Figure S1. Effects of H2O2 and NO on DCF fluorescence densities in the roots after
HS treatment
(A) Six-day-old wild-type seedlings grown at 22°C were pretreated with 2 mL of
ultrapure water (Control), 100 μM H2O2, 20 μM SNP, 20 μM SNAP, 125 units CAT,
or 50 μM cPTIO, for 8 h, then exposed to 45°C for 20 min. The fluorescence densities
were then assessed by fluorescence microscopy in roots stained with CM-H2DCFDA.
Bar = 100 μm.
(B) Relative DCF fluorescence densities in the roots. The data presented are the mean
± SE of measurements taken from at least 10 roots for each treatment. *, P < 0.05; **,
P < 0.01 (Student’s t test).
Figure S2. AtrbohB and AtrbohD transcription in wild-type, atrbohB, atrbohD, and
atrbohB/D seedlings.
RT-PCR analysis was used to measure AtrbohB and AtrbohD transcription in
25-day-old wild-type, atrbohB, atrbohD, and atrbohB/D seedlings. ACTIN7 (ACT7)
was used as an internal control.
Figure S3. Effects of light, age and temperature on NO production in wild-type
seedlings.
(A) Six-day-old wild-type seedlings grown at 22°C were exposed to 45°C (HS) or
maintained at 22°C (Control) for 60 min in the light or dark. The NO levels were then
assessed by fluorescence microscopy in roots stained with DAF-FM DA. Bar = 100
μm.
(B) Six, five or four-day-old wild-type seedlings grown at 22°C were exposed to 45°C
(HS) or maintained at 22°C (Control) for 60 min. The NO levels were then assessed
by fluorescence microscopy in roots stained with DAF-FM DA.
(C) Six-day-old wild-type seedlings grown at 22°C were exposed to 45°C and 37°C
(HS), respectively, or maintained at 22°C (Control) for 60 min. The NO levels were
then assessed by fluorescence microscopy in roots stained with DAF-FM DA.
(D) Relative DAF-FM fluorescence densities in the roots. The data presented are the
mean ± SE of measurements taken from at least 10 roots for each treatment.
Figure S4. Effects of cPTIO and H2O2 on the thermotolerance of wild-type seedlings
(A) Six-day-old wild-type seedlings grown at 22°C were pretreated with 4 mL of
ultrapure water (1) or 2 mL of 50 μM cPTIO in combination with 2 mL of a different
concentration (2, 25 μM; 3, 50 μM; 4, 100 μM; or 5, 200 μM) of H2O2 for 8 h, then
exposed to 45°C for 60 min and returned to 22°C to be photographed 5 days later.
(B) Survival ratios of the seedlings after HS treatment. The data presented are the
mean ± SE of at least 5 independent experiments, with 50 seedlings per experiment.
Figure S5. Effects of NO on the thermotolerance of wild-type, noa1, atrbohB/D and
atrbohB/D/noa1 seedlings.
(A) and (B) Six-day-old wild-type, noa1, atrbohB/D and atrbohB/D/noa1 seedlings at
22°C pretreated with 2 mL of 20 μM SNP (A) or SNAP (B) for 8 h were exposed to
45°C (HS) or maintained at 22°C (Control) for 60 min then returned to 22°C and
photographed 5 days later. 1, wild-type; 2, noa1; 3, atrbohB/D; and 4,
atrbohB/D/noa1.
(C) Survival ratios of the seedlings after HS treatment. The data presented are the
mean ± SE of at least 5 independent experiments, with 50 seedlings per experiment. *,
P < 0.05 versus wild-type seedlings (Student’s t test). WT, wild type.
Figure S6. Analysis of the effects of NO on H2O2-induced HSFs and HSPs gene
expression by real time RT-PCR.
Ten-day-old seedlings grown at 22°C was exposed to 37°C for 1 h (A-C) or 2 h (D, E)
then treated as described in Materials and Methods. The data are the mean ± SE of at
least 5 independent experiments.
Figure S7. Effects of NO and H2O2 on catalase (CAT) activity in wild-type seedlings
after HS treatment.
Six-day-old wild-type seedlings grown at 22°C were pretreated with 2 mL of
ultrapure water, 20 μM SNP or SNAP in combination with 2 mL of a different
concentration of H2O2 (0, 25, 50, 100, and 200 μM) for 8 h, then exposed to 45°C (HS,
HS+SNP, and HS+SNAP) or maintained at 22°C (ultrapure water pretreatment,
Control) for 60 min to be used for CAT activity determination. The data presented are
the mean ± SE of at least 5 independent experiments. *, P < 0.05; **, P < 0.01
(Student’s t test).
Supplemental Table S1. Primer sequences (5'→3') used for RT-PCR.
Gene
Forward
Reverse
At1g09090 (rbohB)
GAATAATGTAATTGTAGTGAATGCG
ACAAATTCGCTAGATTCAACCAT
At1g37130 (NIA2)
GCAAGCCACACAAGGGAG
GGGATTAACCAAAGCGAGG
At3g47450 (NOA1)
TTCTCTTCCTCGTCGCCAC
CGGATTAGCTCCAACTAAATCAC
At5g09810 (ACT7)
AGGCACCTCTTAACCCTAAAGC
GGACAACGGAATCTCTCAGC
At5g47910 (rbohD)
GTCGCCAAAGGAGGCGCCGA
GGATACTGATCATAGGCGTGGCTCCA
Supplemental Table S2: Primer sequences (5'→3') used for real-time RT-PCR
Gene
Forward
Reverse
At2g26150 (HsfA2)
GTGTTGAGGTTGGGCAATACG
TTGCTGTTGCCTCAACCTAACTAC
At3g18780 (ACT2)
GGTAACATTGTGCTCAGTGGTGG
AACGACCTTAATCTTCATGCTGC
At3g46230 (HSP17.4)
CGTGTTCGACCCATTTTCACT
CCTCCAGTCCACTTTAGCGTTT
At3g51910 (HsfA7a)
GAGTCAGCAAAGAGGAAAAGAGG
CCATCTAGTTAGGAGGTGGAAG
At4g10250 (HSP22)
CGGTTCCCTGATCCATTCAAGAT
ACAGAGCCACGCTTGTGT
At4g11660 (HsfB2b)
TGGAGGAGAATAACTCCGGTAA
ATGCAATGGGGATTCAGTAACA