits (Applied Biosystems) following
the manufacturer’s recommendations. ␤-catenin exon 3 mutations were detected using TCCAATCTACTAATGCTAATACT and CATTGCCTTACTGAAAGTCAG in a first and CTACTAATGCTAATACTGTTTCG and
CAAGTAGCTGGTAAGAGTATTA primers in a second nested PCR
[1 ⫻ Ampli-Taq Gold buffer, 1 unit of Ampli-Taq Gold (Applied Biosystems),
2.5 mM MgCl2, 200 ␮M deoxynucleotide triphosphates, and 200 nM primers;
35 cycles with annealing at 57°]. Sequencing was performed as described
above using CTACTACTGCTAATACTGTTTCG (forward) and TAATACTCTTACCAGCTACTTG (reverse) primers after purification of the
PCR products using PCR purification kits (InVitrogen, Karlsruhe, Germany)
following InVitrogen’s recommendations.
Generation of pTCF-4 A8. An A8 mutation was introduced into the WT
TCF-4-encoding expression vector pTCF-4 (gift from Bert Vogelstein) using
Quickchange kits (Stratagene, Heidelberg, Germany) and the double-stranded
oligonucleotide GCCCTTGCAGGAGAAAAAAAAGTGCGTTCGCTAC. Success of mutation, giving rise to the expression vector pTCF-4 A8, was verified
by sequencing using the primer CAGACCTCAGCGCTCCTAAG (1624 –
1605, acc. no.Y11306) as described above.
Transient Transfection Assays. HCT116, Lovo, LS174T, SW48 (MSI),
HT29, SW480 (MSS), and 293T (human embryonic kidney) cells (American
Type Culture Collection, Manassas, VA) were maintained in DMEM containing 50 ␮M 2-mercaptoethanol and 10% (v/v) FCS (InVitrogen). Cells were
cotransfected with constant amounts (90 ng) of the firefly luciferase reporter
constructs TOP-FLASH or FOP-FLASH (gifts from Hans Clevers) as a readout for ␤-catenin/TCF-4 activity and 10 ng of the renilla luciferase reporter
construct ptk-RL (Promega, Heidelberg, Germany) for standardization of
transfections, using 0.7 ␮l of Superfect (Qiagen, Hilden, Germany). In other
experiments, various amounts of expression vectors p⌬45␤-catenin, pTCF-4,
pdnTCF-4 (gifts from Bert Vogelstein), and pTCF-4 A8 were cotransfected in
48 cluster well plates together with TOP-FLASH reporter constructs. pcI-neo
(Promega) or pcDNA3.1 f(⫺) (InVitrogen) was added to make up DNA to
constant amounts of 360 ng. After overnight incubation (18 –26 h), cells were
harvested, and luciferase values were analyzed using Dual Light kits (Promega) following Promega’s recommendations. All transfections were done at
least in triplicates. For comparison of ␤-catenin/TCF-4 activity, FOP-FLASH
values were set to 1, and TOP-FLASH values were based on this value.
Results
Mutations in the A9 repeat in the TCF-4 exon 17 (Fig. 1, A and B)
were found in 33.3% of investigated cases (15 of 45, 1 case failed).
Only 1 case in our collection exhibited a homozygous mutation (Fig.
1A). Exon 3 mutations in the destruction box of ␤-catenin were found
in 10.5% of cases (4 of 38, 7 cases failed) in codons 32, 39, 41, and
45 (data not shown). Both values fall within the range of published
data (6, 9). Moreover, the 4 cases displaying ␤-catenin mutations
Fig. 1. Sequence of PCR products generated from DNA of tumors from patients (A–C)
or cell lines (D–F) showing homozygous (A8; A and D) or heterozygous mutations (het;
B and E) or WT TCF-4 sequences (A9; C and F).
possessed heterozygous mutations in the TCF-4 gene simultaneously.
First of all, we compared the mutation state of TCF-4 and ␤-catenin
with the histology of the tumors, as different growth patterns have
been described for MSI-CRC. This may be because of the genetic
profile of the tumors (2, 18). But irrespective of TCF-4 or ␤-catenin
mutations, our MSI-H colorectal tumors displayed both 21 welldifferentiated (Fig. 2, A–D) and 25 poorly differentiated tumors (Fig.
2, E–G). No correlation between growth pattern of tumors and mutations in the TCF-4 or ␤-catenin genes was found. For homozygous
TCF-4 mutations (A8), a comparison was not possible as just a single
case with a well-differentiated growth pattern (Fig. 2A) made up this
group in our collection. Secondly, we considered whether mutations
in the A9 repeat of TCF-4 influence the activity of ␤-catenin/TCF-4
complexes, as A8 mutations lead to a loss of both binding sites for the
negative regulator CtBP (Fig. 4A). Moreover, it cannot be excluded
that TCF-4 and TCF-4 A8 differ with respect to their binding to other
proteins, as loss of the COOH terminus may affect the tertiary
structure of TCF-4 (Fig. 4A).
Therefore, transient transfections were performed. First of all, the
behavior of our TCF-4 expression clone was investigated, as TCF-4 is
known to be an ambivalent transcription factor that can either activate
or suppress transcription (11). 293T cells were transiently transfected
with increasing amounts of pTCF-4, which resulted in an optimum
curve with the rather low amount of 1.6 ng of pTCF-4 yielding the
maximum transactivation value (Fig. 3A, black bars). The addition of
pdn-TCF-4, even at higher amounts, led to an additional suppression
compared with TCF-4 (Fig. 3A, striped bars). Thus, the observed
suppressive effects induced by higher amounts of pTCF-4 are specific.
Next, MSI and MSS cell lines were transiently transfected with the
reporter constructs TOP-FLASH and FOP-FLASH, and the activity of
the cell lines (Fig. 3B) was compared, assuming that mutations in the
TCF-4 gene will affect ␤-catenin/TCF-4-induced transcription. How-
3010
Downloaded from cancerres.aacrjournals.org on July 31, 2017. © 2002 American Association for Cancer Research.
TCF-4 MUTATIONS IN MSI-H CRC
CtBP-binding sites in the TCF-4 molecule should lead to loss of
suppression. Both pTCF-4 and pTCF-4 A8 inhibited the activity built
up by p⌬45-␤-catenin in a comparable dose-dependent manner (Fig.
4C). Thus, mutations of the A9 monorepeat in exon 17 of the TCF-4
gene do not seem to influence the activity of ␤-catenin and may
therefore be only accompanying passenger mutations.
Fig. 2. H&E-stained histological sections of colorectal tumors displaying well (A–D)
or poorly differentiated growth patterns (E–G). Mutation state of the TCF-4 and ␤-catenin
genes is given. WT TCF-4 (TCF-4), heterozygous mutated TCF-4 (TCF-4 het), homozygous mutated TCF-4 (TCF-4 A8), WT ␤-catenin (␤-cat WT), and mutated ␤-catenin (␤-cat
Mut).
ever, no gross difference was observed between the different cell
lines, especially comparing Lovo cells (TCF-4 A8) and MSS cell lines
SW480 and HT29 (Fig. 3B) expressing WT TCF-4. Thus, mutations
in the A9 repeat of TCF-4 exon 17 do not effectively influence the
␤-catenin-mediated transactivation rate. Thirdly, it could be possible
that binding of TCF-4 to DNA is affected indirectly by mutations in
the A9 repeat, again because of effects on the structure of the whole
molecule. Therefore, we performed competition experiments by transiently cotransfecting TOP-FLASH reporter with plasmids expressing
dominant negative TCF-4 (dnTCF-4). Assuming a different affinity of
TCF-4 A8 for DNA, one would expect different dose-dependent
suppression behavior of cell lines with different TCF-4 forms (A9,
het, A8). But again, no gross difference was observed between Lovo,
LS174T, HCT116, or SW48 cells (Fig. 3C), and, thus, mutations in
the A9 repeat of TCF-4 do not strongly influence the ␤-catenin
transactivation system. Unfortunately, LS174T and Lovo, besides
their TCF-4 A8 mutation, have additional alterations in their ␤-catenin, APC, or other genes, respectively (Fig. 3C), so the effects of
TCF-4 mutations on the ␤-catenin system may be masked and are
hence not comparable. Thus, we finally constructed a mutated form of
TCF-4 (pTCF-4 A8) by in vitro mutagenesis, which carries an A8
instead of the A9 repeat (Fig. 4B). This expression plasmid was
transiently cotransfected with the reporter construct TOP-FLASH and
constitutively active ␤-catenin expression plasmid p⌬45-␤-catenin
into 293T cells. pTCF-4 was used in concentrations at which it had
suppressive effects (Fig. 3A), because it was expected that loss of both
Fig. 3. In A, luciferase activity of TOP-FLASH luciferase constructs in 293T cells is
dependent on the amount of TCF-4 present and can be suppressed specifically by the
addition of dn-TCF-4. B, luciferase activity of TOP-FLASH luciferase constructs in
comparison with FOP-FLASH (set to 1) of MSI and MSS colorectal cell lines. C,
luciferase activity of TOP-FLASH reporter constructs in MSI colorectal cell lines cotransfected with increasing amounts (90 or 135 ng) of pdnTCF-4 of DNA. The value for
TOP-FLASH without the addition of pdnTCF-4 (0 ng) was set to 1. Mutation state of the
TCF-4, ␤-catenin, and APC genes for the four MSI cell lines used. For an explanation of
TCF-4 nomenclature, see the legend to Fig. 2. For ␤-catenin and APC, the numbers given
indicate the codons affected by mutation.
3011
Downloaded from cancerres.aacrjournals.org on July 31, 2017. © 2002 American Association for Cancer Research.
TCF-4 MUTATIONS IN MSI-H CRC
Fig. 4. A, schematic diagram of the TCF-4 protein displaying its domains. ␤cat, binding
site for ␤-catenin; Grg/TLE, binding site for Grg/TLE; HMG; NLS, nuclear localization
signal. After mutation of the A9 stretch (A9) into an A8 repeat, the resulting protein is
truncated from 597 to 483 amino acids because of a frameshift STOP codon (A83 Stop).
B, sequence comparison of pTCF-4 encoding the WT A9 repeat and pTCF-4 A8 containing the A8 repeat. C, luciferase activity of TOP-FLASH reporter constructs in 293T cells
cotransfected with constant amounts of p⌬45-␤-catenin expression clone (90 ng) and
increasing amounts of pTCF-4 or pTCF-4 A8 (90, 135, and 180 ng). The TOP-FLASH
value without pTCF-4 or pTCF-4 A8 was set to 1.
Discussion
The collection used in this study is a homogeneous MSI-H group of
colorectal carcinomas and displays mutation rates for TCF-4 and
␤-catenin, as well as histological patterns that have been described
previously (6, 9, 18). Therefore, we consider our tumor collection to
be valid for deducing the function of TCF-4. The ambiguity of the
sequence data (Fig. 1, A and D) is probably attributable to the
structure of the PCR products, because sequences generated from
subcloned PCR products no longer show this ambiguity (data not
shown). Moreover, the sequence AAAAAAAACT is clearly readable
(Fig. 1, A and D), which stands in contrast with sequence data from
heterozygous PCR products (het). Sequences generated from PCR
products of heterozygous tumors show ambiguities throughout the
total sequence, whereas homozygous A8 stretch-based PCR products
show up again later, with clearly readable sequences. As a clear
distinction of the three combinations of the TCF-4 alleles was possible, despite some sequence ambiguity, this procedure was favored
because of the chance of higher throughput compared with subcloning. Firstly, we wanted to see whether mutations in the TCF-4 or
␤-catenin genes were connected with distinctive growth patterns, but
no correlation between the mutation status of TCF-4 or ␤-catenin and
growth pattern could be found. APC mutation screening was not
included, as we had no fresh material from these tumors, and sequencing of the complete APC gene or even the MCR from DNA isolated
from paraffin-embedded tissue is tedious work. However, it has been
described that mutations in the ␤-catenin and APC genes are found to
be mutually exclusive (10) and that APC mutations occur in ⬃60% of
MSI colorectal tumors (3). If APC mutations are involved in the
determination of growth patterns, then the amount of well-differentiated versus poorly differentiated tumors should be distributed in a
40:60 manner or vice versa. In our collection, the value was 21:25.
Although both the theoretical and our observed values are quite
similar, we do not believe that either TCF-4, ␤-catenin, or APC
mutations on their own, or in combination, contribute to the growth
pattern of CRC. Instead, we have data showing that the subcellular
distribution of ␤-catenin is highly correlated with different growth
patterns.5 Secondly, the overlapping mutation pattern of ␤-catenin
and TCF-4 mutations is inconsistent with the supposed mutual exclusivity of ␤-catenin and APC mutations (10). This exclusive behavior
of ␤-catenin and APC mutations supports yet another view, namely
that after mutating one element of the WNT signaling pathway, other
elements are excluded from further mutation. Otherwise, double mutations of ␤-catenin and APC should have been found, by chance
alone. Moreover, the coincidence of ␤-catenin or APC alterations on
the one hand and TCF-4 mutations on the other is also found in cell
lines. An additional challenge to the function of TCF-4 A8 mutation
in colorectal carcinogenesis is the observation that the majority of
TCF-4 mutations in our colorectal tumors are heterozygous. Of
course, it can be argued that the analysis of mutation in our collection
is misleading, as the microdissection still contained some nontumor
cells, feigning heterozygosity. Therefore, thirdly, transient transfections were performed in a variety of MSI and MSS CRC cell lines
(Fig. 3, A–C), using the TOP-FLASH/FOP-FLASH readout for
␤-catenin activity. Again, no marked differences between the cell
lines differing in their TCF-4 status were observed. Moreover, all
tested lines behaved similarly in that dnTCF-4 was able to suppress
the ␤-catenin built-up reaction in a comparable dose-dependent manner. Thus, the mutated TCF-4 A8 form found in the cell lines does not
seem to differ with respect to DNA-binding affinity. It may be that
cell type-specific alterations or features of the chosen MSI and MSS
colorectal cell lines make results using the TOP-FLASH system not
comparable. Thus, we finally devised an experimental system with
which we could analyze the effect of A8 mutations on the same
genetic background. An A8 repeat was generated by site-directed
mutagenesis in the expression plasmid pTCF-4 (Fig. 4C). The TCF-4
isoform encoded by pTCF-4 consists of exons 1–2-3–5-6 –7 (103
bp)-8 –9 (126 bp)-10⫺11-12–13-14 –17 (418 bp), numbering according to Duval et al. (8), with the A9 repeat at the beginning of exon 17,
which encodes both of the CtBP-binding sites (8). Again, no marked
difference was seen in the modulation of TOP-FLASH activity between TCF-4 and TCF-4 A8. In particular, this last experiment
strongly supports the idea that TCF-4 mutations occurring with high
frequency during carcinogenesis of CRC are only passenger mutations
(14) or are at least of only minor importance. Although we have
analyzed just one of the many described TCF-4 isoforms (8), we
suggest extending our results to all isoforms containing exon 17 as
part of their reading frame. Because the only known interacting
partner for the exon 17 corresponding COOH-terminal fragment of
TCF-4 is CtBP, loss of this domain should contribute comparable
effects. Besides, the interaction domain for proteins of the Grg family,
which is encoded roughly by exons 3–9 of TCF-4 and lies just
NH2-terminally adjacent to the HMG domain, seems to be very
5
Manuscript in preparation.
3012
Downloaded from cancerres.aacrjournals.org on July 31, 2017. © 2002 American Association for Cancer Research.
TCF-4 MUTATIONS IN MSI-H CRC
important for repression. Drosophila Grg has been shown to interact
with Osa-containing brahma chromatin-remodeling complexes, which
lead to repression of Wnt target genes. If armadillo (Drosophila’s
␤-catenin) joins pangolin (Drosophila’s TCF), it replaces Grg and,
thus, this repressive chromatin-remodeling complex (12). Moreover, it
has been shown that ␤-catenin interacts with a mammalian Brg-1
chromatin-remodeling complex (brahma homologue), which confers
transcriptional activity (19). Thus, the role of ␤-catenin/TCF-4 complexes may be the organization of chromatin, giving other genespecific transcription factors the capability to transactivate gene expression. This would explain the low transcriptional activation
mediated by ␤-catenin/TCF-4 and the many ␤-catenin target genes
that have been described up to now. It would now be interesting to
screen for TCF-4 mutations in human colorectal tumors in the range
of exons 3–9 and check if mutations interfere with binding to Grg
family proteins. Such mutations are expected to confer gain of function character, and in this sense, TCF-4 would be an oncogene. But the
situation becomes more complex for several reasons: (a) all members
of the Grg family bind to the members of the TCF/LEF family with
different affinity, and Grg and TCF/LEF members are expressed in
different cell lines in different combinations (20); (b) LEF-1 is expressed in colorectal tumors but not in normal colonic tissue (21);
whether LEF-1- and TCF-4-induced transcriptomes are identical is
not clear, especially in the light of data showing that different HMG
proteins make specific DNA contacts besides the central WWCAAAG sequence via factor-specific flanking regions (22); and (c)
TCF-4 is expressed in many isoforms in colorectal tumor cells (8).
Altogether, this increase in combinatorial possibilities may make it
difficult to elucidate the role of TCF/LEF factors for colorectal
carcinogenesis.
Acknowledgments
We thank Bert Vogelstein for the generous gift of expression clones
pcDNA-myc-TCF-4 (pTCF-4), pcDNA-myc-dnTCF-4 (pdnTCF-4), and pcI⌬45-␤-catenin (p⌬45-␤-catenin) and Hans Clevers for the luciferase reporter
constructs TOP-FLASH and FOP-FLASH. We also thank Richard Hamelin for
sharing invaluable sequence information of TCF-4 exon 17 before publishing.
We thank Katja Bräutigam for expert technical assistance, Kerstin Amann for
providing her digital photo-equipment, and Stephen Köver for critical reading
and discussion.
References
1. Bienz, M., and Clevers, H. Linking colorectal cancer to Wnt signaling. Cell, 103:
311–320, 2000.
2. Jass, J. R. Towards a molecular classification of colorectal cancer. Int. J. Colorectal
Dis., 14: 194 –200, 1999.
3. Huang, J., Papadopoulos, N., McKinley, A. J., Farrington, S. M., Curtis, L. J., Wyllie,
A. H., Zheng, S., Willson, J. K., Markowitz, S. D., Morin, P., Kinzler, K. W.,
Vogelstein, B., and Dunlop, M. G. APC mutations in colorectal tumors with mismatch
repair deficiency. Proc. Natl. Acad. Sci. USA, 93: 9049 –9054, 1996.
4. Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R., and Moon, R. T. The Wnt/Ca2⫹
pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet., 16:
279 –283, 2000.
5. Kinzler, K. W., and Vogelstein, B. Lessons from hereditary colorectal cancer. Cell,
87: 159 –170, 1996.
6. Polakis, P. Wnt signaling and cancer. Genes Dev., 14: 1837–1851, 2000.
7. Liu, W., Dong, X., Mai, M., Seelan, R. S., Taniguchi, K., Krishnadath, K. K., Halling,
K. C., Cunningham, J. M., Qian, C., Christensen, E., Roche, P. C., Smith, D. I., and
Thibodeau, S. N. Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating ␤-catenin/TCF signaling. Nat. Genet., 26: 146 –147, 2000.
8. Duval, A., Rolland, S., Tubacher, E., Bui, H., Thomas, G., and Hamelin, R. The
human T-cell transcription factor-4 gene: structure, extensive characterization of
alternative splicings, and mutational analysis in colorectal cancer cell lines. Cancer
Res., 60: 3872–3879, 2000.
9. Duval, A., Gayet, J., Zhou, X. P., Iacopetta, B., Thomas, G., and Hamelin, R.
Frequent frameshift mutations of the TCF-4 gene in colorectal cancers with microsatellite instability. Cancer Res., 59: 4213– 4215, 1999.
10. Sparks, A. B., Morin, P. J., Vogelstein, B., and Kinzler, K. W. Mutational analysis of
the APC/␤-catenin/Tcf pathway in colorectal cancer. Cancer Res., 58: 1130 –1134,
1998.
11. Roose, J., and Clevers, H. TCF transcription factors: molecular switches in carcinogenesis. Biochim. Biophys. Acta, 1424: M23–M37, 1999.
12. Collins, R. T., and Treisman, J. E. Osa-containing Brahma chromatin remodeling
complexes are required for the repression of wingless target genes. Genes Dev., 14:
3140 –3152, 2000.
13. Eastman, Q., and Grosschedl, R. Regulation of LEF-1/TCF transcription factors by
Wnt and other signals. Curr. Opin. Cell Biol., 11: 233–240, 1999.
14. Zhang, L., Yu, J., Willson, J. K., Markowitz, S. D., Kinzler, K. W., and Vogelstein,
B. Short mononucleotide repeat sequence variability in mismatch repair-deficient
cancers. Cancer Res., 61: 3801–3805, 2001.
15. Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P. J., and
Clevers, H. Depletion of epithelial stem-cell compartments in the small intestine of
mice lacking Tcf-4. Nat. Genet., 19: 379 –383, 1998.
16. Dietmaier, W., Wallinger, S., Bocker, T., Kullmann, F., Fishel, R., and Ruschoff, J.
Diagnostic microsatellite instability: definition and correlation with mismatch repair
protein expression. Cancer Res., 57: 4749 – 4756, 1997.
17. Brownstein, M. J., Carpten, J. D., and Smith, J. R. Modulation of non-templated
nucleotide addition by Taq DNA polymerase: primer modifications that facilitate
genotyping. Biotechniques, 20: 1004 –1006, 1008 –1010, 1996.
18. Ruschoff, J., Dietmaier, W., Luttges, J., Seitz, G., Bocker, T., Zirngibl, H., Schlegel,
J., Schackert, H. K., Jauch, K. W., and Hofstaedter, F. Poorly differentiated colonic
adenocarcinoma, medullary type: clinical, phenotypic, and molecular characteristics.
Am. J. Pathol., 150: 1815–1825, 1997.
19. Barker, N., Hurlstone, A., Musisi, H., Miles, A., Bienz, M., and Clevers, H. The
chromatin remodeling factor Brg-1 interacts with ␤-catenin to promote target gene
activation. EMBO J., 20: 4935– 4943, 2001.
20. Brantjes, H., Roose, J., van De Wetering, M., and Clevers, H. All Tcf HMG box
transcription factors interact with Groucho-related co-repressors. Nucleic Acids Res.,
29: 1410 –1419, 2001.
21. Hovanes, K., Li, T. W., Munguia, J. E., Truong, T., Milovanovic, T., Lawrence
Marsh, J., Holcombe, R. F., and Waterman, M. L. ␤-catenin-sensitive isoforms of
lymphoid enhancer factor-1 are selectively expressed in colon cancer. Nat. Genet., 28:
53–57, 2001.
22. van Beest, M., Dooijes, D., van De Wetering, M., Kjaerulff, S., Bonvin, A., Nielsen,
O., and Clevers, H. Sequence-specific high mobility group box factors recognize
10 –12-base pair minor groove motifs. J. Biol. Chem., 275: 27266 –27273, 2000.
3013
Downloaded from cancerres.aacrjournals.org on July 31, 2017. © 2002 American Association for Cancer Research.
T-cell Factor-4 Frameshift Mutations Occur Frequently in
Human Microsatellite Instability-high Colorectal Carcinomas
but Do Not Contribute to Carcinogenesis
Stefan Ruckert, Elke Hiendlmeyer, Wolfgang M. Brueckl, et al.
Cancer Res 2002;62:3009-3013.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/62/11/3009
This article cites 22 articles, 10 of which you can access for free at:
http://cancerres.aacrjournals.org/content/62/11/3009.full#ref-list-1
This article has been cited by 2 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/62/11/3009.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on July 31, 2017. © 2002 American Association for Cancer Research.