An Oxidized Extracellular Oxidation-Reduction State
Increases Nox1 Expression and Proliferation in Vascular
Smooth Muscle Cells Via Epidermal Growth Factor
Receptor Activation
Bojana Stanic, Masato Katsuyama, Francis J. Miller, Jr
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
Objective—To examine the effect of an oxidized extracellular oxidation-reduction (redox) state (Eh) on the expression of
NADPH oxidases in vascular cells.
Methods and Results—The generation of reactive oxygen species by NADPH oxidase (Nox)-based NADPH oxidases
activates redox-dependent signaling pathways and contributes to the development of “oxidative stress” in vascular
disease. An oxidized plasma redox state is associated with cardiovascular disease in humans; however, the cellular
mechanisms by which the extracellular redox state may cause disease are not known. Aortic segments and cultured
aortic smooth muscle cells were exposed to Eh between ⫺150 mV (reduced) and 0 mV (oxidized) by altering the
concentration of cysteine and its disulfide, cystine, the predominant redox couple in plasma. A more oxidized Eh
increased the expression of Nox1 and resulted in Nox1-dependent proliferation of smooth muscle cells. Oxidized Eh
rapidly induced epidermal growth factor receptor phosphorylation via shedding of epidermal growth factor–like ligands
from the plasma membrane and caused extracellular signal–regulated kinase 1/2– dependent phosphorylation of the
transcription factors activating transcription factor-1 and cAMP-response element– binding protein. Inhibition of
epidermal growth factor receptor or extracellular signal–regulated kinase 1/2 activation, or addition of small interference
RNA to activating transcription factor-1, prevented the increase in Nox1 expression.
Conclusion—Our results identify a novel mechanism by which extracellular oxidative stress increases expression and
activity of Nox1 NADPH oxidase and contributes to vascular disease. (Arterioscler Thromb Vasc Biol. 2010;30:2234-2241.)
Key Words: oxidative stress 䡲 atherosclerosis 䡲 NADPH oxidase 䡲 epidermal growth factor receptor
R
eactive oxygen species (ROS) contribute to the pathogenesis of cardiovascular diseases, including hypertension, atherosclerosis, cardiac hypertrophy, heart failure, and
restenosis.1–3 An increase in cellular ROS contributes to the
pathogenesis of vascular disease by altering endothelial cell
function, enhancing vascular smooth muscle cell (SMC)
growth and proliferation, stimulating the expression of proinflammatory genes, and modulating reconstruction of the
extracellular matrix.1,4 Although an excessive amount of ROS
is considered harmful and contributes to the pathogenesis of
disease, ROS normally participate in the regulation of important cellular processes, including cell signaling, gene expression, cellular death and senescence, regulation of growth,
oxygen sensing, activation of matrix metalloproteinases
(MMPs), and angiogenesis.5–7
Although several cellular sources of ROS have been
identified, the primary source of ROS in vascular cells is
NADPH oxidases.3,8 Of the Nox isoforms, Nox1, Nox2,
Nox4, and Nox5 are expressed in vascular cells, with expression patterns showing cell specificity. For example, only
Nox1 and Nox4 are expressed in rodent aortic SMCs.9 The
activity of the vascular NADPH oxidases is regulated by
cytokines, hormones, and mechanical forces known to be
involved in the pathogenesis of vascular disease.10,11 NADPH
oxidase expression is associated with the progression of
atherosclerosis in humans12,13 and with plaque instability in
human coronary arteries.14
Essential cellular processes, such as proliferation, differentiation, and apoptosis, are regulated by reversible
oxidation-reduction (redox) reactions of thiol/disulfide couples.15–17 The most abundant intracellular low-molecularweight thiol/disulfide couple is glutathione (GSH)/GSH disulfide (GSSG), which regulates a variety of cellular
processes. After adjusting for traditional risk factors, the
Received on: April 13, 2010; final version accepted on: August 10, 2010.
From the Department of Internal Medicine (B.S. and F.J.M.), The University of Iowa, Iowa City; Department of Pharmacology, Kyoto Prefectural
University of Medicine (M.K.), Kyoto, Japan; the Department of Anatomy and Cell Biology (F.J.M.), The University of Iowa, Iowa City; the Free Radical
and Radiation Biology Program (F.J.M.), The University of Iowa, Iowa City; and Department of Internal Medicine, Veterans Affair Medical Center
(F.J.M.), Iowa City, Iowa.
Correspondence to Francis J. Miller, Jr, MD, Department of Internal Medicine, The University of Iowa, 285 Newton Rd, Room 2269 CBRB, Iowa City,
IA 52242. E-mail [email protected]
© 2010 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
2234
DOI: 10.1161/ATVBAHA.110.207639
Stanic et al
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
redox state (Eh) of GSH/GSSG was an independent predictor
for carotid intima-media thickness in healthy patients.18 In
contrast, the predominant extracellular low-molecular-weight
thiol/disulfide couple is cysteine and cystine (Cys/CySS). In
humans, the redox state of plasma Cys/CySS differs considerably between individuals, with an oxidized Eh Cys/CySS in
patients with increasing age,19 cigarette smoking,20 and type
2 diabetes mellitus,17 all of which are risk factors for the
development of cardiovascular disease. In addition, levels of
oxidized Cys metabolites correlated with endothelial dysfunction in a healthy human population.21 Recently, oxidized
extracellular Eh Cys/CySS determined proinflammatory cytokine levels in human plasma.22 However, the effect of the
extracellular redox state on the expression or activity of
vascular NADPH oxidases is not known.
The goal of this study was to examine the effect of extracellular oxidative stress (oxidized Eh) on NADPH oxidases in
SMCs. Our findings identify a signaling pathway by which
oxidation of the extracellular environment activates epidermal
growth factor receptor (EGFR) through metalloproteinasemediated shedding of EGF-like ligands, leading to extracellular
signal–regulated kinase 1/2 (ERK1/2)– dependent activation of
the transcription factor activating transcription factor-1 (ATF-1)
and subsequent expression of Nox1. These data identify a novel
mechanism by which extracellular oxidative stress activates
redox-sensitive pathways that increase Nox1-based NADPH
oxidase expression and SMC proliferation.
Methods
The supplemental data (available online at http://atvb.ahajournals.
org) provide a complete description of materials and methods used
for these studies. Medial SMCs were cultured from thoracic aorta of
C57BL/6 mice.23 The range of extracellular thiol/disulfide redox
states (from ⫺150 to 0 mV) was generated by varying concentrations
of Cys and CySS added to cyst(e)ine-free DMEM, as previously
described,24 while maintaining a constant concentration of total Cys
moieties of 200 ␮mol/L. Recombinant adenoviruses encoding small
interference Nox125 and a constitutively active form of the mitogenactivated protein kinase (MAPK) kinase26 were used. The 21
nucelotide-long siRNA (21-nt) anti– cAMP-response element– binding protein (CREB) and anti–ATF-1 double-stranded small interference RNAs and their scrambled controls were designed using
BLOCK-iT RNAi Designer and synthesized by Invitrogen, Carlsbad,
Calif. Fluorogenic peptide substrates were used to measure metalloproteinase activity. pGL3 (a luciferase reporter plasmic designed by
Promega)-basic (empty vector) or Nox1 promoter–luciferase plasmids27 were cotransfected into SMCs with plasmid containing SV40
(simian virus) promoter (pSV40)-Renilla control vectors, and data
were reported as a ratio between the firefly and Renilla luciferase.
Results are expressed as mean⫾SEM. Statistical comparisons were
performed by Student 2-tailed t tests or ANOVA, with a Dunnett or
Tukey multiple comparison posttest as appropriate. P⬍0.05 was
considered significant.
Results
Oxidized Extracellular Eh Increases Nox1
Expression and SMC Growth
Exposure of isolated aortas to an oxidized extracellular redox
environment increased cellular outgrowth and expression of
the NADPH oxidase catalytic subunit Nox1 (Figure 1A).
Because SMCs are the predominant source of Nox1 in the
blood vessel,8 subsequent experiments focused on characterizing the response of cultured SMCs to changes in extracel-
Extracellular Redox and Nox1
2235
lular redox. Similar to observations in aorta segments, SMC
expression of Nox1 increased in response to an increasingly
oxidized extracellular redox state. At the oxidized Eh of 0
mV, Nox1 mRNA expression increased ⬎2-fold after 24
hours (supplemental Figure IA) and ⬎4-fold after 48 hours
(Figure 1B) compared with the Eh of ⫺150 mV. An increase
in Nox1 protein expression was confirmed by Western
blotting (Figure 1C and supplemental Figure IC and D). In
contrast to Nox1, SMC expression of Nox4 was not significantly affected by changes in the extracellular redox state
(Figure 1B and supplemental Figure IB). Oxidized extracellular Eh failed to increase Nox1 levels in human embryonic
kidney 293 or human gut epithelial carcinoma cells, identifying cell specificity to this response (supplemental Figure
IE). Next, we determined whether the oxidized Eh–mediated
increase in SMC Nox1 resulted in an increase in cellular
generation of ROS. Compared with the more reduced extracellular Eh, oxidized Eh increased superoxide levels in SMCs;
this effect was prevented by the selective inhibition of Nox1
expression (Figure 1D and E). Because Nox1 has been
implicated in regulating cell growth,28 –30 we then examined
whether an oxidized Eh induced SMC proliferation. Compared with more reduced conditions (⫺150 mV), an oxidized
Eh (0 mV) for 48 hours resulted in ⬎1.5-fold increase in
thymidine incorporation, which was dependent on the expression of Nox1 (Figure 1F). These data indicate that exposure
of vascular SMCs to an oxidized extracellular environment
increases expression and activity of Nox1, resulting in increased levels of ROS and cell proliferation.
Oxidized Extracellular Eh Activates EGFR Via
MMPs/Disintegrin and Metalloproteinase Family
The EGFR is a primary coordinator of signal transduction
from the extracellular environment.31,32 Therefore, we examined activation of the EGFR as a potential mediator of
oxidized extracellular Eh– dependent increase in Nox1 gene
expression. Oxidized extracellular Eh rapidly induced transient EGFR phosphorylation (Figure 2A and supplemental
Figure IIA), confirmed by the specific inhibitor of EGFR
phosphorylation AG1478 (supplemental Figure IIB). Many
ligands of the EGFR are synthesized as transmembrane
precursors that must be cleaved by metalloproteinases to
release mature ligands.33 Two closely related metalloproteinase families, MMPs and a disintegrin and metalloproteinase
family (ADAMs), contain critical redox-sensitive Cys residues.34 We tested whether oxidized extracellular Eh could
activate metalloproteinases, thereby releasing surface-bound
EGFR ligands. Rapid phosphorylation of the EGFR in response to oxidized extracellular Eh was attenuated by the
general metalloproteinase inhibitor GM6001 (Figure 2B),
confirming involvement of surface metalloproteinases in
EGFR activation to oxidative stress, consistent with previous
reports.35 Next, we used the fluorogenic peptide substrates III
and IX to investigate the role of specific metalloproteinases in
the activation of EGFR. Studies of SMCs exposed to oxidized
extracellular Eh in the presence of a fluorogenic substrate
selective for tumor necrosis factor ␣ converting enzyme (or
ADAM17) and related enzymes (eg, ADAM9 and ADAM10)
indicated activation of ADAMs within minutes, which per-
2236
Arterioscler Thromb Vasc Biol
November 2010
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
Figure 1. Oxidized extracellular Eh
increases Nox1 expression and growth
of vascular cells. Isolated aortas and
SMCs were exposed to varying concentrations of Cys and CySS to obtain a
range of Eh from ⫺150 to 0 mV. A, Representative images show aortic outgrowth on Matrigel. Mean outgrowth
area was calculated from 8 aortic rings
in each group, obtained from 2 animals.
Nox1 mRNA expression was measured
by quantitative RT-PCR (qRT-PCR)
(n⫽4). B, Nox1 and Nox4 mRNA expression in SMCs was measured by qRTPCR (n⫽4). C, Nox1 protein expression
in SMCs was measured by Western
blotting. Results are normalized to
GAPDH expression (n⫽6). D, Superoxide
levels in SMCs were assessed by dihydroethidium (DHE) fluorescence. E, Mean
DHE fluorescence was obtained from 14
to 16 fields per group in 2 independent
experiments. F, SMC proliferation was
measured by [3H]-thymidine incorporation (n⫽4). Data are presented as
mean⫾SE. *P⬍0.05 vs ⫺150 mV and
⌬P⬍0.05 vs 0 mV Ad-empty. Ad-siNox
indicates recombinant adenoviruses
encoding small interference Nox1.
Ad-empty indicates an empty expression
cassette adenovirus.
sisted for several hours (Figure 2C). Similarly, studies using
a fluorogenic substrate selective for MMPs suggested rapid
and sustained activation of these metalloproteinases to oxidize extracellular Eh (Figure 2C). Additional evidence for
MMP activation is provided by the finding that oxidized
extracellular Eh increased proteolytic activity of MMP-2 and
MMP-9 and their proforms (Figure 2D). These data indicate
that exposure of SMCs to an oxidized extracellular environ-
Figure 2. EGFR is phosphorylated by
oxidized extracellular Eh via activation
of metalloproteinases. A, SMCs were
treated with Eh⫽0 mV and p-EGFR
expression analyzed by Western blotting. Results are normalized to total
EGFR expression (n⫽4). B, SMCs were
incubated with 20-␮mol/L GM6001 and
then treated with Eh⫽0 mV for 1
minute. Phosphorylated EGFR was analyzed by Western blotting. Results are
normalized to total EGFR expression
(n⫽4). Blots shown under A and B
were run on the same gel but cut for
better presentation. C, Fluorogenic
peptide substrates were added to
Eh⫽0 mV media, then collected at specific points for measurement of metalloproteinase activity. An appropriate
blank (without fluorogenic substrate) was
subtracted from each measurement (n⫽5).
D, Gelatin zymography of MMP activity
after control (c) and Eh⫽0 mV (t). A representative gel of 3 independent experiments is shown. Summary data are presented as mean⫾SE. *P⬍0.05 vs untreated (0 minutes) and
⌬P⬍0.05 vs 0 mV vehicle. p- indicates phosphorylated form of the protein; pro-MMP, latent form of the MMP.
Stanic et al
Extracellular Redox and Nox1
2237
Figure 3. Oxidized extracellular Eh
increases Nox1 expression via the
metalloproteinase-EGFR pathway. A and
B, SMCs were pretreated with
10-␮mol/L AG1478 (A) or 20-␮mol/L
GM6001 (B) and then exposed to Eh⫽0
mV for 24 hours. Nox1 mRNA expression was measured by quantitative
RT-PCR (n⫽4). C and D, SMCs were
transfected with Nox1 promoter luciferase or control plasmid, then pretreated
with 10-␮mol/L AG1478 (C) or
20-␮mol/L GM6001 (D) and exposed to
Eh⫽0 mV for 8 hours. Firefly luciferase
activity was normalized to Renilla luciferase (n⫽4). Data are presented as
mean⫾SE. *P⬍0.05 vs control and
⌬P⬍0.05 vs 0-mV vehicle.
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
ment activates both the MMP and ADAM families of
metalloproteinases, resulting in phosphorylation of the EGFR
via shedding of EGF-like ligands from the cell surface.
The addition of EGF ligands to SMCs increases intracellular
ROS.36 We examined the effect of short-term changes in
extracellular Eh on intracellular ROS levels. Forty-five minutes after exposure to 0 mV extracellular Cys/CySS (versus
⫺150 mV), cellular 5-(and-6)-chloromethyl-2⬘,7⬘dichlorodihydrofluorescein diacetate (DCFH) fluorescence
was increased 43⫾9% (n⫽5, P⬍0.05).
Oxidized Eh Increases Nox1 Expression Via EGFR
Next, we determined whether phosphorylation of the EGFR
was necessary for increasing expression of Nox1 in response
to oxidized extracellular Eh. Inhibition of EGFR phosphorylation by the specific inhibitor AG1478 prevented the increase in Nox1 expression (Figure 3A). Moreover, consistent
with our observation that oxidized extracellular Eh activates
EGFR by metalloproteinase-mediated shedding of EGF-like
ligands, the increase in Nox1 expression was abolished by
GM6001 (Figure 3B). A role for EGFR activation in Nox1
expression is further supported by the observation that
AG1478 and GM6001 prevented an increase in Nox1 promoter–luciferase activity (Figure 3C and D).
Oxidized Extracellular Eh Activates ERK1/2
and Akt
Members of the MAPK family and phosphatidylinositol
3-kinase/Akt are downstream targets of EGFR activation.31
Therefore, we investigated the involvement of these signaling
pathways in mediating an increase in Nox1 expression.
Oxidized extracellular Eh activates ERK1/2 and Akt in a
time-dependent manner, with maximal phosphorylation
within the first several minutes (supplemental Figure IIIA and
B), which was abolished by pretreatment with GM6001
(Figure 4A and D) or with AG1478 (Figure 4B and E). These
data demonstrate that oxidized extracellular Eh activates
ERK1/2 and Akt through shedding of EGF-like factors and
subsequent activation of EGFR. Inhibiting ERK1/2 activation
by the selective MAPK/ERK kinase inhibitor U0126 prevented the increase in Nox1 promoter–luciferase activity to
oxidized extracellular Eh (Figure 4C), whereas inhibition of
the phosphatidylinositol 3-kinase/Akt pathway by wortmannin had no effect (Figure 4F). A role for ERK1/2 in
expression of Nox1 was further supported by the observation
that expression of a constitutively active form of MAPK/ERK
kinase in SMCs markedly increased expression and
promoter-luciferase activity of Nox1 (supplemental Figure
IV). Oxidized extracellular Eh had no effect on p38 MAPK
(supplemental Figure IIIC) but caused a modest activation of
janus kinase (JNK) (supplemental Figure IIID). However,
inhibition of the JNK MAPK pathway with SP600125, a
potent JNK inhibitor, had no effect on Nox1 expression and
promoter-luciferase activity (data not shown). Together, these
results suggest that in response to changes in extracellular
redox state, signal transduction from the cell surface to the
transcription of Nox1 primarily involves activation of the
EGFR-ERK1/2 pathway.
Oxidized Extracellular Eh Activates Transcription
Factors ATF-1 and CREB
It was previously shown that prostaglandin F2␣ and plateletderived growth factor (PDGF) increase Nox1 expression via
ATF-1.37 Therefore, we examined the role of ATF-1 and its
related transcription factor CREB in oxidized Eh-induced
Nox1 expression. After extraction of DNA-bound proteins
from the nucleus, both CREB and ATF-1 were observed to be
phosphorylated by oxidized extracellular Eh in a timedependent manner (Figure 5A). After construction and testing
of small interference RNAs to the transcription factors CREB
and ATF-1 (supplemental Figure V), we found that small
interference RNA to ATF-1 prevented the oxidized Ehmediated increase in Nox1 expression (Figure 5B), whereas
small interference RNA to CREB had no effect (Figure 5C).
Then, we determined if oxidized extracellular Eh activated
ATF-1 via the EGFR-ERK1/2 signaling pathway. Both
2238
Arterioscler Thromb Vasc Biol
November 2010
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
Figure 4. Oxidized extracellular Eh activates ERK1/2 and Akt via the metalloproteinase-EGFR pathway, but only ERK1/2 mediates the
associated increase in Nox1 expression. A, B, D, and E, SMCs were exposed to Eh⫽0 mV and p-ERK1/2 (A and B) or p-Akt (D and E)
were analyzed by Western blotting after pretreatment with 20-␮mol/L GM6001 (A and D) or 10-␮mol/L AG1478 (B and E). Results are
normalized to total ERK (A and B) or GAPDH (D and E) expression (n⫽3 to 5). C and F, Nox1 promoter luciferase activity was measured after pretreatment with 10-␮mol/L U0126 (C) or 1-␮mol/L wortmannin (F) and exposed to Eh⫽0 mV for 8 hours. Firefly luciferase
activity was normalized to Renilla luciferase (n⫽4 to 6). Data are presented as mean⫾SE. *P⬍0.05 vs control and ⌬P⬍0.05 vs 0 mV
vehicle. p- indicates phosphorylated form of the protein.
GM6001 and AG1478 prevented activation of ATF-1 (Figure
6A and supplemental Figure VI); the same inhibitors failed to
significantly prevent activation of CREB (Figure 6D and
supplemental Figure VI). Similarly, phosphorylation of
ATF-1, but not CREB, was inhibited by U0126 (Figure 6B
and E and supplemental Figure VI). Consistent with our
findings that phosphatidylinositol 3-kinase/Akt was not involved in activation of Nox1 expression to oxidized extracellular Eh (Figure 4F), wortmannin failed to prevent the
increase in ATF-1 or CREB phosphorylation (Figure 6C and
F and supplemental Figure VI). Taken together, these results
identify a signaling pathway by which oxidation of the
extracellular environment activates EGFR through
metalloproteinase-mediated shedding of EGF-like ligands,
leading to ERK1/2-dependent activation of the transcription
factor ATF-1 and subsequent expression of Nox1 (supplemental Figure VII).
Discussion
In humans, the redox state (Eh) of plasma Cys/CySS differs
considerably between individuals, ranging from approximately ⫺130 to ⫺20 mV, with a Cys/CySS redox potential
in young healthy individuals estimated at ⫺80 mV.38 A
more oxidized plasma Cys/CySS is associated with risk
factors for the development of vascular disease, including
increased age,19 cigarette smoking,20 and diabetes.17 In this
study, we describe a signaling pathway in vascular SMCs
by which oxidation of extracellular Cys/CySS activates
EGFR through metalloproteinase-mediated shedding of
EGF-like ligands, leading to ERK1/2-dependent activation
of the transcription factor ATF-1 and subsequent expression of
Nox1 NADPH oxidase. These findings establish a novel mechanism by which extracellular oxidative stress induces SMC
activation and proliferation in vascular disease (supplemental
Figure VII).
The Cys/CySS redox couple represents a nonradical redox
system involved in the regulation of cell function. In contrast
to the high flux electron transfer pathways of NADH and
NADPH, the thiols and disulfides are low flux. Plasma
disulfide CySS predicts adverse cardiovascular outcomes.
Among markers of oxidative stress, plasma CySS and a more
oxidized GSH/GSSG ratio correlated with intima-media
thickness.18 Plasma CySS and mixed disulfide levels were
inversely correlated with endothelium-dependent vasodilation in a healthy human population.21 In addition, oxidized
extracellular Eh Cys/CySS has been associated with nuclear
factor ␬B activation, monocyte binding to endothelial cells,39
and production of inflammatory cytokines in human plasma.22 Our study provides a potential cellular mechanism for
these findings by showing that an oxidized extracellular
Stanic et al
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
Figure 5. Oxidized extracellular Eh activates transcription factors
CREB and ATF-1; however, only ATF-1 contributes to the
increase in Nox1 expression. A, SMCs were treated with Eh⫽0
mV, and the nuclear fraction was subjected to Western blotting
for p-CREB and p-ATF-1. A representative blot of 3 independent experiments is shown. B and C, SMCs were transfected
with 50-nmol/L small interference RNA (siRNA) to ATF-1 (B) or
CREB (C) and exposed to Eh⫽0 mV for 24 hours. Nox1 mRNA
expression was measured by quantitative RT-PCR. Scrambled
siRNA served as a control. Data are presented as mean⫾SE
(n⫽5). *P⬍0.05 vs control and ⌬P⬍0.05 vs 0 mV control siRNA.
p- indicates phosphorylated form of the protein.
redox environment increases Nox1 expression, intracellular
ROS, and SMC growth.
Increased expression of NADPH oxidase is associated with
development of atherosclerosis12,13 and plaque instability in
human arteries.14 Several studies11,40 – 42 have implied Nox1 in
the pathogenesis of vascular disease. Nox1 expression and
vascular ROS are increased early after balloon injury of rat
Extracellular Redox and Nox1
2239
carotid artery and associated with neointimal hyperplasia.43
Nox1 has an important role in the migration and proliferation
of SMCs8,44 and deficiency of Nox1 reduced wire-induced
neointima formation by ⬎50%.30 In addition, overexpression
of Nox1 in SMCs augments angiotensin II–induced hypertension and hypertrophy,45 and ROS derived from Nox1
reduces bioavailability of NO.46 Thus, the ability of oxidized
extracellular Eh Cys/CySS to increase Nox1 expression in
SMCs has important clinical relevance in the pathophysiological features of vascular disease.
The effects of an oxidized extracellular environment on
NADPH oxidase appear to be cell type and subunit specific.
We found that oxidized extracellular Eh Cys/CySS increases
expression of Nox1 in SMCs while having no effect on the
expression of the Nox4 isoform. In addition, an oxidized
extracellular Eh failed to alter expression of Nox1 in human
embryonic kidney 293 and human gut epithelial carcinoma
cells, 2 distinctly different cell types, the first having low
levels of Nox1 and the second having relatively high levels of
Nox1. Although an oxidized Eh Cys/CySS increases proliferation of lung fibroblasts47 and SMCs (present study),
human colon carcinoma, human retinal pigment, and NIH
3T3 cells proliferate more rapidly in conditions of reduced
extracellular Eh Cys/CySS.24,48,49 The explanation for these
discordant growth responses among different cell types to
changes in extracellular redox potential is not known.
Several cell surface proteins are modified in response to
changes in extracellular Cys/CySS redox state by the oxidation of membrane thiols.39,49 The activation of intracellular
kinases and early mitogenic signaling events involve thiolmediated activation of cell surface proteins.50,51 It is proposed
that oxidation of critical Cys sulfhydryl motifs in the prodomain of metalloproteinases regulate the activity of the enzyme.34,52,53 Our data confirm the activation of metalloproteinases by an oxidized extracellular Eh Cys/CySS with
subsequent shedding of EGF-like ligands and phosphorylation of the EGFR. Interestingly, changes in extracellular
redox potential are sufficient to activate this mitogenic
pathway in the absence of growth factors. Changes in
extracellular Eh Cys/CySS are not accompanied by changes in
intracellular GSH/GSSG redox state and the extracellular
Cys/CySS redox state is not regulated by the cellular GSH
pool.24,48,54
Figure 6. ATF-1, but not CREB, is activated via the EGFR-ERK1/2 pathway in
response to oxidized extracellular Eh. A
through F, SMCs were pretreated with
10-␮mol/L AG1478 (A and D), 10-␮mol/L
U0126 (B and F), or 1-␮mol/L wortmannin (C and E) and stimulated with Eh⫽0
mV. Summary data of p-ATF-1 and
p-CREB expression analyzed by Western blotting are shown. Results are normalized to GAPDH expression and presented as mean⫾SE (n⫽3 to 5). *P⬍0.05
vs control and ⌬P⬍0.05 vs 0 mV vehicle.
2240
Arterioscler Thromb Vasc Biol
November 2010
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
Previous studies have shown that oxidized extracellular Eh
Cys/CySS increases intracellular ROS levels in endothelial
cells,39 monocytes,22 and mouse embryonic fibroblasts.49 In a
recent study,49 extracellular oxidizing conditions induced
mitochondria-derived ROS. We found that Nox1 was responsible for the observed increase in intracellular ROS after
exposure of SMCs to oxidized extracellular Eh Cys/CySS.
These observations are not incompatible and raise the possibility of ROS-induced ROS.
Oxidized extracellular Cys/CySS induced strong activation
of the ATF-CREB transcription factors; however, only
ATF-1 (not CREB) was necessary for the observed increase
in Nox1 expression. This finding is consistent with previous
reports37,55 showing that upregulation of Nox1 expression
was mediated by ATF-1. Transactivation of the EGFR and
subsequent activation of ERK1/2 are common events in
ATF-1 induction of Nox1 expression by multiple stimuli,
including prostaglandin F2␣,56 PDGF,57 and an oxidized
extracellular environment (present study). Despite the presence of both CREB-1 and ATF-1 in vascular SMCs, only
ATF-1 was found in the CRE-DNA complexes formed in
response to PDGF and thrombin.58 Similarly, although PDGF
and thrombin induced phosphorylation of both CREB and
ATF-1, CREB phosphorylation did not contribute to cell
growth.58 Instead, CREB was involved in SMC differentiation and is a negative regulator of SMC growth.59 CREregulated gene transcription is a complex process involving
CREB/ATF-1 binding to the CRE, CREB/ATF-1 phosphorylation, and interaction with coactivator proteins.59 The regulation of coactivators of CREB/ATF-1 is not well understood and may explain the distinct transcriptional
involvement of CREB and ATF-1 in SMCs.
In summary, our findings identify a signaling pathway in
vascular SMCs by which oxidation of the extracellular
environment activates EGFR through metalloproteinasemediated shedding of EGF-like ligands, leading to ERK1/2dependent activation of the transcription factor ATF-1 and
subsequent expression of Nox1. These data identify a novel
mechanism by which extracellular oxidative stress, through
oxidation of the Cys/CySS couple, can activate redoxsensitive pathways that stimulate NADPH oxidase expression
and vascular SMC proliferation.
Acknowledgments
We thank associates of the University of Iowa Roy J. and Lucille A.
Carver College of Medicine Central Microscopy Research Facility,
the Flow Cytometry Facility, and the Gene Transfer Vector Core
Facility of the University of Iowa Center for Gene Therapy of Cystic
Fibrosis and Other Genetic Diseases (supported by National Institutes of Health/National Institute of Diabetes and Digestive Kidney
Diseases P30 Grant No. DK 54759). Robin Davisson, PhD, Cornell
University, provided recombinant adenoviruses encoding small interference Nox1; Noriaki Mitsuda, PhD, Ehime University, provided
recombinant adenoviruses encoding a constitutively active form of
the MAPK kinase; and Chihiro Yabe-Nishimura, MD, PhD, Kyoto
Prefectural University of Medicine, provided Nox1 promoter–luciferase plasmids.
Sources of Funding
This study was based on work supported in part by the Office of
Research and Development, Department of Veterans Affairs (Dr
Miller); and by grant HL081750 from the National Institutes of
Health (Dr Miller).
Disclosures
None.
References
1. Stocker R, Keaney JF Jr. Role of oxidative modifications in atherosclerosis. Physiol Rev. 2004;84:1381–1478.
2. Lassègue B, Griendling KK. Reactive oxygen species in hypertension: an
update. Am J Hypertens. 2004;17:852– 860.
3. Murdoch CE, Grieve DJ, Cave AC, Looi YH, Shah AM. NADPH oxidase
and heart failure. Curr Opin Pharmacol. 2006;6:148 –153.
4. Thomas SR, Witting PK, Drummond GR. Redox control of endothelial
function and dysfunction: molecular mechanisms and therapeutic opportunities. Antioxid Redox Signal. 2008;10:1713–1765.
5. Cai H, Griendling KK, Harrison DG. The vascular NAD(P)H oxidases as
therapeutic targets in cardiovascular diseases. Trends Pharmacol Sci.
2003;24:471– 478.
6. Sorescu D, Griendling KK. Reactive oxygen species, mitochondria, and
NAD (P) H oxidases in the development and progression of heart failure.
Cong Heart Fail. 2002;8:132–140.
7. Paravicini TM, Touyz RM. Redox signaling in hypertension. Cardiovasc
Res. 2006;71:247–258.
8. Lassegue B, Clempus RE. Vascular NAD(P)H oxidases: specific features,
expression, and regulation. Am J Physiol Regul Integr Comp Physiol.
2003;285:R277–R297.
9. Brandes RP, Schröder K. Composition and functions of vascular nicotinamide adenine dinucleotide phosphate oxidases. Trends Cardiovasc
Med. 2008;18:15–19.
10. Lyle AN, Griendling KK. Modulation of vascular smooth muscle signaling by reactive oxygen species. Physiology (Bethesda). 2006;21:
269 –280.
11. Bedard K, Krause KH. The NOX family of ROS-generating NADPH
oxidases: physiology and pathophysiology. Physiol Rev. 2007;87:
245–313.
12. Sorescu D, Weiss D, Lassegue B, Clempus RE, Szocs K, Sorescu GP,
Valppu L, Quinn MT, Lambeth JD, Vega JD, Taylor WR, Griendling KK.
Superoxide production and expression of nox family proteins in human
atherosclerosis. Circulation. 2002;105:1429 –1435.
13. Guzik TJ, Sadowski J, Guzik B, Jopek A, Kapelak B, Przybylowski P,
Wierzbicki K, Korbut R, Harrison DG, Channon KM. Coronary artery
superoxide production and nox isoform expression in human coronary
artery disease. Arterioscler Thromb Vasc Biol. 2006;26:333–339.
14. Azumi H, Inoue N, Ohashi Y, Terashima M, Mori T, Fujita H, Awano K,
Kobayashi K, Maeda K, Hata K, Shinke T, Kobayashi S, Hirata K,
Kawashima S, Itabe H, Hayashi Y, Imajoh-Ohmi S, Itoh H, Yokoyama
M. Superoxide generation in directional coronary atherectomy specimens
of patients with angina pectoris: important role of NAD(P)H oxidase.
Arterioscler Thromb Vasc Biol. 2002;22:1838 –1844.
15. Jones DP. Redox potential of GSH/GSSG couple: assay and biological
significance. Methods Enzymol. 2002;348:93–112.
16. Kirlin WG, Cai J, Thompson SA, Diaz D, Kavanagh TJ, Jones DP.
Glutathione redox potential in response to differentiation and enzyme
inducers. Free Radic Biol Med. 1999;27:1208 –1218.
17. Samiec PS, Drews-Botsch C, Flagg EW, Kurtz JC, Sternberg P Jr, Reed
RL, Jones DP. Glutathione in human plasma: decline in association with
aging, age-related macular degeneration, and diabetes. Free Radic Biol
Med. 1998;24:699 –704.
18. Ashfaq S, Abramson JL, Jones DP, Rhodes SD, Weintraub WS, Hooper
WC, Vaccarino V, Harrison DG, Quyyumi AA. The relationship between
plasma levels of oxidized and reduced thiols and early atherosclerosis in
healthy adults. J Am Coll Cardiol. 2006;47:1005–1011.
19. Jones DP, Mody VC Jr, Carlson JL, Lynn MJ, Sternberg P Jr. Redox
analysis of human plasma allows separation of pro-oxidant events of
aging from decline in antioxidant defenses. Free Radic Biol Med. 2002;
33:1290 –1300.
20. Moriarty SE, Shah JH, Lynn M, Jiang S, Openo K, Jones DP, Sternberg
P. Oxidation of glutathione and cysteine in human plasma associated with
smoking. Free Radic Biol Med. 2003;35:1582–1588.
21. Ashfaq S, Abramson JL, Jones DP, Rhodes SD, Weintraub WS, Hooper
WC, Vaccarino V, Alexander RW, Harrison DG, Quyyumi AA. Endothelial function and aminothiol biomarkers of oxidative stress in healthy
adults. Hypertension. 2008;52:80 – 85.
Stanic et al
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
22. Iyer SS, Accardi CJ, Ziegler TR, Blanco RA, Ritzenthaler JD, Rojas M,
Roman J, Jones DP. Cysteine redox potential determines proinflammatory IL-1beta levels. PLoS One. 2009;4:e5017.
23. Miller FJ Jr, Gutterman DD, Rios CD, Heistad DD, Davidson BL.
Superoxide production in vascular smooth muscle contributes to oxidative stress and impaired relaxation in atherosclerosis. Circ Res. 1998;
82:1298 –1305.
24. Jonas CR, Ziegler TR, Gu LH, Jones DP. Extracellular thiol/disulfide
redox state affects proliferation rate in a human colon carcinoma (Caco2)
cell line. Free Radic Biol Med. 2002;33:1499 –1506.
25. Miller FJ Jr, Chu X, Stanic B, Tian X, Sharma RV, Davisson RL, Lamb
FS. A differential role for endocytosis in receptor-mediated activation of
Nox1. Antioxid Redox Signal. 2010;12:583–593.
26. Mitsuda N, Ohkubo N, Tamatani M, Lee Y-D, Taniguchi M, Namikawa
K, Kiyama H, Yamaguchi A, Sato N, Sakata K, Ogihara T, Vitek MP,
Tohyama M. Activated cAMP-response element-binding protein regulates neuronal expression of presenilin-1. J Biol Chem. 2001;276:
9688 –9698.
27. Arakawa N, Katsuyama M, Matsuno K, Urao N, Tabuchi Y, Okigaki M,
Matsubara H, Yabe-Nishimura C. Novel transcripts of Nox1 are regulated
by alternative promoters and expressed under phenotypic modulation of
vascular smooth muscle cells. Biochem J. 2006;398:303–310.
28. Suh YA, Arnold RS, Lassegue B, Shi J, Xu X, Sorescu D, Chung AB,
Griendling KK, Lambeth JD. Cell transformation by the superoxidegenerating oxidase Mox1. Nature. 1999;401:79 – 82.
29. Arnold RS, He J, Remo A, Ritsick D, Yin-Goen Q, Lambeth JD, Datta
MW, Young AN, Petros JA. Nox1 expression determines cellular reactive
oxygen and modulates c-fos-induced growth factor, interleukin-8, and
Cav-1. Am J Pathol. 2007;171:2021.
30. Lee MY, Martin AS, Mehta PK, Dikalova AE, Garrido AM, Datla SR,
Lyons E, Krause K-H, Banfi B, Lambeth JD, Lassegue B, Griendling KK.
Mechanisms of vascular smooth muscle NADPH oxidase 1 (Nox1) contribution to injury-induced neointimal formation. Arterioscler Thromb
Vasc Biol. 2009;29:480 – 487.
31. Prenzel N, Fischer OM, Streit S, Hart S, Ullrich A. The epidermal growth
factor receptor family as a central element for cellular signal transduction
and diversification. Endocr Relat Cancer. 2001;8:11–31.
32. Kalmes A, Daum G, Clowes AW. EGFR transactivation in the regulation
of SMC function. Ann N Y Acad Sci. 2001;947:42–55.
33. Ohtsu H, Dempsey PJ, Eguchi S. ADAMs as mediators of EGF receptor
transactivation by G protein-coupled receptors. Am J Physiol Cell
Physiol. 2006;291:C1–C10.
34. Van Wart HE, Birkedal-Hansen H. The cysteine switch: a principle of
regulation of metalloproteinase activity with potential applicability to the
entire matrix metalloproteinase gene family. Proc Natl Acad Sci U S A.
1990;87:5578 –5582.
35. Nkabyo YS, Go YM, Ziegler TR, Jones DP. Extracellular cysteine/
cystine redox regulates the p44/p42 MAPK pathway by
metalloproteinase-dependent epidermal growth factor receptor signaling.
Am J Physiol Gastrointest Liver Physiol. 2005;289:G70 –G78.
36. Kayanoki Y, Higashiyama S, Suzuki K, Asahi M, Kawata S, Matsuzawa
Y, Taniguchi N. The requirement of both intracellular reactive oxygen
species and intracellular calcium elevation for the induction of heparinbinding EGF-like growth factor in vascular endothelial cells and smooth
muscle cells. Biochem Biophys Res Commun. 1999;259:50 –55.
37. Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miyagishi M, Taira K,
Yabe-Nishimura C. Essential role of ATF-1 in induction of NOX1, a
catalytic subunit of NADPH oxidase: involvement of mitochondrial respiratory chain. Biochem J. 2005;386:255–261.
38. Jones DP, Carlson JL, Mody VC, Cai J, Lynn MJ, Sternberg P. Redox
state of glutathione in human plasma. Free Radic Biol Med. 2000;28:
625– 635.
39. Go YM, Jones DP. Intracellular proatherogenic events and cell adhesion
modulated by extracellular thiol/disulfide redox state. Circulation. 2005;
111:2973–2980.
40. Sedeek M, Hebert RL, Kennedy CR, Burns KD, Touyz RM. Molecular
mechanisms of hypertension: role of Nox family NADPH oxidases. Curr
Opin Nephrol Hypertens. 2009;18:122–127.
Extracellular Redox and Nox1
2241
41. Cave AC, Brewer AC, Narayanapanicker A, Ray R, Grieve DJ, Walker S,
Shah AM. NADPH oxidases in cardiovascular health and disease.
Antioxid Redox Signal. 2006;8:691–728.
42. Lee MY, Griendling KK. Redox signaling, vascular function, and hypertension. Antioxid Redox Signal. 2008;10:1045–1059.
43. Szocs K, Lassegue B, Sorescu D, Hilenski LL, Valppu L, Couse TL,
Wilcox JN, Quinn MT, Lambeth JD, Griendling KK. Upregulation of
Nox-based NAD(P)H oxidases in restenosis after carotid injury. Arterioscler Thromb Vasc Biol. 2002;22:21–27.
44. Schroder K, Helmcke I, Palfi K, Krause KH, Busse R, Brandes RP. Nox1
mediates basic fibroblast growth factor-induced migration of vascular
smooth muscle cells. Arterioscler Thromb Vasc Biol. 2007;27:1736.
45. Dikalova A, Clempus R, Lassegue B, Cheng G, McCoy J, Dikalov S, San
Martin A, Lyle A, Weber DS, Weiss D, Taylor WR, Schmidt HH, Owens
GK, Lambeth JD, Griendling KK. Nox1 overexpression potentiates angiotensin II-induced hypertension and vascular smooth muscle hypertrophy in transgenic mice. Circulation. 2005;112:2668 –2676.
46. Tong X, Schröder K. NADPH oxidases are responsible for the failure of
nitric oxide to inhibit migration of smooth muscle cells exposed to high
glucose. Free Radic Biol Med. 2009;47:1578 –1583.
47. Ramirez A, Ramadan B, Ritzenthaler JD, Rivera HN, Jones DP, Roman
J. Extracellular cysteine/cystine redox potential controls lung fibroblast
proliferation and matrix expression through upregulation of transforming
growth factor-beta. Am J Physiol Lung Cell Mol Physiol. 2007;293:
L972–L981.
48. Jiang S, Moriarty-Craige SE, Orr M, Cai J, Sternberg P Jr, Jones DP.
Oxidant-induced apoptosis in human retinal pigment epithelial cells:
dependence on extracellular redox state. Invest Ophthalmol Vis Sci. 2005;
46:1054 –1061.
49. Imhoff BR, Hansen JM. Extracellular redox status regulates Nrf2 activation through mitochondrial reactive oxygen species. Biochem J. 2009;
424:491–500.
50. Clark S, Konstantopoulos N. Sulphydryl agents modulate insulin- and
epidermal growth factor (EGF)-receptor kinase via reaction with intracellular receptor domains: differential effects on basal versus activated
receptors. Biochem J. 1993;292(pt 1):217–223.
51. Kamata H, Shibukawa Y, Oka SI, Hirata H. Epidermal growth factor
receptor is modulated by redox through multiple mechanisms: effects of
reductants and H2O2. Eur J Biochem. 2000;267:1933–1944.
52. Wang Y, Herrera AH, Li Y, Belani KK, Walcheck B. Regulation of
mature ADAM17 by redox agents for L-selectin shedding. J Immunol.
2009;182:2449 –2457.
53. Li X, Fan H. Loss of ectodomain shedding due to mutations in the
metalloprotease and cysteine-rich/disintegrin domains of the tumor
necrosis factor-alpha converting enzyme (TACE). J Biol Chem. 2004;
279:27365–27375.
54. Anderson CL, Iyer SS, Ziegler TR, Jones DP. Control of extracellular
cysteine/cystine redox state by HT-29 cells is independent of cellular
glutathione. Am J Physiol Regul Integr Comp Physiol. 2007;293:
R1069 –R1075.
55. Katsuyama M, Ozgur Cevik M, Arakawa N, Kakehi T, Nishinaka T,
Iwata K, Ibi M, Matsuno K, Yabe-Nishimura C. Myocyte enhancer factor
2B is involved in the inducible expression of NOX1/NADPH oxidase, a
vascular superoxide-producing enzyme. FEBS J. 2007;274:5128 –5136.
56. Fan C, Katsuyama M, Nishinaka T, Yabe-Nishimura C. Transactivation
of the EGF receptor and a PI3 kinase-ATF-1 pathway is involved in the
upregulation of NOX1, a catalytic subunit of NADPH oxidase. FEBS
Lett. 2005;579:1301–1305.
57. Fan CY, Katsuyama M, Yabe-Nishimura C. PKCdelta mediates
up-regulation of NOX1, a catalytic subunit of NADPH oxidase, via
transactivation of the EGF receptor: possible involvement of PKCdelta in
vascular hypertrophy. Biochem J. 2005;390:761–767.
58. Ghosh SK, Gadiparthi L, Zeng ZZ, Bhanoori M, Tellez C, Bar-Eli M, Rao
GN. ATF-1 mediates protease-activated receptor-1 but not receptor
tyrosine kinase-induced DNA synthesis in vascular smooth muscle cells.
J Biol Chem. 2002;277:21325–21331.
59. Klemm DJ, Watson PA, Frid MG, Dempsey EC, Schaack J, Colton LA,
Nesterova A, Stenmark KR, Reusch JEB. cAMP response elementbinding protein content is a molecular determinant of smooth muscle cell
proliferation and migration. J Biol Chem. 2001;276:46132– 46141.
Downloaded from http://atvb.ahajournals.org/ by guest on July 31, 2017
An Oxidized Extracellular Oxidation-Reduction State Increases Nox1 Expression and
Proliferation in Vascular Smooth Muscle Cells Via Epidermal Growth Factor Receptor
Activation
Bojana Stanic, Masato Katsuyama and Francis J. Miller, Jr
Arterioscler Thromb Vasc Biol. 2010;30:2234-2241; originally published online September 2,
2010;
doi: 10.1161/ATVBAHA.110.207639
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2010 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/30/11/2234
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2010/09/02/ATVBAHA.110.207639.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Stanic B ATVB/2010/207639 R1
Supplement Material
Chemicals and Antibodies. Fetal bovine serum (FBS), Dulbecco’s Modified Eagle’s Medium
(DMEM), penicillin-streptomycin mixture, L-glutamine, trypsin/EDTA and HEPES buffer
solution were purchased from Gibco BRL (Grand Island, NY). [Methyl-3H] thymidine (1.0
mCi/ml) was from PerkinElmer Life and Analytical Sciences (Boston, MA). Complete protease
inhibitor cocktail was obtained from Roche Applied Science (Indianapolis, IN). BD Matrigel
Matrix was purchased from BD Biosciences (Bedford, MA). Anti-phospho-EGFR antibody
(pY1068) was purchased from BioSource (Camarillo, CA). Antibodies to EGFR, phospho-Akt
(pS473), phospho-CREB (pS133, reactive with phosphorylated forms of CREB and ATF-1), and
MEK1/2 were from Cell Signaling Technology (Danvers, MA). Anti-GAPDH antibody was
purchased from Chemicon International (Temecula, CA). Anti-Nox1, anti-phospho-ERK1/2
(pT202/pY204), anti-ERK1/2, anti-phospho-p38 (pY182), and anti-phospho-JNK (pT183/pY185)
antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Secondary
horseradish peroxidase-conjugated goat anti-mouse, rabbit anti-goat, and goat anti-rabbit
antibodies were from Bio-Rad Laboratories (Hercules, CA). Bio-Rad DC Protein Assay kit was
used for protein measurement. Enhanced chemiluminescence (ECL) western blotting detection
reagents were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). Except for
wortmannin (Sigma-Aldrich; St. Louis, MO), all other pharmacologic inhibitors were obtained
from Calbiochem (San Diego, CA). TRIzol Reagent and SuperScript II Reverse Transcriptase
kit were from Invitrogen (Carlsbad, CA). DNA-free kit was purchased from Ambion (Austin,
TX), whereas PCR Nucleotide Mix was obtained from Roche Applied Science (Indianapolis,
IN). Dihydroethidium (DHE) and 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein
1
Stanic B ATVB/2010/207639 R1
diacetate, acetyl ester (CM-H2DCFDA) were from Molecular Probes (Eugene, OR), whereas
Vectashield H-1000 mounting medium was from Vector Laboratories (Burlingame, CA).
Fluorogenic peptide substrates were purchased from R&D Systems (Minneapolis, MN), whereas
Centricon Ultracel YM-10 filter tubes were obtained from Millipore Corporation (Billerica,
MA). The Dual Luciferase Assay Kit was from Promega (Madison, WI). All other chemicals
were purchased from Sigma-Aldrich (St. Louis, MO).
Animals and Cells. Mice were housed in an AALAC accredited University Animal Care
Facility and all procedures were approved by the Institutional Animal Care and Use Committee
at University of Iowa and complied with the standards stated in the Guide for the Care and Use
of Laboratory Animals. Thoracic aortae were removed from 12 week old C57BL/6 mice and
transferred to cold cyst(e)ine-free DMEM containing 0.2% (v/v) FBS, 4 mM glutamine, 10 U/ml
penicillin, and 10 g/ml streptomycin. The loosely adhering fibroadipose tissue was removed
and aorta cut into 1 mm long rings. Vessel segments were placed in redox media (-150 or 0 mV;
see below) at 37ºC and the media replaced after 12 hours. After 24 hours of incubation with the
redox media, some aortic segments were prepared for isolation of total mRNA for real time PCR
while others for aortic outgrowth experiments (see below).
Medial smooth muscle cells (SMCs) were cultured from thoracic aorta of C57BL/6 mice by
enzymatic digestion, as described previously 1. Cells were cultured in DMEM supplemented
with 10% (v/v) fetal bovine serum (FBS), 10 U/ml penicillin, 10 g/ml streptomycin, 4 mM
glutamine, and 20 mM HEPES, at 37ºC and 5% CO2. SMCs were confirmed positive by -actin
2
Stanic B ATVB/2010/207639 R1
staining at second passage. All experiments were conducted using SMCs between passages 6
and 11 and 60-90% confluence.
Preparation of Redox Media. The range of extracellular thiol/disulfide redox states (from -150
to 0 mV) was generated by varying concentrations of cysteine (Cys) and cystine (CySS) added to
cyst(e)ine-free DMEM (Sigma-Aldrich; St. Louis, MO) containing 0.2% (v/v) FBS, 4 mM
glutamine, 10 U/ml penicillin, and 10 g/ml streptomycin, as described previously 2.
Essentially, concentrations of Cys and CySS were calculated using the Nernst equation:
Eh=Eo+RT/2F ln([CySS]/[Cys]2), where Eh represents the electromotive force relative to a
standard hydrogen electrode, R is the gas constant, T is the absolute temperature, F is Faraday’s
constant, and Eo is the standard electrode potential (−250 mV at pH 7.4) for the Cys/CySS redox
couple. The total concentration in cysteine moieties was kept constant, i.e. [Cys] + 2 x [CySS] =
200 M. Medium pH was adjusted to 7.4 following Cys and CySS addition, and medium was
filter-sterilized prior to use. The redox medium was prepared fresh every day and changed every
10-12 h after addition to cells or aortic segments.
Adenoviral-mediated Gene Delivery. Recombinant adenoviruses encoding siNox1 3 (AdsiNox1, a gift from Dr. Robin Davisson, Cornell University) and constitutively active form of the
mitogen-activated protein kinase kinases (Ad-caMEK 4, a gift from Dr. Noriaki Mitsuda, Ehime
University, Japan) were used. Ad-empty or Ad-siGFP were used as controls. Adenovirus was
mixed with the cationic polymer poly-L-lysine (250 molecules/virus particle) 5 and added to
SMCs (approximately 70% confluence) in serum free-DMEM. After 6 h, media were replaced
3
Stanic B ATVB/2010/207639 R1
with DMEM containing 10% FBS, and after an additional 24-48 h exposed to varying Eh
Cys/CySS redox conditions per experimental protocol.
Real-time PCR Analysis. Detection of mRNA for Nox1 and Nox4 was performed using
quantitaive real-time PCR (qRT-PCR). Smooth muscle cells were plated on 100-mm dishes and
cultured for 24 h in normal growth medium (at approximately 70% confluence), then serumdeprived (0.2% FBS) for another 24 h before culture under varying Eh Cys/CySS redox
conditions. Three mm thick aortic segments were incubated in different Eh Cys/CySS redox
conditions for 24 h prior to RNA isolation. Total RNA from cells and tissues was isolated with
TRIzol reagent (Invitrogen, Carlsbad, CA) and chloroform followed by isopropanol
precipitation. Contaminating genomic DNA was removed with DNA-free reagent (Ambion,
Austin, TX). The reverse transcription reaction of the extracted RNA was performed by using
the SuperScript II Reverse Transcriptase kit from Invitrogen. Five microliters of cDNA from
first-strand reaction were used for qRT-PCR reaction, containing Power SYBR Green PCR
Master Mix (Applied Biosystems, Foster City, CA) and 0.1 M forward and reverse primers in a
total volume of 25 l. ROX was used as an internal reference dye. Primers were designed using
Primer Express Software and synthesized by Integrated DNA Technologies (Coralville, IA). The
following primers were used: Nox1 forward primer (TGGCATCCCTTCACTCTGACT), reverse
primer (AGTCCCCTGCTGCTCGAATA); Nox4 forward primer
(GTTGGGCCTAGGATTGTGTTTAA), reverse primer (AAAGGATGAGGCTGCAGTTGA).
Samples were run on ABI PRISM 7000 Sequence Detection System (Applied Biosystems) using
the following cycle program: 50°C for 2 min, denaturation at 95°C for 10 min, followed by 40
cycles at temperatures of 95°C for 15 s and 60°C for 1 min. Results were quantitated using the
4
Stanic B ATVB/2010/207639 R1
comparative cycle threshold (Ct) method6. Ribosomal 18S mRNA was measured in the same
samples (forward, CGCAGCTAGGAATAATGGAATAGG; reverse
CATGGCCTCAGTTCCGAAA) and used to correct for variations in RNA content among
samples.
Measurement of Intracellular ROS. Intracellular ROS levels were detected in SMCs with
dihydroethidium (DHE) or 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate,
acetyl ester (CM-H2DCFDA). In experiments studying the effects of prolonged exposure to
different extracellular redox conditions on ROS production, SMCs grown on chamber slides
were infected with adenoviruses as described above, then serum-deprived (0.2% FBS) for 24 h
before stimulation with different Eh Cys/CySS redox conditions for 48 h. On the day of study,
cells were rinsed with PBS, treated with DHE (10 µM) for 1 h at 37° C, then rinsed with PBS
before mounting the slides in Vectashield H-1000 mounting medium (Vector Laboratories;
Burlingame, CA). DHE fluorescence intensity was visualized with Zeiss LSM 510 META laser
confocal microscope as described 7. In each experiment, 7 to 8 randomly picked fields per
sample (with 29-54 cells in each field) were visualized and captured. The resulting fluorescence
was quantitated using NIH ImageJ software and expressed as relative fluorescence intensity per
cell. ROS production after an acute exposure to different extracellular redox conditions was
measured by CM-H2DCFDA fluorescence. Medial SMCs were cultured on six-well plates for 24
h in normal growth medium at approximately 80% confluence, then serum-deprived (0.2% FBS)
for another 24 h before loading with 20 M CM-H2DCFDA for 45 min. Cells were stimulated
with different Eh Cys/CySS redox conditions for 45 min, then rinsed with PBS, collected by
trypsinization, centrifuged at 400 g for 5 min at 4°C, resuspended in ice-cold PBS, filtered, and
5
Stanic B ATVB/2010/207639 R1
kept on ice in the dark for immediate analysis. Flow cytometric data were collected on a Becton
Dickinson FACScan (BD Biosciences, San Jose, CA) flow cytometer and analyzed with the
FlowJo software package (Tree Star, Inc., Ashland, OR).
[methyl-3H]-Thymidine Incorporation Assay. SMCs were incubated in serum-deprived
medium (0.2% FBS) for 24 h before culture under different Eh Cys/CySS redox conditions for 48
h, with 0.05 µCi/ml of [methyl-3H]-thymidine added for the final 4 h. Afterward, the medium
was removed, and the cells were washed with PBS, incubated with ice-cold trichloroacetic acid,
washed again with PBS, and finally solubilized in NaOH. An aliquot of neutralized cell extract
was counted in a Beckman Coulter LS6500 liquid scintillation counter.
Aortic Outgrowth Assay.
After 24 hours in -150Mv or 0 mV Eh Cys/CySS redox conditions,
aortic sections were embedded in 48-well plates coated with Matrigel Matrix (BD Biosciences)
and incubated at 37°C in normal growth medium for 72 h. Images were captured by light
microscopy at 4x magnification and the outgrowth area was analyzed using NIH ImageJ
software.
Western Blot Analysis. DNA binding proteins8 or whole cell lysates3 were resolved on SDSpolyacrylamide gels and transferred to polyvinylidene difluoride membranes. The blots were
first incubated overnight at 4ºC with a specific primary antibody followed by 1 hour incubation
with an appropriate horseradish peroxidase (HRP)-conjugated secondary antibody. Specific
immunoreactive signals were detected using the enhanced chemiluminescence kit (ECL).
Images were captured digitally and quantitated by densitometric analysis using NIH ImageJ
6
Stanic B ATVB/2010/207639 R1
software. To obtain loading controls, the same membranes were stripped and then incubated
overnight at 4ºC with a primary antibody. Finally, the membranes were incubated with a HRPconjugated secondary antibody for 1 hour and immune complexes were visualized using the
Amersham ECL system. Results were expressed as the ratio of phosphorylated form of the
protein to the appropriate loading control.
Gene Silencing of CREB and ATF-1. The 21-nt anti-CREB and anti-ATF-1 double-stranded
small interference (si)RNAs were designed against nucleotides 663-683 of the mouse CREB
mRNA sequence, transcript variant A (Accession number NM_133828) and against nucleotides
314-334 of the mouse ATF-1 mRNA sequence (Accession number NM_007497), respectively.
Sense and antisense oligonucleotide sequences and their scrambled controls were designed using
BLOCK-iT RNAi Designer and synthesized by the same company (Invitrogen). A complete list
of siRNAs and their sequences is given in Table 1. Medial smooth muscle cells were plated on
100-mm dishes and cultured for 24 h in normal growth medium (at approximately 60%
confluence). siRNAs were introduced into SMCs in a final concentration of 50 nM using
Lipofectamine RNAiMAX reagent and OPTI-MEM I reduced serum medium, according to the
manufacturer’s recommendations. After 5 h of incubation, transfection mixture was replaced
with a normal growth medium for 24 h, cells were then serum-deprived (0.2% FBS) for another
24 h and used either for Western blotting or RT-PCR analysis.
Table 1. Sense and antisense siRNA sequences.
Description
Sequence
CREB siRNA - sense
5’-GCCCAGCAACCAAGUUGUUTT-3’
7
Stanic B ATVB/2010/207639 R1
CREB siRNA - antisense
5’-AACAACUUGGUUGCUGGGCTT-3’
Scrambled CREB siRNA - sense
5’-GCCAACGAACCUUGACGUUTT-3’
Scrambled CREB siRNA - antisense
5’-AACGUCAAGGUUCGUUGGCTT-3’
ATF-1 siRNA - sense
5’-GCGGACAGUACAUUGCCAUTT-3’
ATF-1 siRNA - antisense
5’-AUGGCAAUGUACUGUCCGCTT-3’
Scrambled ATF-1 siRNA - sense
5’-GCGUGACUACACGUAGCAUTT-3’
Scrambled ATF-1 siRNA - antisense
5’-AUGCUACGUGUAGUCACGCTT-3’
Metalloproteinase Activity. Two fluorogenic peptide substrates from R&D Systems
(Minneapolis, MN), Substrate III and IX, were used to measure metalloproteinase activity.
These peptide substrates contain a highly fluorescent 7-methoxycoumarin group (Mca) that is
efficiently quenched by resonance energy transfer to the 2,4-dinitrophenyl group (Dpa). They
can be used to measure the activities of peptidases that are capable of cleaving an amide bond
between the fluorescent group and the quencher group, causing an increase in fluorescence.
Substrate III (Mca-P-L-A-Q-A-V-Dpa-R-S-S-S-R-NH2) is a substrate for tumor necrosis factor converting enzyme (TACE or ADAM17) and related enzymes such as ADAM9 and
ADAM10. Substrate IX (Mca-K-P-L-G-L-Dpa-A-R-NH2) is a substrate for all matrix
metalloproteinases (MMPs) 9. Medial smooth muscle cells were plated on six-well plates and
cultured for 24 h in normal growth medium (at approximately 80% confluence), then serumdeprived (0.2% FBS) for another 24 h before stimulation with Eh Cys/CySS redox medium.
Prior to treatment, fluorogenic substrates were added to the control or Eh=0 mV medium in the
final concentration of 10 M and SMCs were then incubated for various amount of time. At the
end of each incubation period, the media were collected and the fluorescence was measured
8
Stanic B ATVB/2010/207639 R1
using SpectraMax M2 fluorescence plate reader (Molecular Devices, Sunnyvale, CA), with the
following settings: excitation wavelength 320 nm, emission wavelength 405 nm. An appropriate
blank (without fluorogenic substrate) was subtracted from each measurement and the results
were expressed as the fold difference over control values and normalized to cell number.
Gelatin Zymography. Latent and activated forms of MMP-2 and MMP-9 were detected using
SDS-PAGE gelatin zymography, as described previously 10. Medial smooth muscle cells were
cultured on six-well plates for 24 h in normal growth medium at approximately 80% confluence,
then serum-deprived (0.2% FBS) for another 24 h before stimulation with Eh Cys/CySS redox
medium for different periods of time. After treatment, the conditioned media were collected and
centrifuged at 13,000 g for 5 min at 4°C to remove cell debris. The samples were then
concentrated using Millipore Centricon tubes, according to the manufacturer’s recommendation.
Concentrated samples were mixed with non-reducing sample buffer and electrophoretically
separated on 10% Bio-Rad Ready Gel zymogram gels containing 1 mg/ml gelatin. Following
electrophoresis, gels were soaked in NOVEX Zymogram renaturing buffer (Invitrogen, Carlsbad,
CA) for 1 h at room temperature to remove SDS, and then incubated in NOVEX Zymogram
developing buffer at 37°C for 48 h, to allow enough time for the metalloproteinases to digest
gelatin. Sample bands with proteolytic activity were visualized after staining with Coomassie
Brilliant Blue (CBB) R-250 (0.25% CBB R-250 in 40% methanol and 10% acetic acid) as clear
bands against a dark blue background. After gel staining, MMP-2 and MMP-9 were identified
based on gelatin lysis at molecular masses of 62 kDa for MMP-2 and 84 kDa for MMP-9,
whereas pro-MMP-2 and pro-MMP-9 were identified at 72 kDa and 92 kDa, respectively. Gel
images were obtained using a digital imaging system from Eastman Kodak (Rochester, NY).
9
Stanic B ATVB/2010/207639 R1
Luciferase Assay for Promoter Activity. pGL3-basic (empty vector) or Nox1 promoterluciferase plasmids (gift from Dr. Chihiro Yabe-Nishimura, Kyoto Prefectural University of
Medicine, Japan) 11 were co-transfected into SMCs with pSV40-Renilla control vectors.
Medial smooth muscle cells were plated on twelve-well plates and cultured for 24 h in normal
growth medium (at approximately 70% confluence). Next, pGL3-basic (empty vector) or Nox1
promoter-luciferase plasmids were co-transfected into SMCs (750 ng/well) with pSV40-Renilla
control vectors (5 ng/well) using Lipofectamine LTX and PLUS Reagent (Invitrogen) in OPTIMEM I reduced serum medium. pSV40-Renilla plasmid served as a control for transfection.
After 4 h of transfection, SMCs were cultured for 24 h in a normal growth medium then serumdeprived (0.2% FBS) for another 24 h before incubation with various Eh Cys/CySS redox
medium. After treatment for 8 h, cells were lysed and luciferase activity measured with the
Dual-Luciferase Reporter Assay System (Promega, Madison, WI). Results were expressed as a
ratio between the firefly and Renilla luciferase.
Statistical Analysis. Results are expressed as mean ± SEM. Statistical comparisons were
performed by Student’s two-tailed t-test or one-way analysis of variance (ANOVA) followed by
Dunnett’s or Tukey’s multiple comparison post-tests, where appropriate. A value of p < 0.05
was considered significant.
10
Stanic B ATVB/2010/207639 R1
References
1.
Miller FJ, Jr., Gutterman DD, Rios CD, Heistad DD, Davidson BL. Superoxide
production in vascular smooth muscle contributes to oxidative stress and impaired
relaxation in atherosclerosis. Circ Res. 1998;82:1298-1305.
2.
Jonas CR, Ziegler TR, Gu LH, Jones DP. Extracellular thiol/disulfide redox state affects
proliferation rate in a human colon carcinoma (Caco2) cell line. Free Radic Biol Med.
2002;33:1499-1506.
3.
Miller Jr FJ, Chu X, Stanic B, Tian X, Sharma RV, Davisson RL, Lamb FS. A
Differential Role for Endocytosis in Receptor-mediated Activation of Nox1. Antioxid
Redox Signal. 2010;12:583-593.
4.
Mitsuda N, Ohkubo N, Tamatani M, Lee Y-D, Taniguchi M, Namikawa K, Kiyama H,
Yamaguchi A, Sato N, Sakata K, Ogihara T, Vitek MP, Tohyama M. Activated cAMPresponse Element-binding Protein Regulates Neuronal Expression of Presenilin-1.
Journal of Biological Chemistry. 2001;276:9688-9698.
5.
Fasbender A, Zabner J, Chillon M, Moninger TO, Puga AP, Davidson BL, Welsh MJ.
Complexes of adenovirus with polycationic polymers and cationic lipids increase the
efficiency of gene transfer in vitro and in vivo Journal of Biological Chemistry.
1997;272:6479-6489.
6.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408.
7.
Chamseddine AH, Miller FJ, Jr. gp91phox Contributes to NADPH oxidase activity in
aortic fibroblasts but not smooth muscle cells. Heart and Circulatory Physiology.
2003;285:H2284-H2289.
8.
Andrews NC, Faller DV. A rapid micropreparation technique for extraction of DNAbinding proteins from limiting numbers of mammalian cells. Nucleic Acids Res.
1991;19:2499.
9.
Visse R, Nagase H. Matrix Metalloproteinases and Tissue Inhibitors of
Metalloproteinases: Structure, Function, and Biochemistry. Circ Res. 2003;92:827-839.
10.
Asanuma K, Magid R, Johnson C, Nerem RM, Galis ZS. Uniaxial strain upregulates
matrix-degrading enzymes produced by human vascular smooth muscle cells. Am J
Physiol Heart Circ Physiol. 2003;284:H1778-1784.
11
Stanic B ATVB/2010/207639 R1
11.
Arakawa N, Katsuyama M, Matsuno K, Urao N, Tabuchi Y, Okigaki M, Matsubara H,
Yabe-Nishimura C. Novel transcripts of Nox1 are regulated by alternative promoters and
expressed under phenotypic modulation of vascular smooth muscle cells. Biochem J.
2006;398:303-310.
12
Stanic B ATVB/2010/207639 R1
Supplemental Figures
A
B
Ad-siGFP
Relative Nox1 protein
expression
200
Ad-siNox1
Nox1
GAPDH
Eh -
0
-
0
Ad-siGFP
Ad-siNox1
150
*

100
50
0
*
200
*
100
0 mV
300
Relative Nox4 mRNA
expression
300
Relative Nox1 mRNA
expression
-150 mV
D
C
200
100
0
0
-150 -131 -109
-80
-46
-150 -131 -109
0
Relative Nox1 mRNA
expression
-46
0
Eh (mV)
Eh (mV)
E
-80
600
Control
0 mV
*
400
200
0
VSMC
HEK 293
Caco2
Supplemental Figure I. Oxidized extracellular Eh increases Nox1 expression in vascular SMCs,
but not in HEK 293 and Caco2 cells. Cells were exposed to varying concentrations of Cys and
CySS to obtain a range of Eh from -150 mV to 0 mV for 24 hours. (A) SMCs were infected with
adenovirus encoding siNox1 (Ad-siNox1) or with Ad-siGFP as a control for three days prior to
exposure to -150 mV or 0 mV Cys/CySS redox conditions. Nox1 protein expression was
measured by Western blotting. (B) Summary data from four independent experiments. Results
13
Stanic B ATVB/2010/207639 R1
are normalized to GAPDH expression (mean ± SE, * p < 0.05 vs. -150 mV,  p < 0.05 vs. 0 mV
Ad-siGFP). Nox1 (C, E) and Nox4 (D) mRNA expression was measured by qRT-PCR. The
data are presented as mean ± SE (n=4 to 5). * p < 0.05 vs. -150 mV or control.
14
Stanic B ATVB/2010/207639 R1
A
B
Time (min):
0
0.5
1
5
30
p-EGFR
p-EGFR
Relative EGFR phosphorylation
150
100
50
0
0
0.5
1
5
30
Relative EGFR phosphorylation
EGFR
EGFR
250
200
Vehicle
AG1478
*
150

100
50
0
Control
0 mV
Time (min)
Supplemental Figure II. AG1478 prevents EGFR phosphorylation by an oxidized extracellular
Eh. (A) SMCs were treated with the control medium and p-EGFR expression analyzed by
Western blotting. Results are normalized to total EGFR expression (n=3). (B) SMCs were
pretreated with 10 M AG1478, then exposed to Eh=0 mV for 1 min. Phospho-EGFR
expression was analyzed by Western blotting. Results are normalized to total EGFR expression
and presented as mean ± SE (n=5). * p < 0.05 vs. control;  p < 0.05 vs. 0 mV vehicle.
15
Stanic B ATVB/2010/207639 R1
A
B
Time (min):
0
0.5
1
5
30
Time (min):
ERK1/2
GAPDH
800
* *
600
Relative Akt phosphorylation
p-Akt
Relative ERK1/2 phosphorylation
p-ERK1/2
*
400
200
0
0
0.5
1
5
30
Time (min)
C
0
0.5
1
5
30
GAPDH
1
5
30
* *
300
*
200
100
0
0
0.5
1
5
30
Time (min)
D
p-p38
0
0.5
1
5
30
p-JNK
GAPDH
150
100
50
0
0
0.5
1
Time (min)
5
30
Relative JNK phosphorylation
Relative p38 phosphorylation
0.5
400
Time (min):
Time (min):
0
* *
* *
*
200
150
100
50
0
0
0.5
1
5
30
Time (min)
Supplemental Figure III. Oxidized extracellular Eh differentially activates EGFR downstream
signaling targets. SMCs were exposed to Eh=0 mV for indicated amount of time and p-ERK1/2
(A), p-Akt (B), p-p38 (C), and p-JNK (D) were analyzed by Western blotting. Results are
normalized to total ERK (A) or GAPDH expression (B, C, D) and presented as mean ± SE (n=3
to 4). Blots shown were run on the same gel but cut for better presentation. * p < 0.05 vs.
untreated (0 min).
16
Stanic B ATVB/2010/207639 R1
A
MOI:
25
50
100
Ad-caMEK Ad-empty
Ad-empty
Ad-caMEK
200
MOI:
200
MEK1/2
p-ERK1/2
GAPDH
GAPDH
C
2000
*
1500
1000
500
0
Ad-empty
Ad-caMEK
Relative luciferase activity
Relative Nox1 mRNA
expression
B
100
200
200
*
300
200
100
0
Ad-empty
Ad-caMEK
Supplemental Figure IV. Nox1 expression is increased via the MEK pathway. SMCs were
infected with adenovirus encoding constitutively active form of MEK (Ad-caMEK) or with Adempty as a control. (A) Representative blots show MEK and p-ERK1/2 expression, respectively.
GAPDH served as a loading control (n=3). (B) Nox1 mRNA expression was measured by qRTPCR (n=4). (C) SMCs were transfected with Nox1 promoter luciferase or control plasmid and
infected with Ad-caMEK or Ad-empty. Firefly luciferase activity was normalized to Renilla
luciferase. Data are presented as mean ± SE (n=5). * p < 0.05 vs. Ad-empty.
17
Stanic B ATVB/2010/207639 R1
A
p-CREB
p-ATF-1
*
*
250
200

150
Control
0 mV
100
50
0
Control siRNA
CREB siRNA
+
-
+
-
+
p-CREB
+
-
+
-
+
Relative phosphorylation
Relative phosphorylation
B
p-ATF-1
400
*
*
300

200
100
0
Control siRNA
ATF-1 siRNA
+
-
+
-
+
+
-
+
-
+
Supplemental Figure V. siRNAs to CREB and ATF-1 are effective and specific for their target.
SMCs were transfected with 50 nM siRNA to CREB or ATF-1, then exposed to Eh=0 mV for 5
min. (A) p-CREB and p-ATF-1 expression were analyzed by Western blotting. Scrambled
siRNA served as a control. Results are normalized to GAPDH expression. (B) Summary data of
n=5 independent experiments. * p < 0.05 vs. control;  p < 0.05 vs. 0 mV control siRNA.
18
Relative ATF-1 phosphorylation
A
500
400
Vehicle
20 M GM6001
40 M GM6001
*

300

200
100
0
Control
0 mV
Relative CREB phosphorylation
Stanic B ATVB/2010/207639 R1
500
400
Vehicle
20 M GM6001
40 M GM6001
*
300
200
100
0
Control
0 mV
C
B
AG1478
0 mV
Vehicle
AG1478
Vehicle
Control
p-CREB
p-ATF-1
GAPDH
Supplemental Figure VI. ATF-1, but not CREB, is activated via the metalloproteinase-EGFRERK1/2 pathway in response to oxidized extracellular Eh. SMCs were pretreated with GM6001
(A), 10 M AG1478 (B) or 10 M U0126 and 1 M wortmannin (C) and stimulated with Eh=0
mV for 5 min. Representative blots show p-CREB and p-ATF-1 expression. Blots shown in A
and in B were run on the same gel but cut for better presentation. Summary data of four
independent experiments are shown (n=3 to 5). GAPDH served as a loading control (mean ± SE,
* p < 0.05 vs. control;  p < 0.05 vs. 0 mV vehicle).
19
Stanic B ATVB/2010/207639 R1
“Oxidative Stress”
ligand
EGFR
MPs
ERK1/2
ATF-1
Nox1
ROS
nucleus
SMC proliferation
Supplemental Figure VII. Summary of signaling pathways involved in oxidized extracellular
Eh-mediated activation of Nox1 expression. Extracellular oxidative stress, involving oxidation
of the Cys/CySS redox couple, activates the EGFR through metalloproteinase-mediated shedding
of EGF-like ligands, leading to ERK1/2-dependent activation of the transcription factor ATF-1
and subsequent expression of Nox1. Generation of ROS by activation of Nox1 promotes
phenotypic modifications in SMCs, such as cell proliferation, that contribute to vascular disease.
20