Pioglitazone-Induced Reductions in Atherosclerosis Occur
via Smooth Muscle Cell–Specific Interaction With PPAR␥
Venkateswaran Subramanian, Jonathan Golledge, Talha Ijaz, Dennis Bruemmer, Alan Daugherty
Rationale: Peroxisome proliferator-activated receptor (PPAR)␥ agonists attenuate atherosclerosis and abdominal
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
aortic aneurysms (AAAs). PPAR␥, a nuclear receptor, is expressed on many cell types including smooth muscle
cells (SMCs).
Objective: To determine whether a PPAR␥ agonist reduces angiotensin II (Ang II)–induced atherosclerosis and
AAAs via interaction with SMC-specific PPAR␥.
Methods and Results: Low-density lipoprotein receptor (LDLR)ⴚ/ⴚ mice with SMC-specific PPAR␥ deficiency
were developed using PPAR␥ floxed (PPAR␥f/f) and SM22 Creⴙ mice. PPAR␥f/f littermates were generated that
did not express Cre (Cre0/0) or were hemizygous for Cre (Creⴙ/0). To assess the contribution of SMC-specific
PPAR␥ in ligand-mediated attenuation of Ang II–induced atherosclerosis and AAAs, both male and female
Cre0/0 and Creⴙ/0 mice were fed a fat-enriched diet with or without the PPAR␥ agonist pioglitazone (Pio) (20
mg/kg per day) for 5 weeks. After 1 week of feeding modified diets, mice were infused with Ang II (1000 ng/kg
per minute) for 4 weeks. SMC-specific PPAR␥ deficiency or Pio administration had no effect on plasma
cholesterol concentrations. Pio administration attenuated Ang II–increased systolic blood pressure equivalently
in both Cre0/0 and Creⴙ/0 groups. SMC-specific PPAR␥ deficiency increased atherosclerosis in male mice. Pio
administration reduced atherosclerosis in only the Cre0/0 mice, but not in mice with SMC-specific PPAR␥
deficiency. SMC-specific PPAR␥ deficiency or Pio administration had no effect on Ang II–induced AAA
development. Pio also did not attenuate Ang II–induced monocyte chemoattractant protein-1 production in
PPAR␥-deficient SMCs.
Conclusions: Pio attenuates Ang II–induced atherosclerosis via the interaction with SMC-specific PPAR␥, but
has no effect on the development of AAAs. (Circ Res. 2010;107:00-00.)
Key Words: Ang II 䡲 atherosclerosis 䡲 smooth muscle cell 䡲 PPAR␥ 䡲 Pioglitazone
effects through PPAR ␥ -independent mechanisms, although this has not been defined in vascular pathologies.6
TZDs have been demonstrated to regulate important
SMC functions, including proliferation and migration.7
SMC-specific genetic manipulations have resulted in
changes in both atherosclerosis8,9 and AAAs in mice.9
Furthermore, SMC-specific gene deletion of PPAR␥ results in changes in blood pressure and injury-induced
vascular hyperplasia.10,11 However, no studies have currently determined whether the benefits of TZDs on vascular pathologies are mediated via a SMC-specific PPAR␥dependent mechanism.
To elucidate a role of SMC-specific PPAR␥ expression
on TZD-induced reductions in atherosclerosis and AAAs,
we bred female LDLR⫺/⫺ mice harboring PPAR␥ floxed
T
hiazolidinediones (TZDs), including rosiglitazone and
pioglitazone (Pio), are used widely to improve insulin
sensitivity in patients with type 2 diabetes. Experimentally,
TZDs reduce atherosclerosis in both low-density lipoprotein receptor (LDLR)⫺/⫺ and apolipoprotein (Apo)E⫺/⫺
mice.1,2 Recent studies have demonstrated that TZDs also
reduce Ang II–induced abdominal aortic aneurysm (AAA)
development in ApoE⫺/⫺ mice.3,4 The molecular target for
TZD is PPAR␥, a nuclear receptor that is highly expressed
in all cell types involved in vascular pathologies, including
macrophages, endothelial cells, and smooth muscle cells
(SMCs).5 Currently, it has not been defined whether the
beneficial effects of TZDs are attributable to PPAR␥
agonism in a specific cell type. Furthermore, it has been
suggested that TZDs may exert some of their biological
Original received February 23, 2010; revision received August 6, 2010; accepted August 16, 2010. In July 2010, the average time from submission
to first decision for all original research papers submitted to Circulation Research was 12.9 days.
From the Saha Cardiovascular Research Center (V.S., T.I., D.B., A.D.), University of Kentucky, Lexington; and Vascular Biology Unit (J.G.), James
Cook University, Townsville, Queensland, Australia.
This manuscript was sent to Peter Libby, Consulting Editor, for review by expert referees, editorial decision, and final disposition.
Correspondence to Alan Daugherty, Saha Cardiovascular Research Center, BBSRB, Room B243, University of Kentucky, Lexington, KY 40536-0509.
E-mail [email protected]
© 2010 American Heart Association, Inc.
Circulation Research is available at http://circres.ahajournals.org
DOI: 10.1161/CIRCRESAHA.110.219089
1
2
Circulation Research
October 15, 2010
Non-standard Abbreviations and Acronyms
AAA
Ang II
ApoE
IFN
LDLR
MCP
Pio
PPAR
SBP
SMC
TZD
abdominal aortic aneurysm
angiotensin II
apolipoprotein E
interferon
low-density lipoprotein receptor
monocyte chemoattractant protein
pioglitazone
peroxisome proliferator-activated receptor
systolic blood pressure
smooth muscle cell
thiazolidinedione
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
genes to similarly genetically manipulated males that were
hemizygous for Cre regulated by the SM22 promoter. This
breeding strategy generated littermate controls that were
either wild-type or SMC-specific deficient in PPAR␥.
Using these mice, we determined the contribution of
PPAR␥ expression in SMCs to the effects of Pio on
Ang II–induced atherosclerosis and AAAs.12 The results
demonstrate that SMC-PPAR␥ deficiency resulted in increased Ang II–induced atherosclerosis. Furthermore,
these data demonstrate that PPAR␥ expression in SMCs is
a major contributor to Pio-induced reduction in atherosclerosis. Contrary to previous studies, we did not discern an
effect of Pio on Ang II–induced AAAs.
Methods
An expanded Methods section is available in the Online Data
Supplement at http://circres.ahajournals.org.
Results
ⴚ/ⴚ
Generation of LDLR
PPAR␥ Deficiency
Mice With SMC-Specific
To verify the genotype of mice, aortas were dissected
free, adventitia and endothelium were removed, and DNA
was isolated from SMC-containing media. PCR analyses
were performed on DNA isolated from the arch, thorax,
suprarenal, and infrarenal aortic regions to determine the
uniformity of Cre-based exon excision. These analyses
demonstrated the presence of nonfunctional alleles
(240-bp amplicon) throughout aortas of Cre-expressing
mice. In contrast, aortas from nontransgenic littermates
generated 215-bp amplicons derived from intact floxed
genes (Figure 1A).
RT-PCR analyses showed complete deletion of PPAR␥
mRNA in SMC aortic medias of Cre⫹/0 mice (Figure 1B),
indicating that functional PPAR␥ transcripts were ablated.
Western blot analyses demonstrated that PPAR␥ protein was
ablated in aortic SMCs from Cre⫹/0 mice, while not influencing abundance in liver, kidney, and adipose tissue (Figure 1C
and Online Figure II).
Figure 1. Generation of SMC-specific PPAR␥-deficient mice.
SMC-specific PPAR␥-deficient mice were generated as
described in the Methods. A, PCR analyses of DNA demonstrated complete deletion of PPAR␥ in SMC-containing medial
layer from all aortic regions. A 215-bp amplicon was generated
from Cre0/0 mice, whereas a 240-bp amplicon was obtained
from Cre⫹/0 mice. B, RT-PCR analyses showed deletion of
PPAR␥ mRNA in aortic medias. C, Western blot analyses
showed deletion of PPAR␥ protein in Cre⫹/0 SMCs.
SMC-Specific Deficiency of PPAR␥ Augmented
Ang II–Induced Atherosclerosis Without
Affecting AAAs
SMC-specific PPAR␥ deficiency in LDL receptor⫺/⫺ mice
resulted in significant (P⬍0.05) increases in Ang II–
induced atherosclerotic lesion areas in male mice, but had
no effect in females (Figure 2). SMC-specific deletion of
PPAR␥ had no effect on body weight, plasma total
cholesterol concentrations (Online Table I), or lipoproteincholesterol distributions (data not shown). Ang II infusion
significantly increased systolic blood pressure (SBP) in
male mice of both groups (Online Table I). SMC-specific
PPAR␥ deficiency had no effect on Ang II–induced AAA
formation (Figure 2C) or aortic rupture (Cre0/0, 25%;
versus Cre⫹/0, 28%) in either sex.
Pio Attenuated Ang II–Induced Atherosclerosis
Only in the Presence of PPAR␥ in SMCs
In Ang II–infused mice fed a fat-enriched diet, PPAR␥
mRNA abundance was not significantly increased in peritoneal macrophages (Online Figure III). Pio administration to
these mice induced PPAR␥ mRNA abundance and activity in
selected cell types and tissues, including macrophages, liver,
kidney, and adipose. These inductions did not differ between
Cre0/0 and Cre⫹/0 mice (Figure 3A and 3B; Online Figure IV).
Increased PPAR␥ activity was demonstrable by increased
mRNA abundance of PPAR␥ target genes: AP2 and CD36 in
macrophages (Online Figure V) and selected tissues (Online
Figure VI).
Pio administration profoundly reduced atherosclerosis
only in Cre0/0 mice, but not in mice with SMC-specific
Subramanian et al
Smooth Muscle Cell PPAR␥ and Atherosclerosis
3
lesion size, immunostaining for macrophages was dominant in atherosclerosis from both Cre0/0 or Cre Cre⫹/0
mice.
Ang II Augmented Monocyte Chemoattractant
Protein-1 Production in PPAR␥-Deficient SMCs
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Figure 2. SMC-PPAR␥ deficiency augmented Ang II–induced
atherosclerosis but had no effect on AAAs in male LDLRⴚ/ⴚ
mice. Atherosclerotic lesion area was measured on aortic arch
(A) and thoracic (B) intimal surfaces (n⫽9 to 20). C, Measurements of maximal external width of abdominal aortas (n⫽9 to
16). Open circles (Cre0/0) and gray circles (Cre⫹/0) represent
individual mice, diamonds represent means, and bars are
SEMs. Statistical analyses were performed using Mann–Whitney
rank sum analyses. Horizontal bars represent significance of
P⬍0.05.
PPAR␥ deficiency (Figure 3C and 3D). In contrast, Pio
administration significantly attenuated Ang II–increased
SBP equivalently in both Cre0/0 and Cre⫹/0 groups (Online
Table II). Pio administration had no effect on body weight,
plasma total cholesterol concentrations (Online Table II),
or lipoprotein cholesterol distributions (data not shown).
AAA formation (Figure 3E) or aortic rupture (Cre0/0, 11%;
versus Cre⫹/0, 20%) was not different between groups.
Immunostaining of atherosclerotic lesions with ␣-actin
demonstrated uniform reactivity throughout the medial
intralaminar spaces of all groups, but minimal SMC
immunostaining was detected in atherosclerotic lesions
from any group. Although PPAR␥ deficiency increased
To define potential mechanisms of Pio reducing atherosclerosis, plasma monocyte chemoattractant protein (MCP)-1
concentrations were measured. No significant difference was
observed among groups demonstrating no systemic effect on
MCP-1 (Online Figure VII).
Aortic SMCs cultured from either Cre0/0 or Cre⫹/0 mice
were incubated with Pio (20 ␮mol/L) for 24 hours, and with
or without Ang II (1 ␮mol/L) for a further 18 hours. Ang II
significantly increased MCP-1 concentrations from Cre⫹/0
SMCs but had no significant effect on Cre0/0 SMCs (Figure
4). Coincubation with Pio had no effect on Ang II–induced
MCP-1 production in Cre⫹/0 SMCs.
Consistent with SMCs harvested from Cre0/0 and Cre⫹/0
mice, Ang II increased MCP-1 concentrations in media of
SMCs cultured from mice expressing a dominant-negative
mutation of PPAR␥ P465L (PPAR␥L⫹)13 but not in cells
isolated from nontransgenic littermates. To determine
whether PPAR␥ has a dominant effect on MCP-1 secretion, SMCs were incubated with interferon (IFN)␥. In
contrast to Ang II, IFN␥ (300 U/mL) significantly increased MCP-1 concentrations in media of SMCs from
both strains (Figure 4B). Pio had no effect on IFN␥induced MCP-1 (Figure 4C).
To confirm that the effects of Pio on MCP-1 were
attributable to interactions with PPAR␥, Cre0/0 and Cre⫹/0
SMCs were incubated with Pio and Ang II as described
above. The absence of PPAR␥ in SMCs significantly lowered
AP2 mRNA abundance but failed to affect CD36 (Online
Figure VIII). Ang II incubation significantly reduced mRNA
abundance of both these target genes in Cre⫹/0 SMCs.
Coincubation of Ang II and Pio significantly attenuated the
reduced mRNA abundance of target genes in SMCs from
Cre0/0 but not Cre⫹/0 mice.
Discussion
In the present study, we demonstrate that SMC-specific
PPAR␥ deficiency augments Ang II–induced atherosclerosis in male LDLR⫺/⫺ mice. Interestingly, Pio administration attenuates Ang II–induced atherosclerosis only in
wild-type mice, but not in SMC-specific PPAR␥-deficient
mice, which characterizes SMC-specific PPAR␥ as the key
molecular target for the ligand-mediated attenuation of
atherosclerosis.
SMC-specific PPAR␥ deficiency augmented Ang II–induced atherosclerosis only in male mice. This is in agreement
with the study by Li et al, in which the attenuation of
atherosclerosis by a PPAR␥ ligand was observed only in male
LDLR⫺/⫺ mice.1 The basis for these sex differences have not
been defined.
Pio administration activates PPAR␥ in both Cre0/0 and
Cre⫹/0 genotypes, which was evidenced by increased
4
Circulation Research
October 15, 2010
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Figure 3. Pio attenuated Ang II–induced atherosclerosis via SMCPPAR␥. Peritoneal macrophages were
harvested from Cre0/0 (A) and Cre⫹/0 (B)
mice fed with or without Pio. Total RNA
was extracted and analyzed by RT-PCR
using 18S as an internal control. Atherosclerotic lesion areas were measured in
aortic arch (C) and thoracic (D) intimal
surfaces (n⫽7 to 12). E, Measurements
of maximal external width of abdominal
aortas (n⫽7 to 13). Open circles (Cre0/0)
and gray circles (Cre⫹/0) represent individual mice, and diamonds represent
means and bars are SEMs. Horizontal
bars represent significance of P⬍0.05
by 2-way ANOVA followed by Holm–
Sidak post hoc tests.
PPAR␥ expression observed in peritoneal macrophages
and other tissues. Previous in vitro studies demonstrated
that TZDs inhibited SMC proliferation and induced apoptosis through PPAR␥-dependent mechanisms.14 In the
present study, Pio administration attenuates Ang II–induced atherosclerosis only in Cre0/0 mice, but not in mice
with SMC-specific PPAR␥ deficiency. Considering that
SMC proliferation constitutes an important cellular mech-
Figure 4. Ang II augmented MCP-1
production in PPAR␥-deficient SMCs.
A through C, MCP-1 protein accumulated in cell culture media was measured
by ELISA. Values are represented as
means⫾SEMs. Horizontal bars represent significance of P⬍0.05 by 1-way
ANOVA followed by Holm–Sidak post
hoc tests. WT indicates wild type.
Subramanian et al
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
anism for atherosclerosis initiation,15 our findings not only
demonstrated SMC-specific PPAR␥ as an endogenous
inhibitor of atherosclerosis but also established that TZDs
exert antiatherosclerotic effects through this pathway.
Pio administration significantly suppresses Ang II–induced
SBP in both genotypes. This result indicates that Piomediated SBP-lowering effect is independent of SMCspecific PPAR␥. In support of this observation, a recently
published study using both SM22-Cre⫹ and Tie2-Cre⫹
PPAR␥ flox mice showed that TZD-mediated the SBPlowering effects via PPAR␥ expressed in endothelium.16
Because endothelial PPAR␥ is intact, Pio administration
attenuates Ang II–induced SBP in both Cre0/0 and Cre⫹/0
groups in our study.
SMC-specific PPAR␥ deficiency or Pio administration
did not influence aneurysm formation in LDLR⫺/⫺ mice,
which is contrary to a recent publication in which Pio
reduced suprarenal aortic expansion in Ang II–infused
ApoE⫺/⫺ mice.4 The differences may be attributable to the
lower dose used in the present study.4 Our dietary delivery
was estimated to be ⬇20 mg/kg per day, whereas the
drinking water delivery in the study by Golledge et al4 was
estimated to be 50 mg/kg per day. In another study,
rosiglitazone attenuated Ang II–induced AAA formation in
ApoE⫺/⫺ mice, which was mainly associated with decreased expression of inflammatory mediators.3 The basis
for the inconsistent effects of TZDs on Ang II–induced
AAAs is unclear.
To further understand the mechanism by which Pio
mediates its effect via SMC-PPAR␥ on atherosclerosis, we
examined the effect of Ang II on MCP-1 production in
cultured Cre⫹ and PPAR␥L⫹ SMCs. Interestingly, Ang II
activates MCP-1 production only in Cre⫹/0 and PPAR␥L⫹
SMCs, but not in control SMCs, suggesting that endogenous SMC-PPAR␥ regulates Ang II–induced MCP-1 production. In addition, Pio had no effect on Ang II–induced
MCP-1 production in Cre⫹/0 SMCs, which is consistent
with this TZD requiring interaction with PPAR␥ to reduce
Ang II–induced atherosclerosis. The specificity of this
pathway was demonstrated by the continued induction of
MCP-1 secretion in PPAR␥L⫹ cells during IFN␥ incubation that signals via CD74 pathway in SMCs.17 This
SMC-PPAR␥– dependent effect of Ang II is localized to
SMCs, which is not reflected by plasma concentrations of
MCP-1.
In summary, this study provides evidence that lack of
PPAR␥ in vascular SMCs results in significant increases in
atherosclerosis associated with increased MCP-1 production.
Furthermore, the study reveals that SMC-specific PPAR␥
expression is a novel mediator of ligand-mediated attenuation
of atherosclerosis.
Acknowledgments
We acknowledge Deborah Howatt, Jessica Moorleghen, Debra
Rateri, and Anju Balakrishnan for technical assistance; Richard
Charnigo Jr for assistance with statistics; and Takeda Pharmaceuticals for providing pioglitazone. We thank Manikandan Panchat-
Smooth Muscle Cell PPAR␥ and Atherosclerosis
5
charam, Susan Smyth, and Nobuyo Maeda (University of North
Carolina, Chapel Hill) for providing PPAR␥L⫹ cells.
Sources of Funding
This work was supported by National Heart, Lung, and Blood
Institute grants HL80010 (to J.G.) and HL80100 (to A.D.) and
American Heart Association Great Rivers Affiliate Postdoctoral
Fellowship 0825592D (to V.S.).
Disclosures
None.
References
1. Li AC, Brown KK, Silvestre MJ, Willson TM, Palinski W, Glass CK.
Peroxisome proliferator-activated receptor gamma ligands inhibit development of atherosclerosis in LDL receptor-deficient mice. J Clin
Invest. 2000;106:523–531.
2. Levi Z, Shaish A, Yacov N, Levkovitz H, Trestman S, Gerber Y, Cohen
H, Dvir A, Rhachmani R, Ravid M, Harats D. Rosiglitazone
(PPARgamma-agonist) attenuates atherogenesis with no effect on hyperglycaemia in a combined diabetes-atherosclerosis mouse model. Diabetes
Obes Metab. 2003;5:45–50.
3. Jones A, Deb R, Torsney E, Howe F, Dunkley M, Gnaneswaran Y, Gaze
D, Nasr H, Loftus IM, Thompson MM, Cockerill GW. Rosiglitazone
reduces the development and rupture of experimental aortic aneurysms.
Circulation. 2009;119:3125–3132.
4. Golledge J, Cullen B, Rush C, Moran CS, Secomb E, Wood F, Daugherty
A, Campbell JH, Norman PE. Peroxisome proliferator-activated receptor
ligands reduce aortic dilatation in a mouse model of aortic aneurysm.
Atherosclerosis. 2010;210:51–56.
5. Hsueh WA, Bruemmer D. Peroxisome proliferator-activated receptor
gamma: implications for cardiovascular disease. Hypertension. 2004;43:
297–305.
6. Chawla A, Barak Y, Nagy L, Liao D, Tontonoz P, Evans RM.
PPAR-gamma dependent and independent effects on macrophage-gene
expression in lipid metabolism and inflammation. Nat Med. 2001;7:
48 –52.
7. Gizard F, Bruemmer D. Transcriptional control of vascular smooth
muscle cell proliferation by peroxisome proliferator-activated receptorgamma: therapeutic implications for cardiovascular diseases. PPAR Res.
2008;429123:1–11.
8. Wolfsgruber W, Feil S, Brummer S, Kuppinger O, Hofmann F, Feil R.
A proatherogenic role for cGMP-dependent protein kinase in vascular
smooth muscle cells. Proc Natl Acad Sci U S A. 2003;100:1351913524.
9. Boucher P, Gotthardt M, Li WP, Anderson RGW, Herz J. LRP: role in
vascular wall integrity and protection from atherosclerosis. Science. 2003;
300:329 –332.
10. Halabi CM, Beyer AM, de Lange WJ, Keen HL, Baumbach GL, Faraci
FM, Sigmund CD. Interference with PPAR gamma function in smooth
muscle causes vascular dysfunction and hypertension. Cell Metab. 2008;
7:215–216.
11. Meredith D, Panchatcharam M, Miriyala S, Tsai YS, Morris AJ,
Maeda N, Stouffer GA, Smyth SS. Dominant-negative loss of
PPARgamma function enhances smooth muscle cell proliferation,
migration, and vascular remodeling. Arterioscler Thromb Vasc Biol.
2009;29:465– 471.
12. Daugherty A, Manning MW, Cassis LA. Angiotensin II promotes atherosclerotic lesions and aneurysms in apolipoprotein E-deficient mice.
J Clin Invest. 2000;105:1605–1612.
13. Tsai YS, Kim HJ, Takahashi N, Kim HS, Hagaman JR, Kim JK,
Maeda N. Hypertension and abnormal fat distribution but not insulin
resistance in mice with P465L PPARgamma. J Clin Invest. 2004;114:
240 –249.
14. Bruemmer D, Yin F, Liu J, Berger JP, Sakai T, Blaschke F, Fleck E, Van
Herle AJ, Forman BM, Law RE. Regulation of the growth arrest and
DNA damage-inducible gene 45 (GADD45) by peroxisome proliferatoractivated receptor gamma in vascular smooth muscle cells. Circ Res.
2003;93:e38 – e47.
6
Circulation Research
October 15, 2010
15. Doran AC, Meller N, McNamara CA. Role of smooth muscle cells in the
initiation and early progression of atherosclerosis. Arterioscler Thromb
Vasc Biol. 2008;28:812– 819.
16. Wang N, Symons JD, Zhang H, Jia Z, Gonzalez FJ, Yang T. Distinct
functions of vascular endothelial and smooth muscle PPARgamma in regulation of blood pressure and vascular tone. Toxicol Pathol. 2009;37:21–27.
17. Martin-Ventura JL, Madrigal-Matute J, Munoz-Garcia B,
Blanco-Colio LM, Van Oostrom M, Zalba G, Fortuno A, GomezGuerrero C, Ortega L, Ortiz A, Diez J, Egido J. Increased CD74
expression in human atherosclerotic plaques: contribution to inflammatory responses in vascular cells. Cardiovasc Res. 2009;83:
586 –594.
Novelty and Significance
What Is Known?
●
●
●
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
●
Peroxisome proliferator-activated receptor (PPAR)␥, a nuclear receptor, is a target of therapeutic interventions to augment insulin
sensitivity.
PPAR␥ expression in macrophages moderates the development of
experimental atherosclerosis.
Activation of PPAR␥ by thiazolidinediones (TZDs) suppresses smooth
muscle cell (SMC) proliferation.
TZDs, PPAR␥ agonists, attenuate atherosclerosis in male mice.
What New Information Does This Article Contribute?
●
●
Pioglitazone-induced attenuation of atherosclerosis depends on
PPAR␥ in SMC.
Selective deficiency of PPAR␥ in SMC augments Ang II–aggravated
atherosclerosis.
PPAR␥ is a nuclear receptor that is highly expressed in many of
cell types involved in vascular pathologies, including macro-
phages, endothelial cells, and SMCs. The TZDs (agonists of
PPAR␥) have been shown to inhibit the development of atherosclerosis in male animals. Currently, it is unclear whether the
beneficial effects of TZDs could be attributed to PPAR␥ agonism
in a specific cell type. In vitro, TZDs inhibit SMC proliferation and
migration, the key events that promote intimal hyperplasia
during atherogenesis; however, the contribution of SMC PPAR␥
to the antiatherogenic effects of TZD has not been assessed.
Because TZDs regulate SMC proliferation, which is a key step in
the development of atherosclerosis, we hypothesized that SMCspecific PPAR␥ is responsible for the beneficial effects of TZD on
atherosclerosis. By generating SMC-specific PPAR␥-deficient
mice, we show that SMC-specific PPAR␥ plays a critical role in
the development of Ang II–induced atherosclerosis. We demonstrate that PPAR␥ expression in SMCs is required for the
reduction in Ang II–induced atherosclerosis by pioglitazone. This
is the first study to report that pioglitazone exerts its beneficial
effect on atherosclerosis via a SMC-specific PPAR␥-dependent
mechanism.
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Pioglitazone-Induced Reductions in Atherosclerosis Occur via Smooth Muscle Cell−
Specific Interaction With PPARγ
Venkateswaran Subramanian, Jonathan Golledge, Talha Ijaz, Dennis Bruemmer and Alan
Daugherty
Circ Res. published online August 26, 2010;
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2010 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/early/2010/08/26/CIRCRESAHA.110.219089.citation
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2010/08/26/CIRCRESAHA.110.219089.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
ONLINE SUPPLEMENT
Pioglitazone-induced Reductions in Atherosclerosis Occur via
Smooth Muscle Cell-specific Interaction With PPARγ
Venkateswaran Subramanian,1 Jonathan Golledge,2 Talha Ijaz,1
Dennis Bruemmer,1 Alan Daugherty1
Saha Cardiovascular Research Center1
University of Kentucky
Lexington, KY 40536
The Vascular Biology Unit2
James Cook University
Townsville, QLD, Australia 4811
Running Title - Smooth muscle cell PPAR gamma and atherosclerosis
Address for Correspondence: Alan Daugherty
Saha Cardiovascular Research Center
BBSRB, Room B243
University of Kentucky
Lexington, KY 40536-0509
Telephone: (859) 323-3512
E-mail:
[email protected]
MATERIALS AND METHODS
Mice
LDL receptor -/- (stock # 002207), PPARγf/f (stock # 004584), and SM22 Cre+/0
(stock # 004746) mice were purchased from the Jackson Laboratory. LDL receptor-/and PPARγf/f mice were backcrossed 10 times into a C57BL/6 background. SM22
Cre+/0 mice were obtained in a mixed background (C57BL/6 x SJL) and were
backcrossed 8 times into a C57BL/6 background. Both PPARγf/f and SM22 Cre+/0
mice were bred to an LDL receptor -/- background. Female PPARγf/f mice were bred
with male SM22-Cre+/0 mice to yield mice homologous for the floxed allele and
hemizygous for the Cre transgene (termed as Cre+/0). Littermates that were
homozygous for the floxed PPARγ gene, but without the Cre transgene (Cre0/0), were
used as control mice. All mice were maintained in a barrier facility and fed with normal
mouse laboratory diet. All study procedures were approved by the University of
Kentucky Institutional Animal Care and Use Committee.
Mouse Genotyping
Mouse genotypes were determined by PCR. DNA was isolated from tail snips
and carotid artery samples of mice using a DNeasy tissue kit (Qiagen). LDL receptor
genotype was performed as described previously.1 PPARγf/f genotyping used the
following primers: 5'-CTAGTGAAGTATACTATACACTGTGCAGCC, 5'-GTGTCATAAT
AAACATGGGACCATAGAAGC, and 5'-TCTTATACCTGGGACAGCATATCCCA.
Resultant wild-type, flox, and delta flox (deleted) allele bands were 170, 215, and 240
base pairs (bp), respectively (see Online Figure I). Cre+ genotyping used the following
primers: 5'-ACCTGAAGATGTTCGCGATT and 5'-CGGCATCAACGTTTTCTTTT. The
resultant Cre+ hemizygous allele PCR product was 182 bp and no product for non
transgenic mice. The IL-2 gene was used as an internal control for Cre+ genotyping
using the following primers: 5'-CTAGGCCACAGAATTGAAAGATCT and 5'GTAGGTGGAAATTCTAGCATCATCC. The resultant product was 324 bp.
Diets
To induce hypercholesterolemia, all study mice were fed a diet enriched with
saturated fat (21% wt/wt milk fat; Harlan Teklad, TD88137) for 5 weeks. For the Pio
study, mice were fed a saturated fat-enriched diet with or without the PPARγ agonist,
Pio (0.16 mg/g diet) for 5 weeks. The dose of Pio was estimated to be ~20 mg/kg/day.
Osmotic Minipump Implantation
After 1 week of feeding a saturated fat-enriched diet, mice (8-12 weeks old) were
infused with AngII (1,000 ng/kg/min, Bachem) by subcutaneously implanted Alzet
osmotic minipumps (Model 1004, Durect Corporation) for a period of 28 days, as
described previously.2 The mice were continued to consume with saturated fat-enriched
diet.
Blood Pressure Measurements
Systolic blood pressure (SBP) was measured noninvasively on conscious
restrained mice using a computerized tail cuff blood pressure system (Coda 8, Kent
Scientific Corp).3 SBP was measured for 5 days prior to pump implantation, and during
the last 5 days of the AngII administration.
Measurement of Plasma Components
Plasma cholesterol concentrations and lipoprotein cholesterol distribution were
determined as described previously.2
2
Quantification of Atherosclerosis and AAAs
Atherosclerosis was quantified using en face analyses both in the aortic intima of
the arch and thorax, as described previously.4,5 AAAs were quantified by measurement
of the maximum width of the ex vivo suprarenal abdominal diameter using computerized
morphometry (Image-Pro) as described previously.6
Immunostaining:
SMCs were detected using a rabbit anti-α smooth muscle actin antibody (catalog
no. ab5694; Abcam). Macrophages were detected using a rabbit antimouse
macrophage serum (catalog no. AIA31240; Accurate Chemical Company) and a rat
antimouse CD68 (FA-11, catalog no. MCA 1957; Serotec). We also attempted to
immunostain for Ki-67 using either a rabbit antimouse Ki-67 (ab15580; Abcam) or a
goat antimouse Ki-67(SC-7846; Santa Cruz). Immunostaining was performed on
formalin-fixed frozen sections, with appropriate negative controls, as described
previously.1,7
mRNA Abundance
RNA was harvested from mouse aortic medial tissues, SMCs and peritoneal
macrophages using the Qiagen and SV Total RNA Isolation System (Promega),
respectively. RNA (100 ng) was reverse transcribed using the iScript cDNA synthesis
kit (Bio-Rad). PCR was performed as described previously.1,7 mRNA abundances were
calculated by normalization to either 18S rRNA or β-actin. Non-template and no RT
reactions were used as negative controls. The primers used are detailed in Table 3.
Western blot analyses
Tissue or cell lysates were extracted in RIPA lysis buffer and protein content was
measured using the Bradford assay (Bio-Rad). Extracts (30 μg protein) were resolved
by SDS-PAGE (7.5 % wt/vol) and transferred electrophoretically to PVDF membranes.
After blocking, the following antibodies were used to probe the membranes: PPARγ
(Affinity Bioreagents; catalog No: PA3-821A), and β-actin (Sigma-Aldrich; catalog No:
A228). Membranes were then incubated with appropriate secondary antibodies, and
immune complexes were visualized by chemiluminescence (Pierce) and quantified
using a Kodak Imager.
Quantification of MCP-1 Protein by ELISA
Aortic SMCs were isolated from PPARγf/f Cre0/0 and PPARγf/f Cre+/0 mice as
described previously.8 Quiescent cells were incubated with either vehicle or Pio (20 μM)
for 24 hours and then incubated with AngII (1 μM) for a further 24 hours. Culture media
of SMCs incubated with either AngII or AngII + Pio were collected and centrifuged at
13,000 rpm for 5 minutes. Supernatants were stored at -80°C until assay.
Accumulation of MCP-1 protein in media was measured with a mouse MCP-1 ELISA kit
(R & D System) and normalized to cellular protein.
PPARγ P465L Mutant Aortic SMCs
SMCs harvested from mice containing the P465L mutation in PPARγ and non
transgenic littermates were obtained as a gift from Dr. Smyth (University of Kentucky).
Passage 7-8 were used in this study.
Statistical Analyses
All data are represented as mean ± SEM. Statistical analyses were performed
using Sigmastat (SPSS Inc) or version 8.2 of SAS (SAS Institute). One or two-way
ANOVA were performed with Holm-Sidak post hoc tests as appropriate. Repeated
3
measurement data were analyzed with SAS fitting a linear mixed model expressing the
temporal trend in systolic blood pressure as a quadratic polynomial in time for each
treatment. P<0.05 values were considered to be statistically significant.
4
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
Daugherty A, Rateri DL, Lu H, Inagami T, Cassis LA. Hypercholesterolemia
stimulates angiotensin peptide synthesis and contributes to atherosclerosis
through the AT1A receptor. Circulation. 2004 110:3849-3857.
Daugherty A, Manning MW, Cassis LA. Angiotensin II promotes atherosclerotic
lesions and aneurysms in apolipoprotein E-deficient mice. J Clin Invest. 2000
105:1605-1612.
Daugherty A, Rateri D, Hong L, Balakrishnan A. Measuring blood pressure in mice
using volume pressure recording, a tail-cuff method. J Vis Exp. 2009 1291.
Daugherty A, Whitman SC. Quantification of atherosclerosis in mice. Methods Mol
Biol. 2003 209:293-309.
Daugherty A, Rateri DL. Development of experimental designs for atherosclerosis
studies in mice. Methods. 2005 36:129-138.
Daugherty A, Cassis LA. Mouse models of abdominal aortic aneurysms.
Arterioscler Thromb Vasc Biol. 2004 24:429-434.
Lu H, Boustany-Kari CM, Daugherty A, Cassis LA. Angiotensin II increases
adipose angiotensinogen expression. Am J Physiol Endocrinol Metab. 2007
292:E1280-1287.
Ray JL, Leach R, Herbert JM, Benson M. Isolation of vascular smooth muscle cells
from a single murine aorta. Methods Cell Sci. 2001 23:185-188.
5
ONLINE FIGURES
PPARγ WT
LoxP
Exon 1
Exon 2
Exon 1
Exon 2
170 bp
PPARγ Flox/Flox
215 bp
Cre
PPARγ delta Flox
240 bp
Online Figure I: PCR screening strategy to verify deletion of PPARγ alleles. A
215 bp product was generated from Cre0/0 mice, while a 240 bp product was obtained
from Cre+/0 mice.
6
Liver
Cre:
+/0
Adipose
0/0 +/0
Kidney
0/0
+/0
0/0
PPARγ
ß-actin
Online Figure II. SM22-Cre+ mediated deletion did not influence PPARγ protein in
non SMC containing tissues. Western blot analyses demonstrated the presence of
PPARγ protein in liver, adipose, and kidney from both Cre0/0 and Cre+/0 mice.
7
PPARγ / β-actin Ratio
(Fold Change vs Cre0/0 Control)
2.0
Normal diet
Fat enriched
1.5
1.0
0.5
0.0
0/0
+/0
Cre genotype
Online Figure III: Saturated fat-enriched diet did not increase PPARγ mRNA
abundance in peritoneal macrophages. Peritoneal macrophages were harvested
from Cre0/0 and Cre+/0 mice fed normal or saturated fat-enriched diet. Total RNA was
extracted and PPARγ mRNA abundance was determined by real-time PCR using βactin as an internal control (n=4).
8
PPARγ / β-actin Ratio
(Fold Change vs Cre0/0 Control)
8
6
Control
*
Liver
Kidney
Adipose
Pio
*
*
4
**
*
*
2
0
0/0
+/0
0/0
+/0
Cre genotype
Online Figure IV: Pio administration increased PPARγ mRNA abundance in both
Cre0/0 and Cre+/0 groups. Liver, kidney, and adipose tissue were harvested from
Cre0/0 and Cre+/0 mice administered with or without Pio. Total RNA was extracted and
PPARγ mRNA abundance was analyzed by real-time PCR using β-actin as an internal
control (n=5). * Denotes significance of P<0.05 for mice administered Pio by two-way
ANOVA followed by Holm-Sidak post hoc tests.
9
Relative Gene Abundance / β-actin Ratio
(Fold Change vs Cre0/0 Control)
A
1.5
AP2
CD36
1.0
0.5
0.0
0/0
B
Relative Gene Abundance / β-actin Ratio
(Fold Change vs Cre0/0 Control)
Fat enriched
Normal diet
2.5
+/0
0/0
Pio
Control
AP2
CD36
2.0
+/0
*
*
*
*
0/0
+/0
1.5
1.0
0.5
0.0
0/0
+/0
Cre genotype
Online Figure V: Pio administration, but not feeding a saturated fat-enriched diet,
increased mRNA abundance of PPARγ target genes in peritoneal macrophages.
Peritoneal macrophages were harvested from Cre0/0 and Cre+/0 mice fed normal or
saturated fat-enriched diets (A) or fed a fat-enriched diet and administered with or
without Pio (B). Total RNA was extracted and mRNA abundance of PPARγ target
genes, AP2 and CD36, was determined by real-time PCR using β-actin as an internal
control. * Denotes significance of P<0.05 for mice administered Pio by two-way ANOVA
followed by Holm-Sidak post hoc tests (n=4-5).
10
A
8
6
Control
Pio
*
AP2
CD36
*
*
*
4
Relative Gene Abundance / β-actin Ratio
(Fold change vs Cre0/0 Control)
2
0
0/0
B
4
+/0
0/0
+/0
Control
Pio
*
3
*
*
*
2
1
0
0/0
+/0
0/0
+/0
C
Control
21
Pio
18
*
*
15
12
*
9
*
6
3
0
0/0
+/0
0/0
+/0
Cre genotype
Online Figure VI: Pio administration increased mRNA abundance of PPARγ
target genes in liver, kidney, and adipose tissue. Total RNA was extracted and
mRNA abundance of PPARγ target genes, AP2 and CD36, were analyzed in liver (A),
kidney (B), and adipose tissue (C) by real-time PCR using β-actin as an internal control.
* Denotes significance of P<0.05 for mice administered Pio by two-way ANOVA
followed by Holm-Sidak post hoc tests (n=5).
11
140
Control
Pio
MCP-1 (pg / ml)
120
100
80
60
40
20
0
0/0
+/0
0/0
+/0
(Cre genotype)
Online Figure VII: SMC-PPARγ deficiency had no effect on plasma MCP-1
concentrations. MCP-1 protein concentrations in plasma were measured by ELISA.
Values are represented as means ± SEMs (n=5). No differences were statistically
significant.
12
A
1.6
Cre +/0 SMCs
AP2/ß-actin ratio
(Fold change vs Cre0/0 vehicle)
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0
Vehicle
AngII
Pio
+
-
2.0
CD36/ß-actin ratio
(Fold change vs Cre0/0 vehicle)
B
Cre 0/0 SMCs
+
+
-
+
+
+
+
+
+
-
+
+
-
+
+
+
+
+
Cre +/0 SMCs
Cre 0/0 SMCs
1.5
1.0
0.5
0.0
Vehicle
AngII
Pio
+
-
+
+
-
+
+
+
+
+
+
-
+
+
-
+
+
+
+
+
Online Figure VIII: Pio increased AP2 and CD36 mRNA abundance in SMCs via
PPARγ. Total RNA was extracted and mRNA abundance of PPARγ target genes, AP2
(A) and CD36 (B), were analyzed by real-time PCR using β-actin as an internal control.
Values are represented as mean ± SEM. All horizontal bars represent significance of
P<0.05 by one-way ANOVA followed by Holm-Sidak post hoc tests (n=4).
13
Online Table I. Effects of SMC-specific PPARγ deletion in LDL receptor -/- mice during
infusion of AngII.
Parameters
Groups
Cre0/0
Cre+/0
Gender
N
Cre0/0
Male
Cre+/0
Female
27
21
11
11
26 ± 1
25 ± 1
22 ± 1
22 ± 1
1544 ± 112
1548 ± 87
1677 ± 134
1535 ± 94
Systolic BP pre-infusion (mm Hg)
141 ± 2
134 ± 3
138 ± 2
137 ± 2
Systolic BP post-infusion (mm Hg)
152 ± 4*
151 ± 2*
147 ± 5
141± 2
Body Weight (g)
Plasma Cholesterol (mg/dL)
Values are represented as means ± SEMs. * Denotes P<0.001 vs pre-infusion, oneway ANOVA.
14
Online Table II. Effects of Pio on SMC-specific PPARγ deletion in male LDL receptor /- mice during infusion of AngII.
Parameters
Groups
Cre0/0
Cre+/0
Drug
N
Cre0/0
None
Cre+/0
Pio
19
14
12
10
28 ± 1
28 ± 1
27 ± 1
27 ± 1
1339 ± 84
1319 ± 75
1240 ± 66
1357 ± 68
Systolic BP pre-infusion (mm Hg)
143 ± 2
136 ± 3
141 ± 4
138 ± 3
Systolic BP post-infusion (mm Hg)
164 ± 2*
161 ± 3*
145 ± 2
144 ± 2
Body Weight (g)
Plasma Cholesterol (mg/dL)
Values are represented as means ± SEMs. * Denotes P<0.001 for post-infusion versus
pre-infusion by one-way ANOVA.
15
Online Table III. Primers used for RT or real-time PCR
Product
size (bp)
Gene
Primers
PPARγ
5'-AGCATCAGGCTTCCACTATG
5'-ATCCGGCAGTTAAGATCACA
111
AP2
5'-TCACCTGGAAGACAGCTCCT
5'-AAGCCCACTCCCACTTCTTT
167
CD36
5'- TGCTGGAGCTGTTATTGGTG
5'-TGGGTTTTGCACATCAAAGA
190
18S
5'-CTCTGTTCCGCCTAGTCCTG
5'-AATGAGCCATTCGCAGTTTC
170
β-actin
5'-CGTGGGCCGCCCTAGGCAACCA
5'-TTGGCCTTAGGGTTCAGGGGGG
220
16