Mar. Biotechnol. 3, 163–171, 2001
DOI: 10.1007/s101260000058
© 2001 Springer-Verlag New York Inc.
Sequencing and Amplified Restriction Fragment Length
Polymorphism Analysis of Ribonucleotide Reductase
Large Subunit Gene of the White Spot Syndrome Virus in
Blue Crab (Callinectes sapidus) from American
Coastal Waters
Yun-Shiang Chang,1 Shao-En Peng,1 Han-Ching Wang,2 Hui-Chen Hsu,1 Ching-Hui Ho,1
Chung-Hsiung Wang,3 Sho-Ya Wang,4 Chu-Fang Lo,1,* and Guang-Hsiung Kou1,*
1
Department of Zoology, National Taiwan University, Taipei, Taiwan, R.O.C.
School of Public Health at Chung Shan Medical and Dental College, Taichung, Taiwan, R.O.C.
3
Department of Entomology, National Taiwan University, Taipei, Taiwan, R.O.C.
4
Department of Biological Sciences, State University of New York at Albany, New York, U.S.A.
2
Abstract: In the present study, the existence of white spot syndrome virus (WSSV) in blue crab (Callinectes
sapidus) collected from 3 different American coastal waters (New York, New Jersey, and Texas) was confirmed
by 2-step diagnostic polymerase chain reaction and in situ hybridization analysis. When geographic isolates
were also compared using a gene that encodes the WSSV ribonucleotide reductase large subunit RR1 (WSSV
rr1), a C1661-to-T point mutation was found in the New Jersey WSSV isolated. This point mutation, which
resulted in the creation of an additional RsaI endonuclease recognition site, was not found in the WSSV from
the New York and Texas blue crab samples, or in the WSSV Taiwan isolate, or in any of the other WSSV
geographical isolates for which data are available. WSSV rr1-specific RsaI amplified restriction fragment length
polymorphism of an amplified 1156-bp fragment thus distinguished the New Jersey blue crab samples from the
other WSSV isolates.
Key words: white spot syndrome virus (WSSV), WSSV isolate, Callinectes sapidus, amplified restriction fragment length polymorphism, ribonucleotide reductase large subunit RR1, WSSV rr1.
I NTRODUCTION
White spot syndrome virus (WSSV) causes one of the most
serious disease problems faced by the shrimp farming industry globally. In recent years, WSSV or a WSSV-like virus
Received June 29, 2000; accepted October 11, 2000
*Corresponding authors: telephone +886-2-2363-3562; fax +886-2-2363-8179; e-mail
[email protected], [email protected]
has been found in several cultured and noncultured arthropods in cultured and noncultured environments worldwide.
The lack of appropriate markers makes it impossible to
distinguish between the many different WSSV isolates or to
organize them into meaningful groups, and this hampers
the study of the molecular epidemiology of WSSV.
For some time it has been unclear whether the WSSVs
found in hosts from different species or geographic distri-
164
Yun-Shiang Chang et al.
butions are identical or only more or less closely related, or
even whether distinct viruses or geographic strains exist.
Comparative studies of virion morphology, protein composition, and WSSV-specific fragment analysis with polymerase chain reaction (PCR) and dot hybridization have
shown that many WSSV isolates are virtually identical (Lo
et al., 1996b, 1997b, 1999; Nadala and Loh, 1998; Nadala et
al., 1998; Tapay et al., 1999), and previous studies using
PCR and amplified restriction fragment length polymorphism (ARFLP) (Lo et al., 1996a, 1996b) have reported a
close relatedness for WSSVs isolated from different species
of shrimps and crabs from the same geographic area (Taiwan). Conversely, studies that used dot blot hybridization
and PCR with specific WSSV genomic fragments (Lo et al.,
1999) and genomic DNA restriction fragment length polymorphism (RFLP) (Nadala and Loh, 1998) have suggested
that nucleotide sequence variations may exist in clinical
samples of WSSV from different geographical locations.
However, thus far no direct nucleotide sequence data or
specific genetic markers have been reported.
In the present study blue crab Callinectes sapidus, a
common wild crab species, was collected from 3 different
American coastal waters and screened for WSSV by 2-step
WSSV-diagnostic PCR. In situ hybridization analysis was
performed to confirm the existence of WSSV in the cells of
WSSV PCR-positive specimens, and from some of the crabs
from each population, the amplified fragment from the
2-step WSSV-diagnostic PCR was sequenced. The gene that
encodes WSSV ribonucleode reductase large subunit RR1
(WSSV rr1), one of the first WSSV genes to be identified
(van Hulten et al., 2000a), was also used to compare different WSSV geographic isolates. Sequence comparisons
and an ARFLP analysis for part of the coding region of the
WSSV rr1 gene were used in an effort to find distinguishable
markers for WSSV isolates.
M ATERIALS
AND
M ETHODS
Callinectes sapidus Specimens
To investigate the prevalence of WSSV in natural populations of crabs, groups of living blue crab, Callinectes sapidus,
were collected from 3 different U.S. coastal waters in 1997.
Each batch of crabs was collected from the same place at the
same time: the New York samples were bought in a New
York market (March 1997), and the others were captured
from the coastal waters of Texas (April 1997) and New
Jersey (October 1997). All samples had a body weight of 300
to 400 g. To avoid contamination by other sources of
WSSV, all the C. sapidus were transported to the laboratory
immediately after being caught or bought. Upon arrival
crabs were dissected, and tissue samples (heart, gill, stomach, and epidermis) of 100 to 200 mg excised from living C.
sapidus were used as the source of the DNA template for the
2-step WSSV-diagnostic PCR (Lo et al., 1996a). (It is important to prepare DNA templates from living crabs; our
unpublished data suggest that templates prepared from frozen specimens almost invariably produce negative results.)
For the in situ hybridization analysis, pieces of the gills,
heart, and stomach were preserved with Davidson’s alcohol
formalin acetic acid (AFA) fixative (Lightner, 1996). The
DNA extraction and tissue fixation procedures were carried
out locally near the collection areas except for the New
Jersey specimens; these were air-freighted live to Taiwan
and then processed immediately upon arrival. DNA templates of a WSSV Taiwan isolate (positive control) were
prepared from the abdominal muscle of a seriously WSSVinfected (1-step PCR-positive) cultured Penaeus monodon
collected from southern Taiwan in 1994 (see Lo et al.,
1996a).
PCR Screening
For 2-step WSSV-diagnostic PCR, a WSSV-specific nested
primer set, pms 146, was used. This consists of the primer
pair pms 146F1 (5⬘-ACTACTAACTTCAGCCTATCTAG-3⬘)/pms
146R1 (5⬘- TAATGCGGGTGTAATGTTCTTACGA -3⬘) and the
nested primer pair pms 146F2 (5⬘- GTAACTGCCCCTTC CATCTCCA-3⬘)/pms 146R2 (5⬘-TACGGCAGCTGCTGCACCTTGT3⬘), derived from the sequences of cloned WSSV genomic
DNA SalI fragments (Lo et al., 1996a). To exclude falsenegative PCR results, the quality of the DNA extracted from
tested crabs was checked with a primer pair amplifying a
decapod gene. This primer pair consists of 143F (5⬘TGCCTTATCAGCTNTCGATTGTAG-3⬘, where N represents G, A,
T, or C), and 145R (5⬘-TTCAGNTTTGCAACCATACTTCCC-3⬘),
derived from a highly conserved region of 18S ribosomal
RNA sequence of decapods (Kim and Abele, 1990; Lo et al.,
1996a).
The first step of the 2-step WSSV-diagnostic PCR used
pms 146F1/R1 and the DNA quality test primer pair 143F/
145R. Each 100-µl reaction mixture consisted of 100 ng of
template DNA, 10 mM Tris-HCl, pH 8.8, at 25°C, 50 mM
KCl, 1.5 mM MgCl2, 0.1% Triton X-100, 200 µM of each
dNTP, 100 pmol of each primer, and 2 U DyNazyme II
Identification of WSSV in Atlantic Blue Crab 165
DNA polymerase (Finnzymes). DNA was amplified in a
GeneAmp PCR System 9700 (Perkin-Elmer Corp.) or an
AcuGen Systems AG 9600 Thermal Station (Biotronics
Corp.). DNA amplification was initiated at 94°C for 3 minutes, and this was followed by 40 cycles of 94°C for 1
minute, 55°C for 1 minute, and 72°C for 2 minutes, with a
final extension at 72°C for 5 minutes.
An aliquot (10 µl) of the first-step PCR product served
as the template for the second step of amplification, which
used the primer pair pms 146F2/R2. A negative control,
with the template DNA solution replaced by 0.1 × TE
buffer, and a positive control were performed with each
reaction. The thermal cycling program and conditions were
as described above.
After the second step, 10 µl of the PCR product was
subjected to electrophoresis in 1% agarose–TAE (1 × TAE:
0.04 M Tris base, 0.04 M acetate, 0.001 M EDTA) gel containing 0.5 µg/ml ethidium bromide and visualized under
ultraviolet irradiation. Nucleic acid sequence analysis of
pms146F2/R2 amplicons was performed on an automated
ABI Model-377 sequencing apparatus (Applied Biosystems,
Inc., Foster City, Calif.) and carried out by Mission Biotech
Co. Ltd., Taiwan.
In Situ Hybridization
After being fixed in Davidson’s fixative for 48 hours, the
tissues were preserved in 70% ethanol until use. Fixed tissues of all the WSSV PCR-positive and some of the WSSV
PCR-negative C. sapidus were then embedded in Paraplast/
Plus (Monoject), and histologic tissue sections of 4 to 5 µm
were made. Sections were mounted onto positively charged
SuperFrost*/Plus (Menzel-Glaser) microscope slides for in
situ hybridization with a WSSV-specific probe labeled with
digoxigenin (DIG). Slides consisting of tissue sections of
WSSV-infected P. monodon were used as positive controls,
while those of uninfected P. monodon as well as 2-step
WSSV-diagnostic PCR-negative C. sapidus were used as
negative controls. The in situ hybridization procedures and
coloration methods followed Lightner (1996). Finally, the
slides were counterstained with 0.5% aqueous Bismarck
Brown Y (Sigma, St. Louis, Mo.) for 90 seconds and then
dehydrated and mounted with Permount (Fisher Scientific,
Pittsburgh, Pa.) mounting media and coverslips for observation under an Olympus Research Microscope Model
AHBT3.
The 0.94-kb DNA probe used here was directly nonradioactively labeled with DIG (Roche Molecular Biochemi-
cals, Indianapolis, Ind.) by PCR using primer pair pms
146F2/R2. Templates for PCR were prepared from the seriously infected (1-step PCR-positive) P. monodon abdominal muscle. The thermal cycling program and PCR reaction
conditions were as described above, except that the dNTP
solution of the PCR cocktail was replaced by PCR DIG
Labeling Mix (Roche Molecular Biochemicals).
Sequence Analysis and Amplified Restriction
Fragment Length Polymorphism for WSSV
rr1 Gene
Amplification of the WSSV rr1-specific DNA fragment was
carried out by 2-step PCR using the outer primer pair
WSSVrr1F5/WSSVrr1R8 (5⬘-TTTCCTCGTGCTTCCTTCTG-3⬘/5⬘CGATTATACATGTTGGAC-3⬘) for the first amplification and the
internal primer pair WSSVrr1F6/WSSVrr1R6 (5⬘GACTCGGCATCCACTTTCATG-3⬘/5⬘-GATTCAGAGTTGCCCAGGAT3⬘) for the second amplification. The 1156-bp 2-step PCR
product corresponds to the nucleotide sequence of part of
the WSSV rr1 coding region (WSSV RR1 amino acid residues 271 to 654, GenBank accession number AF132669).
Clinical samples diagnosed as positive by 2-step WSSVdiagnostic PCR were subjected to WSSV rr1-specific fragment amplification. Except for the primers, the DNA amplification reaction mixture and thermal cycling program
were the same as for the 2-step WSSV-diagnostic PCR described above. PCR products (10 µl) were resolved in 1%
agarose–TAE gel containing 0.5 µg/ml ethidium bromide.
Nested PCR products of the WSSV rr1-specific DNA
fragment were sequenced directly as described above. Multiple nucleotide sequence alignment and restriction enzyme
digestion site analyses were performed with the computer
software GeneWorks Version 2.5.1 for Macintosh (IntelliGenetics Inc.). Nested PCR products amplified from 3 of
the New York specimens, 3 of the Texas specimens, and 5 of
the New Jersey specimens were subjected to direct sequencing.
From the sequence analysis data, an ARFLP analysis
using the RsaI restriction enzyme was developed to distinguish the samples from different sources. Digestion of aliquots of PCR products (5–10 µl) was performed in a 20-µl
reaction volume containing restriction enzyme and an appropriate buffer supplied by the enzyme manufacturer
(Roche Molecular Biochemicals). The mixtures were incubated at 37°C for 1 hour, and 10-µl aliquots were loaded for
electrophoresis. Digested DNA fragments were separated on
166 Yun-Shiang Chang et al.
Table 1. WSSV Detection Rates in Wild Populations of Callinectes sapidus Collected from U.S. Coastal Waters
2-Step WSSVdiagnostic PCR
Source
Number of
C. sapidus
tested
1-Step
positive
2-Step
positive
New York
Texas
New Jersey
Total
110
51
45
206
0
0
0
0
32
13
11
56
Detection
rate (%)
29.1
25.5
24.4
27.2
3% agarose–TAE gels containing 0.5 µg/ml ethidium bromide. Nested PCR products from 5 of the New York specimens, 5 of the Texas specimens, 10 of the New Jersey specimens, and 15 other WSSV isolates from different host species or geographic sources were selected for RsaI ARFLP
analysis. Some of the digested DNA mixtures were also
resolved in 6% denaturing polyacrylamide gels containing
urea as a denaturant and stained with ethidium bromide for
higher resolution.
R ESULTS
Two-Step WSSV-Diagnostic PCR Screening of
Callinectes sapidus
The PCR detection rates for the 3 different geographic C.
sapidus isolates were 29.1%, 25.4%, and 24.4% for samples
collected from New York, Texas, and New Jersey, respectively (Table 1). None of the crabs was 1-step PCR positive.
The 848-bp amplicon amplified by primer pair 143F/145R
for the template DNA quality assay was found in each of the
tested samples (data not shown).
In Situ Hybridization Detection
WSSV-positive signals (Figure 1) were observed in tissues of
the tested 2-step PCR-positive samples. The positive and
negative control sections produced the expected results in
each in situ hybridization assay performed using the pms
146F2/R2 probe (data not shown).
Sequencing and ARFLP Analysis of the WSSV
rr1 Gene
Nested PCR products amplified from specimens from New
York (n = 3), Texas (n = 3), and New Jersey (n = 5) were
Figure 1. Examples of WSSV-specific in situ hybridizationpositive cells (arrows) found in Callinectes sapidus. A: Gills of New
Jersey-32. B: Heart of New York-25. Scale bar = 25 µm.
selected for nucleic acid sequencing, and the full nucleotide
and deduced amino acid sequence of the WSSV rr1 coding
region is shown together with the PCR primer positions in
Figure 2. No sequence differences were observed in the
samples collected from New York and Texas, and these
samples produced sequences identical to that of the WSSV
Taiwan isolate. However, a C1661-to-T point mutation was
observed in WSSV from all 5 New Jersey specimens (Figure
2), which caused the translated amino acid to change from
alanine to valine and resulted in the creation of an additional RsaI endonuclease recognition site in the amplified
fragment from the New Jersey WSSV isolated (Figure 2).
Therefore, RsaI was used for the ARFLP analysis.
Nested PCR products from specimens from New York
(n = 5), Texas (n = 5), and New Jersey (n = 10) are shown
in Figure 3. A comparison of RsaI endonuclease digestion
profiles shows that the New York and Texas samples and
Identification of WSSV in Atlantic Blue Crab 167
D ISCUSSION
Figure 2. WSSV rr1 nucleotide and deduced amino acid sequence
of the WSSV Taiwan isolate indicating the positions of the PCR
outer primer pair WSSVrr1F5 (T713–G732)/WSSVrr1R8 (G1980–
G 1997 ) and nested primer pair WSSVrr1F6 (G 809 –G 829 )/
WSSVrr1R6 (A1945–C1964). The boldfaced T above C1661 shows
the single nucleotide variation (T1661) identified from the 1156-bp
nested PCR products of New Jersey Callinectes sapidus. The RsaI
recognition sites within the PCR-amplified regions are also indicated.
the WSSV Taiwan isolate all have the same pattern of 4
fragments (lengths 592, 310, 192, and 62 bp) (Figure 2), and
that this 4-band profile was clearly resolved (Figure 4, A).
WSSV from different host species or geographic sources
(Table 2) also displayed the same 4-fragment RsaI ARFLP
pattern as that of the WSSV Taiwan isolate (Figure 5). By
contrast, all 10 of the New Jersey samples showed a different
pattern of 5 fragments with lengths of 310, 303, 289, 192,
and 62 bp (Figure 2). Because of resolution limitations of
the agarose gel, the 310-bp, 303-bp, and 289-bp fragments
were not clearly resolved but rather formed an intense, aggregated band. Thus a 3-band profile was observed for the
New Jersey samples (Figure 4, B). Polyacrylamide gel electrophoresis resolved the intense band into 3 fragments (Figure 4, C).
Restriction fragment analysis of total genomic DNA often
offers a limited glimpse into the genetic variation that exists
between groups with low levels of genetic divergence. The
development of PCR allows specific regions to be isolated
and thus facilitates the detection of genetic differences. In
amplified RFLP (ARFLP), the fragments to be analyzed are
amplified by PCR using specific primer sets and then
cleaved by restriction endonucleases. ARFLP has been used
to examine the historical origins and geographic distribution of eukaryotes (Vitic and Strobeck, 1996) as well as
viruses (Gouvea et al., 1998; Sammels et al., 1999), and in
the present study, it was applied for the first time to further
differentiate between WSSVs found in blue crabs collected
from the Atlantic seaboard of North America.
The single nucleotide variation found in the WSSV rr1
coding region in the New Jersey C. sapidus WSSV DNA
resulted in the creation of an additional RsaI recognition
site (GTAC) and allowed the WSSV rr1-specific RsaI ARFLP
of an amplified WSSV rr1-specific fragment to distinguish
the New Jersey blue crab WSSV isolate from other WSSV
isolates. (The fact that only one instance of this kind of
point mutation was found in so many WSSV isolates taken
from such a wide variety of species and geographic locations
is not especially surprising: in the 1156–bp marker region
investigated here, point mutations could be expected to be
rare because rr1 is a gene that encodes the large subunit of
a key DNA synthesis enzyme, and it would therefore be
expected to be stable.)
Recently, several other WSSV genes have been identified, including genes encoding the ribonucleotide reductase
small subunit (RR2), two major virion proteins (VP26,
GenBank accession number AF272980; and VP28, GenBank
accession number AF272979), a novel chimeric polypeptide
of cellular-type thymidine kinase and thymidylate kinase
(van Hulten et al., 2000a, 2000b; Tsai et al., 2000a, 2000b).
Not only are these genes important for WSSV molecular
pathogenicity research, but their sequences should also facilitate the development of a panel of strain-specific ARFLP
analyses for fast WSSV genotyping, and this in turn should
be a very useful tool for molecular epidemiology.
The WSSV detection rates in Table 1 may possibly have
been distorted by false positives or false negatives. To rule
out the possibility that the PCR-positive results were caused
by contamination from unknown sources, PCR-positive
specimens were also subjected to in situ hybridization with
the pms 146 probe. None of the samples was 1-step WSSV
168 Yun-Shiang Chang et al.
Figure 3. Agarose gel electrophoresis of the 1156-bp nested PCR
amplicon of the WSSV rr1 gene from Callinectes sapidus specimens. A: 5 New York samples (lanes 1–5) and 5 Texas samples
(lanes 6–10). B: 10 New Jersey samples (lanes 1–10). PCR products
PCR positive; only a few WSSV-positive cells were found in
the gills, heart, and stomach—i.e., those organs most frequently targeted by WSSV (Lo et al., 1997a; Kou et al.,
1998). Nonetheless, in the tested 2-step WSSV PCR-positive
specimens that were examined, the existence of WSSV in
wild populations of Atlantic blue crab was confirmed.
The in situ hybridizations were performed on 4 separate tissues (gill, heart, stomach, and epidermis) of 6 of the
2-step WSSV-diagnostic PCR-positive crabs. Positive in situ
hybridization signals were only observed in the gills of 2
New Jersey specimens and in the heart and stomach of a
Texas specimen. Because of the sensitivity differences between PCR and in situ hybridization, the 2-step PCRpositive samples did not always produce positive in situ
hybridization results. However, none of the tested specimens was WSSV 1-step PCR positive, and only WSSV
2-step PCR-positive specimens were found (Table 1), which
suggests that only low amounts of WSSV were present in C.
sapidus. When the virus is present in very low concentrations, it will sometimes fall below the sensitivity limit of the
2-step PCR tests (Hsu et al., 1999) and thus produce falsenegative results. This possibility cannot be completely eliminated in the present study.
Several species of crabs collected from coastal waters
and around culture ponds have been shown to be WSSV
carriers that might act as reservoirs for WSSV (Lo et al.,
1996b; Otta et al., 1999; Chen et al., 2000). In the present
study, however, we took care that the blue crabs from New
York and New Jersey were caught a long way from any
shrimp culture activity. Even so, several specimens were
WSSV positive. And interestingly, even though Texas has a
large shrimp culture industry, the Texas blue crabs did not
show a significantly higher WSSV PCR detection rate than
the specimens from other sources (Table 1). Clearly, this
suggests that WSSV is widely dispersed in wild populations
were resolved in 1% agarose–TAE gel. Lane M, pGEM DNA markers (Promega); lane N, PCR-negative control; lane P, PCR-positive
control (WSSV Taiwan isolate).
Figure 4. RsaI restriction profiles of the 1156-bp WSSV rr1 gene
from Callinectes sapidus. A: 5 New York samples (lanes 1–5), and
5 Texas samples (lanes 6–10). B: 10 New Jersey samples (lanes
1–10). In the profiles of the New Jersey isolate, cleaved fragments
with lengths of 310, 303, and 289 bp aggregated into an intense
band near the 300-bp position. C: Typical results of the 6% denaturing polyacrylamide gel electrophoresis show how the intense
band resolves into 3 fragments. Lane M1, pGEM DNA markers
(Promega); lane M2, 100-bp DNA ladder (Promega); lane P,
WSSV Taiwan isolate.
of Atlantic blue crab and that the underlying prevalence is
higher than 20%. Taken together with other reports (Lo et
Identification of WSSV in Atlantic Blue Crab 169
Table 2. Sources of the WSSV Samples Used for the WSSV rr1-Specific ARFLP Analysis in Figure 5
DNA sample names*
Year of
collection
Geographical origin
1. Texas95-242-J43/#6/M
2. Texas96-7/#10/P1
3. South Carolina97-64/#2/G
4. Crayfish97-25/#2/G
5. Thailand95-46/#1/B4
6. India95-314/#2/G
7. China96-116A/#3/MG
8. Grocery store96-115/#5/P1
9. Indonesia990715-Pm1/P1
10. Ecuador991115-Lv/#1/P1
11. Taiwan960812-Ps/#53/Ep
12. Taiwan960810-Cf/#99/Ep
13. Taiwan960810-Pp/#102/Pp
14. Taiwan991116-Pm/#2-5/Pl
15. Taiwan941129-Pm/#1/M
1995
1996
1997
1997
1995
1995
1996
1996
1999
1999
1996
1996
1996
1999
1994
Texas
Texas
South Carolina
U.S.A.
Thailand
India
China
Thailand
Indonesia
Ecuador
Taiwan
Taiwan
Taiwan
Taiwan
Taiwan
Clinical sample species
Litopenaeus vannamei
Litopenaeus vannamei
Litopenaeus vannamei
Orconectes punctimanus
Litopenaeus vannamei
Penaeus monodon
Penaeus chinensis
Penaeus monodon
Penaeus monodon
Litopenaeus vannamei
Portunus sanguinolentus
Charybdis feriatus
Portunus pelagicus
Panaeus monodon
Penaeus monodon
*DNA sample names consist of collection data/individual shrimp number/tissue source for DNA extraction (M indicates muscle; Pl, pleopod; G, gill; MG,
midgut; Ep, epidermis; Pp, pereiopod).
Figure 5. RsaI restriction profiles of the 1156-bp WSSV rr1 gene
from different geographic or species WSSV isolates. Lane numbers
correspond to the sample numbers in Table 2. Lane M1, pGEM
DNA markers (Promega); lane M2, 100-bp DNA ladder (Promega).
al., 1996b; Flegel, 1997; Kanchanaphum et al., 1998;
Supamattaya et al., 1998; Otta et al., 1999b; Chen et al.,
2000), this appears to confirm that WSSV is a natural virus
commonly present at very low concentrations in at least
some wild crab populations. Atlantic blue crabs are also
implicated as asymptomatic carriers (or reservoir hosts) of
WSSV.
A variety of nonoccluded rod-shaped viruses have been
reported to infect mesodermally derived cells (mainly hemocytes, connective-tissue cells, and hemopoietic cells) of
the brachyuran portunid crabs Carcinus maenas, Carcinus
mediterraneus, and C. sapidus taken from Europe or the
Atlantic coast of North America (Johnson, 1988; Johnson
and Lightner, 1988). Although these viruses were found
several years before any outbreaks of shrimp WSS were
reported and have not been found in Asia, where the first
WSS outbreaks occurred, these crab viruses are similar
morphologically to WSSV. We speculate that they may even
be connected with the origin and spread of WSSV, and it
was partly for this reason that in the present study we
screened for WSSV-related virus in blue crab taken from
the Atlantic coast of North America. From the present evidence, we can by no means be certain whether or not the
virus found in these blue crabs is in fact one of the viruses
reported previously; we do, however, conclude that WSSVrelated virus appears to exist widely in Atlantic blue crab.
A CKNOWLEDGMENTS
We are grateful to Dr. Donald V. Lightner (Department of
Veterinary Science, University of Arizona, Tucson) for providing geographical WSSV clinical samples. We thank
Hwei-Chung Liu (Department of Zoology, National Taiwan
University, Taipei, Taiwan, ROC) for assisting in in situ
hybridization. This research was supported by the National
Science Council grant NSC 89-2311-B002-037. We are in-
170 Yun-Shiang Chang et al.
debted to Paul Barlow for his helpful criticism of the manuscript.
R EFERENCES
Chen, L.L., Lo, C.F., Chiu, Y.L., Chang, C.F., and Kou, G.H.
(2000). Natural and experimental infection of white spot syndrome virus (WSSV) in benthic larvae of mud crab Scylla serrata.
Dis Aquat Org 40:157–161.
Flegel, T.W. (1997). Special topic review: major viral diseases of
the black tiger prawn (Penaeus monodon) in Thailand. World J
Microbiol Biotechnol 13:433–422.
Gouvea, V., Hoke, C. Jr., and Innis, B.L. (1998). Genotyping of
hepatitis E virus in clinical specimens by restriction endonuclease
analysis. J Virol Methods 70:71–78.
Hsu, H.C., Lo, C.F., Lin, S.C., Liu, K.F., Peng, S.E., Chang, Y.S.,
Chen, L.L., Liu, W.J., and Kou, G.H. (1999). Studies on effective
PCR screening strategies for white spot syndrome virus (WSSV)
detection in Penaeus monodon brooders. Dis Aquat Org 39:13–19.
Johnson, P.T. (1988). Rod-shaped nuclear viruses of crustaceans:
hemocyte-infecting species. Dis Aquat Org 5:111–122.
Johnson, P.T., and Lightner, D.V. (1988). Rod-shaped nuclear
viruses of crustaceans: gut-infecting species. Dis Aquat Org 5:123–
141.
Kanchanaphum, P., Wongteerasupaya, C., Sitidilokratana, N.,
Boonsaeng, V., Panyim, S., Tassanakajon, A., Withyachumnarnkul, B., and Flegel, T.W. (1998). Experimental transmission of
white-spot syndrome virus (WSSV) from crabs to shrimp Penaeus
monodon. Dis Aquat Org 34:1–7.
Kim, W., and Abele, L.G. (1990). Molecular phylogeny of selected
decapid crustaceans based on 18S rRNA nucleotide sequence. J
Crust Biol 10:1–13.
Kou, G.H., Peng, S.E., Chiu, Y.L., and Lo, C.F. (1998). Tissue
distribution of white spot syndrome virus (WSSV) in shrimp and
crabs. In: Advances in Shrimp Biotechnology, Flegel, T.W. (ed.).
Bangkok, Thailand: National Center for Genetic Engineering and
Biotechnology, 267–271.
Lightner, D.V. (ed.) (1996). A Handbook of Pathology and Diagnostic Procedures for Diseases of Penaeid Shrimp. Baton Rouge, La.:
World Aquaculture Society.
Lo, C.F., Leu, J.H., Ho, C.H., Chen, C.H., Peng. S.E., Chen, Y.T.,
Chou, C.M., Yeh, P.Y., Huang, C.J., Chou, H.Y., Wang, C.H., and
Kou, G.H. (1996a). Detection of baculovirus associated with white
spot syndrome (WSBV) in penaeid shrimps using polymerase
chain reaction. Dis Aquat Org 25:133–141.
Lo, C.F., Ho, C.H., Peng, S.E., Chen, C.H., Hsu, H.C., Chiu, Y.L.,
Chang, C.F., Liu, K.F., Su, M.S., Wang, C.H., and Kou, G.H.
(1996b). White spot syndrome baculovirus (WSBV) detected in
cultured and captured shrimp, crab and other arthropods. Dis
Aquat Org 27:215–225.
Lo, C.F., Ho, C.H., Chen, C.H., Liu, K.F., Chiu, Y.L., Yeh, P.Y.,
Peng, S.E., Hsu, H.C., Liu, H.C., Chang, C.F., Su, M.S., Wang,
C.H., and Kou, G.H. (1997a). Detection and tissue tropism of
white spot syndrome baculovirus (WSBV) in captured brooders of
Penaeus monodon with a special emphasis on reproductive organs.
Dis Aquat Org 30:53–72.
Lo, C.F., Wang, C.H., and Kou, G.H. (1997b). White spot syndrome (WSS): pathology, hosts and prevalence in captured shrimp
and crabs in Taiwan. In: New Approaches to Viral Diseases of
Aquatic Animals: NRIA International Workshop Proceedings, Inui,
Y. (ed.). Mie, Japan: National Research Institute of Aquaculture,
206–217.
Lo, C.F., Hsu, H.C., Tsai, M.F., Ho, C.H., Peng, S.E., Kou, G.H.,
and Lightner, D.V. (1999). Specific genomic DNA fragment analysis of different geographical clinical samples of shrimp white spot
syndrome virus. Dis Aquat Org 35:175–185.
Nadala, E.C.B. Jr., and Loh, P.C. (1998). A comparative study of
three different isolates of white spot virus. Dis Aquat Org 33:231–
234.
Nadala, E.C.B. Jr., Tapay, L.M., and Loh, P.C. (1998). Characterization of non-occluded baculovirus-like agent pathogenic to
penaeid shrimp. Dis Aquat Org 33:221–229.
Otta, S.K., Shubha, G., Joseph, B., Chakraborty, A., Karunasagar,
I., and Karunasagar, I. (1999). Polymerase chain reaction (PCR)
detection of white spot syndrome virus (WSSV) in cultured and
wild crustaceans in India. Dis Aquat Org 38:67–70.
Sammels, L.M., Lindsay, M.D., Poidinger, M., Coelen, R.J., and
Mackenzie, J.S. (1999). Geographic distribution and evolution of
Sindbis virus in Australia. J Gen Virol 80:739–748.
Supamattaya, K., Hoffman, R.W., Boonyaratpalin, S., and Kanchanaphum, P. (1998). Experimental transmission of white spot
syndrome virus (WSSV) from black tiger shrimp Penaeus monodon to the sand crab Portunus pelagicus, mud crab Scylla serrata
and krill Acetes sp. Dis Aquat Org 32:79–85.
Tapay, L.M., Nadala, E.C.B. Jr., and Loh, P.C. (1999). A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus. J Virol Methods 82:39–43.
Tsai, M.F., Lo, C.F., van Hulten, M.C.W., Tzeng, H.F., Chou,
C.M., Huang, C.J., Wang, C.H., Lin, J.Y., Valk, J.M., and Kou,
Identification of WSSV in Atlantic Blue Crab 171
G.H. (2000a). Transcriptional analysis of the ribonucleotide reductase genes of shrimp white spot syndrome virus. Virology
277:92–99.
G.H., and Vlak, J.M. (2000a). Analysis of a genomic segment of
white spot syndrome virus of shrimp containing ribonucleotide
reductase genes and repeat regions. J Gen Virol 81:307–316.
Tsai, M.F., Yu, H.T., Tzeng, H.F., Tzeng, H.F., Sun, S.W., Leu,
J.H., Chou, C.M., Huang, C.J., Wang, C.H., Lin, J.Y., Valk, J.M.,
Kou, G.H., and Lo, C.F. (2000b). Identification and characterization of a shrimp white spot syndrome virus (WSSV) gene that
encodes a novel chimeric polypeptide of cellular-type thymidine
kinase and thmidylate kinase. Virology 277:100–110.
van Hulten, M.C.W., Westenberg, M., Goodall, S.D., and Vlak,
J.M. (2000b). Identification of two major virion protein genes of
white spot syndrome virus of shrimp. Virology 266:227–236.
van Hulten, M.C.W., Tsai, M.F., Schipper, C.A., Lo, C.F., Kou,
Vitic, R., and Strobeck, C. (1996). Mitochondrial DNA analysis of
populations of lake trout (Salvelinus namaycush) in west-central
Canada: implications for stock identification. Can J Fish Aquat Sci
53:1038–1047.