RESEARCH LETTER
Physiological signi¢cance of the peptidoglycan hydrolase, LytM, in
Staphylococcus aureus
Vineet K. Singh1, Mary R. Carlos2 & Kuldeep Singh1
1
Microbiology and Immunology, Kirksville College of Osteopathic Medicine (KCOM), A.T. Still University of Health Sciences, Kirksville, MO, USA; and
Arizona School of Dentistry and Oral Health (ASDOH), A.T. Still University of Health Sciences, Mesa, AZ, USA
2
Correspondence: Vineet K. Singh,
Microbiology and Immunology, Kirksville
College of Osteopathic Medicine (KCOM),
A.T. Still University of Health Sciences,
Kirksville, MO 63501, USA. Tel.: 11 660 626
2455; fax: 11 660 626 2523;
e-mail: [email protected]
Received 24 May 2010; revised 28 July 2010;
accepted 29 July 2010.
Final version published online 25 August 2010.
DOI:10.1111/j.1574-6968.2010.02087.x
Editor: Ross Fitzgerald
MICROBIOLOGY LETTERS
Keywords
Staphylococcus; peptidoglycan hydrolases;
autolysin; LytM.
Abstract
Autolysins in bacteria are peptidoglycan hydrolases with roles in growth, turnover
and cell lysis. LytM was identified as the only autolysin in a previously reported
autolysis-deficient (lyt) strain of Staphylococcus aureus. Purified LytM has been
studied in great detail for its lytic properties and its production is elevated in
vancomycin-resistant S. aureus. However, the postulated roles of LytM in S. aureus are
largely speculative. Studies utilizing a reporter strain where the lytM promoter was
cloned in front of a promoterless lacZ gene and fused in S. aureus strain SH1000
suggest that the expression of lytM is the highest during the early exponential phase.
Additionally, lytM expression was downregulated in agr mutants. The expression of
lytM was not affected by the presence of cell wall inhibitors in the growth medium. To
further determine the significance of LytM in staphylococcal autolysis, the gene
encoding LytM was deleted by site-directed mutagenesis. The deletion of lytM,
however, did not alter the rate of staphylococcal cell autolysis. Surprisingly, when the
lytM mutation was combined with the lyt mutant, the lytic activity band of the
lyt strain was still apparent in the lytM:lyt double mutant. Purified full-length Histagged LytM did not demonstrate any lytic activity against S. aureus cells. Surprisingly, cultures of S. aureus lytM deletion mutant lysed at a significantly faster rate
compared with the wild-type S. aureus in the presence of oxacillin. The findings of
this study raise questions about LytM as an autolysin and the significance of this
protein should thus be investigated beyond its role as an autolysin.
Introduction
Staphylococcus aureus is an aggressive pathogen that is
responsible for a wide array of diseases ranging from
pyogenic skin infections and food poisoning to complicated
life-threatening diseases such as bacteremia and endocarditis (Plata et al., 2009). The emergence of multidrug resistance in S. aureus is generating enormous public health
concern and an urgent need for alternative therapeutic
targets for infections caused by this bacterium.
Peptidoglycan hydrolases are enzymes that hydrolyze the
peptidoglycan of the bacterial cell wall. These enzymes in
S. aureus include N-acetyl muramidase, N-acetyl glucosaminidase, N-acetylmuramyl-L-alanine amidase and endopeptidase (Ramadurai et al., 1999; Ingavale et al., 2003).
Cellular levels and activities of autolysins are believed to be
intricately regulated and these enzymes are proposed to play
FEMS Microbiol Lett 311 (2010) 167–175
key roles in bacterial cell wall metabolism, daughter-cell
separation, antibiotic-mediated cell lysis and pathogenicity
(Ramadurai et al., 1999; Ingavale et al., 2003).
LytM was identified and proposed to be the only autolysin present in a previously reported autolysis-defective lyt
mutant strain of S. aureus (Mani et al., 1993; Ramadurai &
Jayaswal, 1997). LytM is suggested to be a lysostaphin-type
peptidase that is found mostly in bacteria and bacteriophages and are believed to be glycyl–glycine endopeptidases
(Ramadurai & Jayaswal, 1997; Sugai et al., 1997; Bochtler
et al., 2004). Glycyl–glycine peptide bonds are involved in
cross-linking peptidoglycan in many Staphylococcus species
including S. aureus (Schleifer & Kandler, 1972). These
lysostaphin-type peptidases have similar active sites and
share a core folding motif, but they have highly divergent
folds (Bochtler et al., 2004). The presence of endopeptidases
in gram-positive bacteria such as Bacillus subtilis and many
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
168
V.K. Singh et al.
Table 1. Bacterial strains and plasmids used in this study
Strains or plasmids
Bacteria
S. aureus RN4220
S. aureus 8325-4
S. aureus SH1000
lyt
VKS1005
VKS1006
VKS1007
VKS1008
SH1000lytP-lacZ
SH1000agr:lytP-lacZ
E. coli JM109
E. coli BL21(DE3)pLysS
Plasmids
pGEMT
pTZ18R
pCU1
pAZ106
pRSETA
pTZ18R–lytM
pTZ–lytM–tetM
pCU1–lytM
pRSETA–lytM
Characteristics
Reference
A restriction minus derivative of S. aureus strain 8325-4
A laboratory strain of S. aureus cured of all the prophages
S. aureus strain 8325-4 with functional RsbU
An autolysis-deficient mutant strain of S. aureus which produces only a single band in
autolytic-activity gels (ErmR)
S. aureus strain SH1000 with mutation in the lytM gene (TetR)
S. aureus strain 8325-4 with mutation in the lytM gene (TetR)
S. aureus lyt strain with mutation in lytM gene (ErmR, TetR)
VKS1006 complemented with 2.2 kb lytM gene under its promoter (KanR, CamR)
lytM promoter–lacZ reporter fused in the chromosome of S. aureus SH1000 (ErmR)
lytM promoter–lacZ reporter fused in the chromosome of S. aureus agr mutant of strain
SH1000 (ErmR, TetR)
recA1 supE44 endA1 hsdr17 gyra96 relA1I thiD(lac-proAB) F 0 (traD36 proAB1 lacIqDM15)
F–, ompT, hsdSB (rB–,mB–), dcm, gal, l(DE3), pLysS (CamR)
Kreiswirth et al. (1983)
Novick (1991)
Horsburgh et al. (2002)
Mani et al. (1993)
Cloning vector for E. coli (AmpR)
Cloning vector for E. coli (AmpR)
Shuttle vector (AmpR in E. coli and CamR in S. aureus)
Plasmid with a promoterless lacZ
An E. coli overexpression plasmid
Plasmid pTZ18R containing left and right flanking regions of the S. aureus lytM gene.
A 2.2 kb tetracycline resistance gene was used to replace the BamHI fragment of construct
pTZ18R–lytM.
Plasmid pCU1 containing 2.2 kb fragment representing the S. aureus lytM promoter and
coding region
Plasmid pRSETA containing the S. aureus lytM coding region
Promega
Mead et al. (1986)
Augustin et al. (1992)
Chan et al. (1998)
Invitrogen
This study
This study
This study
This study
This study
This study
This study
This study
Yanisch-Perron et al. (1985)
(Promega)
This study
This study
TetR, tetracyclin resistant; CamR, chloramphenicol resistant; ErmR, erythromycin resistant; AmpR, ampicillin resistant.
gram-negative bacteria that lack glycyl–glycine peptidoglycan cross links suggests additional roles for these enzymes
beyond peptidoglycan hydrolases (Bochtler et al., 2004).
LytM has been studied extensively for its lytic properties
in recent years. The protein has been crystallized and its
active site domains have been mapped (Odintsov et al.,
2004; Firczuk et al., 2005). In addition, LytM production has
been shown to be elevated in vancomycin-resistant S. aureus
(Pieper et al., 2006; Renzoni et al., 2006).
In this study, the expression pattern of lytM during stages of
bacterial growth and the significance of LytM as an autolysin
were investigated. LytM was determined to be an early
exponential-phase protein and the expression of lytM was
determined to be downregulated by Agr. This study, however,
raises questions about the physiological role of this protein as
an autolysin and suggests that the significance of this protein
should be investigated beyond its role as an autolysin.
Escherichia coli cells were routinely grown aerobically at
37 1C in tryptic soy broth/agar (TSB; Beckton Dickinson)
and Luria–Bertani broth/agar (LB; Fisher), respectively.
Broth cultures were grown in a shaking incubator
(220 r.p.m.) unless stated otherwise. When needed, ampicillin (50 mg mL1), tetracycline (10 mg mL1), erythromycin
(10 mg mL1) and chloramphenicol (10 mg mL1) were
added to the bacterial growth medium.
DNA isolation and manipulations
Materials and methods
Plasmid DNA was isolated using the Qiaprep kit (Qiagen
Inc.); chromosomal DNA was isolated using the DNAzol kit
(Molecular Research Center) from lysostaphin (Sigma)treated S. aureus cells as per the manufacturer’s instructions.
All restriction and modification enzymes were purchased
from Promega. DNA manipulations were carried out using
standard procedures. PCR was performed using the PTC200 Peltier Thermal Cycler (MJ Research). Oligonucleotide
primers (Table 2) were obtained from Sigma Genosys.
Bacterial strains, plasmids and growth conditions
Generation of a lytM mutant
The bacterial strains and plasmid constructs used in this
study are shown in Table 1. Staphylococcus aureus and
For this study, the lytM nucleotide sequence was obtained
from the http://www.ncbi.nlm.nih.gov/sites/entrez?db=gen
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
FEMS Microbiol Lett 311 (2010) 167–175
169
Staphylococcal LytM
Table 2. Primers used in this study
P1
P2
P3
P4
P5
P6
P7
P8
P9
P10
GAATTCCGCCATTGCATTATC
GGATCCCCATTAGAATCAATTG
GGATCCAACGTATGTCTGGTGGC
AAGCTTGCTATGGGTATCGTATAC
GGATCCGCCATTGCATTATC
AAGCTTTGATGATACGTCTGCC
TCTAGAAATTATCGTTGGAAATC
GAATTCATGTATAAAACATCCTCC
GGATCCATGGAGGATGTTTTATACATG
AAGCTTGGGATTTTCTGTATTATC
Growth kinetic measurements
Mid-exponential-phase cultures (OD600 nm = 0.6) were diluted 50-fold in a nephelo culture flask (Wheaton) containing 50 mL fresh TSB with a flask-to-medium volume ratio of
6 : 1 and growth was followed by measurement of OD600 nm
spectrophotometrically. In another experiment, cultures
pregrown to an OD600 nm = 0.5 were added with oxacillin at
a final concentration of 15 mg mL1 and subsequent growth
was measured spectrophotometrically.
Restriction sites (underlined) were added to facilitate cloning.
ome&cmd=Retrieve&dopt=Overview&list_uids=610 database, which suggests an additional 18 nucleotides at the 5 0 end to be part of the lytM gene compared with what has
been suggested by others (Ramadurai & Jayaswal, 1997;
Ramadurai et al., 1999). To create a lytM deletion mutant, a
set of two primers, P1 and P2, was used to amplify a 1083-bp
DNA fragment using genomic DNA extracted from S. aureus
strain SH1000 as a template. This amplicon represented
192 nt of the 5 0 -end and additional DNA upstream of the
lytM gene. Primers P3 and P4 were used to amplify an 834bp DNA fragment that represented 68 nt of the 3 0 -end
of the lytM gene and an additional downstream region.
These two fragments were cloned individually into plasmid
pGEMT (Promega) and subsequently ligated together in
plasmid pTZ18R (Mead et al., 1986) resulting in the
construct pTZ–lytM that simultaneously generated a unique
BamH1 restriction site between the ligated fragments. A
2.2 kb tetracycline resistance cassette was subsequently inserted at this BamH1 site, yielding the pTZ–lytM–tetM
construct, which was used as a suicidal construct to transform S. aureus RN4220 cells by electroporation (Schenk &
Laddaga, 1992). Selection of the transformants on tetracycline plates led to the integration of the entire construct into
the chromosome. Phage 80a was propagated on these
transformants and used to resolve the mutation in the lytM
gene in the S. aureus strains by performing transductional
outcrosses as described (Singh et al., 2001b, 2007, 2008).
Mutation in the lytM gene was subsequently transduced into
the S. aureus lyt strain (Mani et al., 1993; Ramadurai &
Jayaswal, 1997) to potentially create an autolysin-free
lyt:lytM double mutant.
For genetic complementation of the lytM mutant, an
approximately 2.2-kb DNA fragment was PCR amplified
using primers P5 and P6 and S. aureus SH1000 genomic
DNA as template. This amplicon represents a fragment
starting 890 nt upstream and ending 364 nt downstream of
the lytM gene that was cloned into the BamHI and HindIII
sites of shuttle plasmid pCU1 (Augustin et al., 1992) and
subsequently transferred to a lytM mutant of S. aureus
SH1000.
FEMS Microbiol Lett 311 (2010) 167–175
Construction of the lytM promoter::lacZ
reporter strain
Primers P7 and P8 were used to amplify a 1223-bp DNA
fragment using genomic DNA from S. aureus SH1000 as a
template. This amplicon represents the upstream and 23 nt
of the 5 0 -end of the lytM gene. The amplicon was cloned in
the correct orientation upstream of a promoterless lacZ gene
of vector pAZ106 (Chan et al., 1998) and was introduced
into the chromosome of S. aureus RN4220 by electroporation with selection on erythromycin. Phage 80a lysate of the
resulting transformant was used to transduce the lytM
promoter:lacZ fusion into strain S. aureus SH1000 and its
derivative agr mutant (Shenkman et al., 2001). A single copy
insertion of the fusion in the chromosome was confirmed by
Southern blot analysis. The activity of b-galactosidase in the
reporter strain was assayed using O-nitrophenyl-b-Dgalactopyranoside as the substrate as described previously
(Singh et al., 2001a, b).
Overexpression and purification of recombinant
His6--LytM fusion protein
The lytM ORF was PCR amplified using the primer pairs P9
and P10 and S. aureus SH1000 genomic DNA as the
template. The amplified lytM gene was cloned in frame at
the BamHI and HindIII sites of the overexpression vector
pRSETa (Invitrogen) to produce pRSETa–lytM, which was
then transferred into E. coli BLR(DE3)pLysS (Novagen). The
resulting transformants were grown in LB containing ampicillin (50 mg mL1), chloramphenicol (30 mg mL1) and tetracycline (12 mg mL1) to an OD600 nm of 0.4 and induced
for the synthesis of His-tagged LytM by the addition of
2.5 mM of isopropyl-b-thiogalactopyranoside (IPTG) for
2.5 h. The induced culture was harvested and resuspended
in 50 mM Tris-HCl buffer (pH 7.5), sonicated and centrifuged. The supernatant fluid was applied to a nickel-charged
agarose affinity column and eluted with 400 mM imidazole
using the Xpress Purification system (Invitrogen). Fractions
containing the overexpressed His-tagged LytM were pooled,
dialyzed and concentrated against 50 mM potassium phosphate buffer, pH 7.2.
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
170
Autolysis assays were performed as described previously
(Singh et al., 2008). Briefly, wild-type and the lytM mutant
cultures of S. aureus were grown to an OD600 nm of 0.7 at
37 1C in PYK medium (0.5% Bacto peptone, 0.5% yeast
extract, 0.3% K2HPO4, pH 7.2). After one wash with cold
water (8500 g, 4 1C, 15 min), cells were suspended in 0.05 M
Tris-HCl buffer, pH 7.2, containing 0.05% Triton X-100 to
an OD600 nm of 1.0. Cell suspension was incubated in flasks
at 37 1C with shaking (125 r.p.m.) and autolysis was determined by measuring decline in the turbidity spectrophotometrically at 600 nm every 30 min. Autolysis was also
analyzed using a zymographic procedure as described previously (Singh et al., 2008). The total autolysins were
extracted after bead beating bacterial cells in 0.25 M phosphate buffer (pH 7.2) using a BioSpec Mini-Beadbeater after
growth in PYK to an OD600 nm = 0.7. Purified His6–LytM,
extracts from E. coli cells overexpressing His6–LytM and an
S. aureus bead-beated cell-free extract was analyzed for the
presence of autolysins in a zymographic method using
autoclaved S. aureus 8325-4 cells as described previously
(Singh et al., 2008).
Results
Construction of an S. aureus lytM mutant strain
To construct a mutation, lytM upstream and downstream
flanking regions were PCR amplified and sandwiched with a
tetracycline resistance cassette in plasmid pTZ18R. This
construct was used to replace the wild-type lytM gene in
the S. aureus chromosome by double homologous recombination. This mutant represents a deletion of 706 nt of the
966 nt lytM gene. In PCR assays, primers P9 and P10
amplified an 1.0 kb lytM region when the genomic DNA
from the wild-type S. aureus was used as the template
(Fig. 1, lane 1) as compared with an 2.5 kb amplicon when
genomic DNA from the lytM mutant strain was used as a
template (Fig. 1, lane 2). The mutation in the lytM gene was
also confirmed by Southern blot analysis (data not shown).
bp
M
The deletion of LytM was investigated for any impact on the
growth of S. aureus in TSB or in modified TSB to impose
stresses such as acidic stress (pH 5.5), alkaline stress (pH
9.0) or salt stress (TSB added with additional 1.5 M NaCl).
No growth defect was observed whether the lytM mutants
used were in S. aureus strain SH1000 or 8325-4 (data not
shown). Surprisingly, the presence of oxacillin led to increased lysis of mid-log-phase lytM mutant cells compared
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
2
3000
2000
1500
1000
500
Fig. 1. Construction and confirmation of mutation in the lytM gene in
Staphylococcus aureus. The primers P9 and P10 amplified 1.0 kb lytM
region with genomic DNA from the wild-type (lane 1) and 2.5-kb
fragment with genomic DNA from the lytM mutant strain (lane 2). The
larger amplicon in the mutant confirms replacement of the majority of
the lytM coding region (706 of the 966 nt lytM gene) with a 2.2 kb
tetracycline resistance cassette. Lane M, DNA ladder.
0.8
0.6
0.4
8325-4
8325-4:lytM
0.2
Complemented strain
0
0
Deletion of LytM leads to induced lysis of
staphylococcal cells in the presence of oxacillin
1
5000
OD600nm
Whole-cell autolysis assays and zymographic
detection of autolytic activity in S. aureus cells
V.K. Singh et al.
60
120
180
240
300
Time (min)
Fig. 2. Growth of the lytM mutant in the presence of oxacillin. The wildtype Staphylococcus aureus strain 8325-4, its derivative lytM mutant and
complemented strain cultures were pregrown to OD600 nm = 0.5 and
were exposed to oxacillin at 15 mg mL1. Values indicate the average of
two independent experiments.
with a culture of wild-type S. aureus 8325-4 cells under
identical conditions (Fig. 2). To verify whether it was indeed
the lack of a functional LytM that is responsible for
oxacillin-induced lysis, the mutant was complemented with
FEMS Microbiol Lett 311 (2010) 167–175
171
Staphylococcal LytM
the lytM gene under its own promoter in trans on plasmid
pCU1. As evident in Fig. 2, the level of resistance to
oxacillin-induced lysis was restored in the complemented
strain.
Expression of lytM
Expression of lytM was monitored using the lytM promoter–lacZ fusion in S. aureus SH1000. An overnight culture of
the reporter strain was diluted (1 : 100) in a 300-mL flask
containing 40 mL of fresh TSB and incubated with shaking
at 37 1C. The bacterial cells were harvested at 120, 210, 300,
440 and 560 min and the level of b-galactosidase activity was
determined. The level of b-galactosidase was reflective of the
lytM promoter activity. The highest lytM expression was
determined in cells from the early to the mid-exponential
phase and this activity declined during the late-exponential
phase and was the lowest during the stationary phase of
growth (Fig. 3a). A higher expression of lytM was also
observed in S. aureus cells from the early- to the midexponential phase of growth in a real-time reverse transcriptase-PCR assay (data not shown). This observation is
consistent with a previous report showing increased lytM
transcript levels in early-exponential-phase S. aureus cells
(Ramadurai & Jayaswal, 1997). It was also reported by
Ramadurai et al. (1999) that the transcription of lytM was
suppressed in the agr mutant cells of S. aureus. In this study
also, we observed a noticeable decrease in the expression of
lytM in an agr mutant of S. aureus SH1000 compared with
the wild-type SH1000 (Fig. 3b). The lytM gene, however,
was not identified as a gene regulated by Agr in transcriptional profiling studies that compared the gene expression in
the agr mutant relative to their wild-type parent (Dunman
et al., 2001; Cassat et al., 2006). It is possible that in these
studies, the level of lytM regulation was below the cut-off set
for the Agr-regulated genes.
Considering the role of LytM as a peptidoglycan hydrolase and its abundance in cells resistant to vancomycin
(Mongodin et al., 2003; Pieper et al., 2006), lytM expression
FEMS Microbiol Lett 311 (2010) 167–175
Autolysis of lytM mutant cells
The autolysis subsequent to mutation in the lytM gene in
S. aureus was initially investigated in strain SH1000. However, no difference in the autolysis of the lytM mutant cells of
S. aureus strain SH1000 was observed compared with the
autolysis of the wild-type SH1000. We consistently observed
a slower rate of autolysis of the SH1000 cells compared with
S. aureus 8325-4 cells. To observe whether there was any
impact of LytM deletion on S. aureus autolysis, the lytM
mutation was transferred to the S. aureus strain 8325-4 and
the lyt transposon mutant of strain 8325-4. There was no
appreciable difference in the autolysis of the lytM mutant
cells of strain 8325-4 relative to wild-type 8325-4 (Fig. 4).
Additionally, no autolysis was observed in the case of the lyt
and lyt:lytM double mutant during the course of the
experiment (5 h) when autolysis was measured periodically
(Fig. 4). The turbidity of the lyt and lyt:lytM cell suspension remained unchanged even after 24 h (data not shown).
(a)
(b)
120
SH1000Δagr
SH1000
8.0
7.0
100
6.0
80
5.0
4.0
60
3.0
40
OD600 nm
β-Galactosidase activity unit
Fig. 3. Expression of lytM in Staphylococcus
aureus strain SH1000 and its derivative agr
mutant. The lytM promoter was cloned in front of
a promoterless lacZ gene in plasmid pAZ106 and
the resulting construct was integrated into the
chromosome of the S. aureus strain SH1000 (a)
and its derivative agr mutant (b). These two
reporter strains were cultured in TSB and bgalactosidase activity was determined at different
time points during growth. OD600 nm is indicated
by closed triangles and the corresponding
b-galactosidase activity is indicated by closed
circles. Values indicate the average of three
independent experiments SE.
was also determined in cells stressed with various cell wall
inhibitors. The cells were allowed to grow to a density of 0.6,
and at this point, the cell wall inhibitors were added at final
concentrations of 5 mg mL1. The cells were allowed to grow
for 60 min with these antibiotics and the level of b-galactosidase was subsequently determined. There was no real
growth inhibition in cultures growing in the presence of
vancomycin and bacitracin in 60 min, but with the other
antibiotics, there was about 20–30% growth inhibition
relative to the lytM reporter culture without the addition of
any antibiotic. There was no appreciable change, however, in
the level of b-galactosidase in these antibiotic stressed cells,
suggesting that the expression of lytM is not affected when S.
aureus cells are challenged with cell wall-active antibiotics
(data not shown). This observation is consistent with the
previous report that did not identify lytM as a gene with an
altered expression in S. aureus cells challenged with cell wallactive antibiotics (Utaida et al., 2003).
2.0
20
1.0
0.0
0
120
210
300
440
560
120
Time (min)
210
300
440
560
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
172
V.K. Singh et al.
120.00
175 kDa
% Decrease in turbidity
100.00
1
2
3
4
83 kDa
80.00
62 kDa
60.00
47.5 kDa
40.00
8325-4
lyt−
8325-4:lytM
lyt−:lytM
20.00
32.5 kDa
0.00
0
30
60
90 120 150
Time (min)
240
270
300
Fig. 4. Triton X-100 induced autolysis of wild-type Staphylococcus
aureus strain 8325-4 and its derivative lytM mutant cells. Values indicate
the average of two independent experiments.
25 kDa
16.5 kDa
Zymographic profiling of autolysins in the
lytM mutant
In zymographic investigations, several lytic-activity bands
were seen in samples from the wild-type S. aureus strain
8325-4 (Fig. 5, lane 1). The pattern of autolytic bands was
almost identical in samples from the lytM mutant of S.
aureus strain 8325-4 (Fig. 5, lane 3). In these experiments,
the S. aureus lyt:lytM double mutant was expected to be
autolysin free based on the previous report that suggested
the LytM protein to be responsible for the residual autolytic
activity in the lyt S. aureus (Ramadurai & Jayaswal, 1997).
Surprisingly, in the zymographic investigations, the pronounced 36 kDa lytic activity band in lyt S. aureus (Fig. 5,
lane 2), postulated to be due to LytM, was present in the
lyt:lytM double mutant (Fig. 5, lane 4). This observation
suggests that LytM is not responsible for the residual activity
of the lyt strain of S. aureus.
Purified LytM and autolytic activity
To address the presence of the 36 kDa lytic activity band in
the lyt:lytM double mutant, the lytM gene was cloned in
vector pRSETA and overexpressed in E. coli. The protein
band that appeared to be induced after the addition of IPTG
was a 36 kDa protein (Fig. 6a, arrow comparing lanes 2 and
3). The size expected for the full-length His-tagged LytM
was 40 kDa. The protein that was repeatedly purified following metal chromatography was also 40 kDa in size (Fig. 6a,
lane 1). It has been reported that the LytM signal peptide
undergoes cleavage even in E. coli cells (Ramadurai &
Jayaswal, 1997; Odintsov et al., 2004). This leads to the loss
of the signal peptide and the approximately 4 kDa His-tag
present on the N-terminus of the recombinant His-tagged
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
Fig. 5. Zymographic analysis of the autolysins in total cellular extracts
from wild-type and lytM mutant Staphylococcus aureus cells. Samples
were analyzed in 15% sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) gels impregnated with autoclaved S. aureus
8325-4 cells. Lytic activity was detected by incubation of the gel with
gentle agitation at 37 1C in renaturing buffer (25 mM Tris-HCl, pH 7.5
containing 0.5% Triton X-100). Lane 1, wild-type S. aureus strain 83254; lane 2, lyt mutant of S. aureus strain 8325-4; lane 3, lytM mutant of
S. aureus strain 8325-4; lane 4, lyt:lytM mutant of S. aureus strain
8325-4. Equivalent amounts of protein samples were loaded.
LytM. It is speculated that the majority of the overexpressed
LytM undergoes cleavage of the signal peptide and only a
small fraction of LytM remains intact with the His-tag,
which could be purified. In zymographic experiments,
Ramadurai & Jayaswal (1997) reported three autolysin
bands of 36, 22 and 19 kDa in extracts of E. coli cells that
overproduced LytM and proposed that the lower lyticactivity bands were LytM-degraded products. However, in
our zymographic experiments, no autolytic band was visualized even after prolonged incubation of the zymographic
gel in the lane corresponding to purified His-tagged LytM
(Fig. 6b, lane 4). There were smaller autolytic activity bands
between 14 and 19 kDa in the lanes corresponding to the
whole-cell extract of the E. coli cells expressing His-tagged
LytM (Fig. 6b, lane 3), but a 36 kDa lytic activity band was
not visualized. The 14 kDa protein band that was apparent
in E. coli cells that contained only plasmid pRSETA (Fig. 6b,
lane 2) may be attributed to the high-level expression of T7
lysozyme in BL21(DE3)pLysS cells.
FEMS Microbiol Lett 311 (2010) 167–175
173
Staphylococcal LytM
(a)
kDa
Fig. 6. (a) Purification of LytM. LytM was
overexpressed by the addition of IPTG in culture
of Escherichia coli BL21(DE3)pLysS cells with
plasmid pRSETA–lytM and analyzed in 15%
SDS-PAGE. Lane 1, LytM purified through nickel
column chromatography. Lanes 2 and 3, total cell
extract of E. coli cells grown with and without
IPTG. Lane M, protein marker. (b) Analysis of LytM
lytic activity. LytM samples were analyzed in 15%
SDS-PAGE gels impregnated with autoclaved
Staphylococcus aureus 8325-4 cells and lytic
activity was detected after incubating the gel in
renaturation buffer. Lane 1, total cellular extract
from the lyt S. aureus strain; lanes 2 and 3, total
extract of E. coli cells with plasmid pRSETA or
plasmid pRSETA–lytM, respectively, grown
with IPTG. Lane 4, LytM purified through nickel
column chromatography.
(b)
M
2
3
kDa
116
116
66.2
66.2
45
45
35
35
25
25
18.4
18.4
14.4
14.4
Discussion
LytM was originally identified and proposed to be responsible for the residual autolytic activity in an autolysisdefective lyt mutant strain of S. aureus (Ramadurai &
Jayaswal, 1997). It has subsequently been shown that the
expression of lytM is negatively regulated by RAT, a regulator of autolysis of the S. aureus cells (Ingavale et al., 2003).
In proteomic and transcriptomic analysis, the level of LytM
has been shown to be elevated two- to threefold in derivative
S. aureus strains with increased vancomycin resistance
compared with its level in the parent S. aureus strain with a
lower level of vancomycin resistance (Mongodin et al., 2003;
Pieper et al., 2006). It has also been shown by electrophoretic
mobility shift and DNase protection assays that the expression of lytM in S. aureus is regulated by the essential twocomponent regulatory system WalK/WalR (YycG/YycF)
(Dubrac & Msadek, 2004; Dubrac et al., 2007). The response
regulator WalR activates the expression of nine genes
involved in staphylococcal cell wall degradation. Conditions
that depleted WalR in S. aureus cells led to a significant
reduction in the levels of cell wall hydrolytic enzymes
including a 36 kDa hydrolytic enzyme that was speculated
by the authors to be LytM (Dubrac et al., 2007).
The results of this study, however, suggest that LytM,
which is an early to mid-exponential-phase protein, is not
responsible for the 36 kDa lytic activity band present in the
lyt mutant strain of S. aureus. This conclusion is based on
the fact that there was no decrease in the intensity of the
36 kDa lytic band subsequent to the deletion of the lytM
gene from S. aureus cells. In addition, the lytic activity
present in the lyt mutant strain of S. aureus could not be
FEMS Microbiol Lett 311 (2010) 167–175
1
1
2
3
4
abolished after the deletion of the lytM gene in this
autolysis-resistant strain. Our findings are further supported
by the observations with LytM protein and its lytic activity
during the course of its crystal structure determination
(Odintsov et al., 2004). The authors demonstrated LytM to
be a Zn21-dependent two-domain metalloprotease (Odintsov et al., 2004). The N-terminal domain of LytM (45–98)
makes very limited contact with the LytM C-domain
(Odintsov et al., 2004). The LytM C-domain (99–316)
comprises two ordered regions located up- and downstream
of a disordered (147–182) region. The authors detected no
lytic activity in assays using pentaglycine as a substrate with
the full-length LytM or a truncated LytM that lacked the Nterminal and the upstream ordered region (Odintsov et al.,
2004). However, truncated LytM (185–316) or a trypsin
product of LytM (180–316) that only contained the downstream ordered region demonstrated activity in these assays
(Odintsov et al., 2004). The crystal structure of this active
fragment of LytM185 316 has since been determined (Firczuk et al., 2005).
The abundance of LytM in the form of a 36 kDa protein in
vancomycin-resistant S. aureus (Pieper et al., 2006) suggests
some role for this protein in resistance against vancomycin
and probably other cell wall inhibitors. This speculation is
supported by observation in this study where the lack of a
functional LytM led to induced lysis of staphylococcal cells
in the presence of oxacillin. However, the expression of lytM
was not impacted by exposure to cell wall inhibitors either in
this study or in a previous study (Utaida et al., 2003).
Several S. aureus mutants are described in the literature
with drastically reduced rates of autolysis. Similar to the lyt
mutant, a mutation in the atl gene in S. aureus abolished
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
174
most of the lytic bands, except for a 36 kDa autolysin band
and a few minor bands of smaller sizes (Foster, 1995). It is
still to be ascertained what gene or genes have been
inactivated in the lyt S. aureus strain subsequent to
transposon insertion that led to reduced autolysis of the
mutant cells. On the other hand, the atl gene is well
characterized, encodes a 137 kDa protein, and it has been
proposed that most autolysins in S. aureus are the processed
products of ATL protein (Foster, 1995; Sugai et al., 1997). In
another study, suppression of the expression of a putative
S. aureus glycoprotease led to drastically reduced autolysis of
S. aureus cells. However, there was no change in the
expression levels of any of the known autolysin regulators
or autolysins including LytM in these autolysis-resistant
cells with a reduced level of the glycoprotease (Zheng et al.,
2007). The expression level of lytM and other major autolytic enzymes was also not suppressed in transcriptomic
analysis of an autolysis-deficient methicillin-resistant strain
of S. aureus (Renzoni et al., 2006).
In summary, the findings of this study suggest that LytM
is an insignificant player in terms of autolysins in S. aureus
and is not responsible for the 36 kDa lytic protein that many
investigators have proposed to be due to this protein. There
are several genes such as lytN and aaa (Gill et al., 2005;
Heilmann et al., 2005) that are postulated to be peptidoglycan hydrolases and encode proteins of approximately 36 kDa
that might be responsible for the pronounced lytic activity
band of this size that is typically visualized in zymographic
analysis of staphylococcal autolysins. Based on the findings
of this study, it is thus proposed that the LytM protein be
investigated in S. aureus beyond its role as an autolysin.
Acknowledgements
The authors thank R.K. Jayaswal (Illinois State University)
for providing some of the strains used in this work. This
work was supported in part by a Warner/Fermaturo & ATSU
Board of Trustees Research Funds and grant 1R15AI09068001 from the National Institutes of Health to V.K.S., a grant
from KCOM Biomedical Sciences Graduate Program to K.S.
and an ASDOH summer internship to M.R.C.
References
Augustin J, Rosenstein R, Wieland B, Schneider U, Schnell N,
Engelke G, Entian KD & Gotz F (1992) Genetic analysis of
epidermin biosynthetic genes and epidermin-negative
mutants of Staphylococcus epidermidis. Eur J Biochem 204:
1149–1154.
Bochtler M, Odintsov SG, Marcyjaniak M & Sabala I (2004)
Similar active sites in lysostaphins and D-Ala-D-Ala
metallopeptidases. Protein Sci 13: 854–861.
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
V.K. Singh et al.
Cassat J, Dunman PM, Murphy E, Projan SJ, Beenken KE, Palm
KJ, Yang SJ, Rice KC, Bayles KW & Smeltzer MS. (2006)
Transcriptional profiling of a Staphylococcus aureus clinical
isolate and its isogenic agr and sarA mutants reveals global
differences in comparison to the laboratory strain RN6390.
Microbiology 152: 3075–3090.
Chan PF, Foster SJ, Ingham E & Clements MO (1998) The
Staphylococcus aureus alternative sigma factor SigmaB controls
the environmental stress response but not starvation survival
or pathogenicity in a mouse abscess model. J Bacteriol 180:
6082–6089.
Dubrac S & Msadek T (2004) Identification of genes controlled
by the essential YycG/YycF two-component system of
Staphylococcus aureus. J Bacteriol 186: 1175–1181.
Dubrac S, Boneca IG, Poupel O & Msadek T (2007) New insights
into the WalK/WalR (YycG/YycF) essential signal transduction
pathway reveal a major role in controlling cell wall metabolism
and biofilm formation in Staphylococcus aureus. J Bacteriol
189: 8257–8269.
Dunman PM, Murphy E, Haney S, Palacios D, Tucker-Kellogg G,
Wu S, Brown EL, Zagursky RJ, Shlaes D & Projan SJ. (2001)
Transcription profiling-based identification of Staphylococcus
aureus genes regulated by the agr and/or sarA loci. J Bacteriol
183: 7341–7353.
Firczuk M, Mucha A & Bochtler M (2005) Crystal structures of
active LytM. J Mol Biol 354: 578–590.
Foster SJ (1995) Molecular characterization and functional
analysis of the major autolysin of Staphylococcus aureus 8325/
4. J Bacteriol 177: 5723–5725.
Gill SR, Fouts DE, Archer GL et al. (2005) Insights on evolution
of virulence and resistance from the complete genome analysis
of an early methicillin-resistant Staphylococcus aureus strain
and a biofilm-producing methicillin-resistant Staphylococcus
epidermidis strain. J Bacteriol 187: 2426–2438.
Heilmann C, Hartleib J, Hussain MS & Peters G (2005) The
multifunctional Staphylococcus aureus autolysin aaa mediates
adherence to immobilized fibrinogen and fibronectin. Infect
Immun 73: 4793–4802.
Horsburgh MJ, Aish JL, White IJ, Shaw L, Lithgow JK & Foster SJ
(2002) SigmaB modulates virulence determinant expression
and stress resistance: characterization of a functional RsbU
strain derived from Staphylococcus aureus 8325-4. J Bacteriol
184: 5457–5467.
Ingavale SS, Van Wamel W & Cheung AL (2003) Characterization
of RAT, an autolysis regulator in Staphylococcus aureus. Mol
Microbiol 48: 1451–1466.
Kreiswirth BN, Lofdahl S, Betley MJ, O’Reilly M, Schlievert PM,
Bergdoll MS & Novick RP (1983) The toxic shock syndrome
exotoxin structural gene is not detectably transmitted by a
prophage. Nature 305: 709–712.
Mani N, Tobin P & Jayaswal RK (1993) Isolation and
characterization of autolysis-defective mutants of
Staphylococcus aureus created by Tn917–lacZ mutagenesis.
J Bacteriol 175: 1493–1499.
FEMS Microbiol Lett 311 (2010) 167–175
175
Staphylococcal LytM
Mead DA, Szczesna-Skorupa E & Kemper B (1986) Singlestranded DNA ‘blue’ T7 promoter plasmids: a versatile tandem
promoter system for cloning and protein engineering. Protein
Eng 1: 67–74.
Mongodin E, Finan J, Climo MW, Rosato A, Gill S & Archer GL
(2003) Microarray transcription analysis of clinical
Staphylococcus aureus isolates resistant to vancomycin.
J Bacteriol 185: 4638–4643.
Novick RP (1991) Genetic systems in staphylococci. Method
Enzymol 204: 587–636.
Odintsov SG, Sabala I, Marcyjaniak M & Bochtler M (2004)
Latent LytM at 1.3A resolution. J Mol Biol 335: 775–785.
Pieper R, Gatlin-Bunai CL, Mongodin EF, Parmar PP, Huang ST,
Clark DJ, Fleischmann RD, Gill SR & Peterson SN (2006)
Comparative proteomic analysis of Staphylococcus aureus
strains with differences in resistance to the cell wall-targeting
antibiotic vancomycin. Proteomics 6: 4246–4258.
Plata K, Rosato AE & Wegrzyn G (2009) Staphylococcus aureus as
an infectious agent: overview of biochemistry and molecular
genetics of its pathogenicity. Acta Biochim Pol 56: 597–612.
Ramadurai L & Jayaswal RK (1997) Molecular cloning,
sequencing, and expression of lytM, a unique autolytic gene of
Staphylococcus aureus. J Bacteriol 179: 3625–3631.
Ramadurai L, Lockwood KJ, Nadakavukaren MJ & Jayaswal RK
(1999) Characterization of a chromosomally encoded
glycylglycine endopeptidase of Staphylococcus aureus.
Microbiology 145: 801–808.
Renzoni A, Barras C, Francois P et al. (2006) Transcriptomic and
functional analysis of an autolysis-deficient, teicoplaninresistant derivative of methicillin-resistant Staphylococcus
aureus. Antimicrob Agents Ch 50: 3048–3061.
Schenk S & Laddaga RA (1992) Improved method for
electroporation of Staphylococcus aureus. FEMS Microbiol Lett
73: 133–138.
Schleifer KH & Kandler O (1972) Peptidoglycan types of bacterial
cell walls and their taxonomic implications. Bacteriol Rev 36:
407–477.
Shenkman B, Rubinstein E, Cheung AL, Brill GE, Dardik R,
Tamarin I, Savion N & Varon D (2001) Adherence properties
FEMS Microbiol Lett 311 (2010) 167–175
of Staphylococcus aureus under static and flow conditions: roles
of agr and sar loci, platelets, and plasma ligands. Infect Immun
69: 4473–4478.
Singh VK, Jayaswal RK & Wilkinson BJ (2001a) Cell wall-active
antibiotic induced proteins of Staphylococcus aureus
identified using a proteomic approach. FEMS Microbiol Lett
199: 79–84.
Singh VK, Moskovitz J, Wilkinson BJ & Jayaswal RK (2001b)
Molecular characterization of a chromosomal locus in
Staphylococcus aureus that contributes to oxidative defence and
is highly induced by the cell-wall-active antibiotic oxacillin.
Microbiology 147: 3037–3045.
Singh VK, Utaida S, Jackson LS, Jayaswal RK, Wilkinson BJ &
Chamberlain NR (2007) Role for dnaK locus in tolerance of
multiple stresses in Staphylococcus aureus. Microbiology 153:
3162–3173.
Singh VK, Hattangady DS, Giotis ES, Singh AK, Chamberlain
NR, Stuart MK & Wilkinson BJ (2008) Insertional inactivation
of branched-chain alpha-keto acid dehydrogenase in
Staphylococcus aureus leads to decreased branched-chain
membrane fatty acid content and increased susceptibility to
certain stresses. Appl Environ Microb 74: 5882–5890.
Sugai M, Fujiwara T, Ohta K, Komatsuzawa H, Ohara M &
Suginaka H (1997) epr, which encodes glycylglycine
endopeptidase resistance, is homologous to femAB and
affects serine content of peptidoglycan cross bridges in
Staphylococcus capitis and Staphylococcus aureus. J Bacteriol
179: 4311–4318.
Utaida S, Dunman PM, Macapagal D, Murphy E, Projan SJ, Singh
VK, Jayaswal RK & Wilkinson BJ (2003) Genome-wide
transcriptional profiling of the response of Staphylococcus
aureus to cell-wall-active antibiotics reveals a cell-wall-stress
stimulon. Microbiology 149: 2719–2732.
Yanisch-Perron C, Vieira J & Messing J (1985) Improved M13
phage cloning vectors and host strains: nucleotide sequences of
the M13mp18 and pUC19 vectors. Gene 33: 103–119.
Zheng L, Yu C, Bayles K, Lasa I & Ji Y (2007) Conditional
mutation of an essential putative glycoprotease eliminates
autolysis in Staphylococcus aureus. J Bacteriol 189: 2734–2742.
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c