Altered Growth Responses of Pulmonary Artery Smooth
Muscle Cells From Patients With Primary Pulmonary
Hypertension to Transforming Growth Factor-␤1 and Bone
Morphogenetic Proteins
Nicholas W. Morrell, MD; Xudong Yang, MD; Paul D. Upton, PhD; Karen B. Jourdan, PhD;
Neal Morgan, BSc; Karen K. Sheares, MA; Richard C. Trembath, FRCP
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
Background—Mutations in the type II receptor for bone morphogenetic protein (BMPR-II), a receptor member of the
transforming growth factor-␤ (TGF-␤) superfamily, underlie many cases of familial and sporadic primary pulmonary
hypertension (PPH). We postulated that pulmonary artery smooth muscle cells (PASMCs) from patients with PPH might
demonstrate abnormal growth responses to TGF-␤ superfamily members.
Methods and Results—For studies of 3H-thymidine incorporation or cell proliferation, PASMCs (passages 4 to 8) were
derived from main pulmonary arteries. In control cells, 24-hour incubation with TGF-␤1 (10 ng/mL) or bone
morphogenetic protein (BMP)-2, -4, and -7 (100 ng/mL) inhibited basal and serum-stimulated 3H-thymidine
incorporation, and TGF-␤1 and BMPs inhibited the proliferation of serum-stimulated PASMCs. In contrast, TGF-␤1
stimulated 3H-thymidine incorporation (200%; P⬍0.001) and cell proliferation in PASMCs from PPH but not from
patients with secondary pulmonary hypertension. In addition, BMPs failed to suppress DNA synthesis and proliferation
in PASMCs from PPH patients. Reverse transcription–polymerase chain reaction of PASMC mRNA detected transcripts
for type I (TGF-␤RI, Alk-1, ActRI, and BMPRIB) and type II (TGF-␤RII, BMPR-II, ActRII, ActRIIB) receptors.
Receptor binding and cross-linking studies with 125I-TGF-␤1 confirmed that the abnormal responses in PPH cells were
not due to differences in TGF-␤ receptor binding. Mutation analysis of PASMC DNA failed to detect mutations in
TGF-␤RII and Alk-1 but confirmed the presence of a mutation in BMPR-II in 1 of 5 PPH isolates.
Conclusions—We conclude that PASMCs from patients with PPH exhibit abnormal growth responses to TGF-␤1 and
BMPs and that altered integration of TGF-␤ superfamily growth signals may contribute to the pathogenesis of PPH.
(Circulation. 2001;104:790-795.)
Key Words: hypertension, pulmonary 䡲 muscle, smooth 䡲 growth substances 䡲 proteins
P
rimary pulmonary hypertension (PPH) is a rare disorder
that is progressive and often fatal.1 The disease is
characterized by vascular cell proliferation and obliteration of
small pulmonary arteries,2 leading to severe pulmonary hypertension and right ventricular failure. Typical morphological changes include increased muscularization of small arteries and thickening or fibrosis of the intima, as well as the
presence of plexiform lesions, which are tangles of capillarylike channels adjacent to small pulmonary arteries.3
Recently, linkage was established between familial PPH
and a region on the long arm of chromosome 2 (2q33).4,5
Sequencing of positional candidate genes revealed heterozygous mutations involving the gene encoding the type II bone
morphogenetic protein receptor (BMPR-II), a member of the
transforming growth factor-␤ (TGF-␤) superfamily of recep-
tors.6,7 The heterogeneous mutations include frameshift and
nonsense mutations predicted to cause premature truncation
of the 1038 amino acid protein. Missense mutations occur at
highly conserved and functionally important sites, predicted
to perturb ligand binding or disrupt the kinase domain of the
receptor. Interestingly, the same mutations underlie ⬇25% of
apparently sporadic cases of PPH, some of which are in fact
familial, the remainder arising de novo.8 Although these
recent genetic studies point toward a critical role for the
TGF-␤ superfamily in the regulation of pulmonary vascular
cell growth and differentiation, the precise molecular mechanisms leading to disease pathogenesis remain to be
elucidated.
The recognized role of the TGF-␤ superfamily in endothelial9 and smooth muscle10 cell growth, differentiation, and
Received March 15, 2001; revision received June 1, 2001; accepted June 4, 2001.
From the Department of Medicine (N.W.M., X.Y., P.D.U., K.B.J., N.M., K.K.S.), University of Cambridge, Addenbrooke’s and Papworth Hospitals,
Cambridge, United Kingdom; and Division of Clinical Genetics (R.C.T.), University of Leicester, Leicester, United Kingdom.
Table I can be found Online at http://www.circulationaha.org
Correspondence to Dr Nicholas W. Morrell, Department of Medicine, University of Cambridge School of Clinical Medicine, Addenbrooke’s Hospital,
Box 157, Hills Rd, Cambridge CB2 2QQ, UK. E-mail [email protected]
© 2001 American Heart Association, Inc.
Circulation is available at http://www.circulationaha.org
790
Morrell et al
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
matrix production reinforces the potential role of BMPR-II in the
vascular lesion of PPH. Growth, migration, and excess matrix
deposition by endothelial cells, smooth muscle cells, and adventitial fibroblasts all contribute to the process of vascular wall
remodeling in pulmonary hypertension.11 TGF-␤1 exerts potent
effects on vascular smooth muscle cells in vitro, including
inhibition of proliferation,12 extracellular matrix synthesis, and
cell differentiation.13 Bone morphogenetic proteins (BMPs) have
been less extensively studied, but BMP-7 has been shown to
inhibit proliferation of human aortic smooth muscle cells and
increase expression of smooth muscle differentiation markers,14
and BMP-2 inhibits vascular smooth muscle cell proliferation
after balloon injury in rats.15
Taken together, these studies provide a platform from which
to speculate that disruption of TGF-␤ superfamily signaling as a
consequence of BMPR2 mutation in PPH might contribute to the
cellular proliferation and vascular obliteration seen in this
condition. The present study demonstrates that cells from patients with PPH but not control subjects or patients with
secondary pulmonary hypertension (SPH) exhibit abnormal
growth responses to TGF-␤1 and BMPs, which suggests that
altered integration of TGF-␤ superfamily signals may contribute
to the vascular lesions characteristic of PPH.
Methods
Isolation of Human Pulmonary Artery Smooth
Muscle Cells
Proximal segments of human pulmonary artery were obtained from
patients undergoing lung or heart-lung transplantation for PPH
(n⫽6) or pulmonary hypertension secondary to congenital heart
disease (n⫽5). Samples of proximal pulmonary artery were obtained
from unused donors for transplantation (n⫽9). The study was
approved by the Harefield and Papworth Hospital ethical review
committees, and subjects gave informed written consent. Explants
were processed as described previously.16 Cells were used for
experiments between passages 4 and 8, and the smooth muscle
phenotype of isolated cells was confirmed by positive immunofluorescence with antibodies to anti-smooth muscle-␣ actin antibody
(IA4) and anti-smooth muscle–specific myosin (hsm-v), as
described.16
Growth Studies
To determine the serum-stimulated growth rates, cells were seeded at
104 per well in 48-well plates in DMEM/10% FBS. Cell numbers
were counted with a hemocytometer at days 2, 5, and 7. In additional
studies, BMP-2, -4, or -7 (1 to 100 ng/mL) or TGF-␤1 (0.1 to 10
ng/mL) was added to quiescent cells (0.1% FBS) or serumstimulated cells (10% FBS) to determine the effect on proliferation.
Growth of human pulmonary artery smooth muscle cells (PASMCs)
in response to individual growth factors was determined by [methyl3
H]-thymidine incorporation, representing DNA synthesis.16 Cells
were grown to 70% to 80% confluence and made quiescent by
incubation with DMEM/0.1% FBS for 48 hours. The media was then
exchanged for fresh DMEM/0.1% FBS either alone or containing
BMP-2, -4, or -7 (0.1 to 100 ng/mL), TGF-␤1 (0.1 to 100 ng/mL),
platelet-derived growth factor-BB (PDGF-BB; 10 ng/mL), or thrombin (3 U/mL) for 24 hours. Then, 0.5 ␮Ci/well [methyl-3H]thymidine was added for the final 6 hours. Each isolate was studied
at least twice under each condition, and the mean values were taken
from all studies conducted with any one isolate.
Expression Profiling of TGF-␤ Superfamily
Receptors by Reverse Transcription–Polymerase
Chain Reaction
Total RNA was isolated from growth-arrested primary cultures of
human PASMCs with TRIzol reagent (Life Technologies) and
TGF-␤ Superfamily and Human PASMC Growth
791
reverse transcription–polymerase chain reaction (RT-PCR) performed with the Access RT-PCR System from Promega. Primers
were taken from previously published sequences, where possible, or
designed with the computer program Prime(⫹). The primer sequences and sources are available online in Table I. All primers were
synthesized by Sigma-Genosys Ltd. PCR products were visualized
by electrophoresis in agarose (2%) gels stained with ethidium
bromide. Control reactions were run without the addition of reverse
transcriptase. The identity of PCR products was confirmed by direct
sequencing.
Receptor Binding Studies in Cells
For competition binding studies, cells were seeded in 24-well plates
and grown to confluence, then made quiescent by incubation in 0.1%
FBS for 3 days. 125I-TGF-␤1 competition binding was performed as
described previously.17 Cells were incubated at 4°C for 4 hours with
DMEM/0.5% BSA containing 125I-TGF-␤1 (Amersham) in the absence or presence of unlabeled TGF-␤1 (0.01 to 100 ng/mL). The
effect of BMP-2, BMP-4, or BMP-7 (10 to 100 ng/mL) on binding
was also assessed.
Receptor Cross-Linking Studies
For cross-linking studies, cells were seeded in 6-well plates and
grown to confluence. Cells were then made quiescent as described
above. The initial binding steps were as described above except that
the ligand was added at 10 000 to 20 000 cps/well in the absence or
presence of 100 ng/mL TGF-␤1 or BMP-4. Cross-linking of 125ITGF-␤1 to cell surface receptors was performed by a previously
described technique, with minor modifications.18 Samples were separated with 10% PAGE gels with or without 50 mmol/L DTT, stained
with Coomassie blue, dried, and exposed to autoradiographic film.
Screening for Mutations in the ALK1, BMPR-II,
and TGF-␤RII Genes
Genomic DNA was extracted from smooth muscle cells by standard
techniques (Nucleon Biosciences). Protein coding sequence from the
ALK1 gene (exons 2 to 10) was amplified from genomic DNA with
primers complimentary to the intron sequences, as described previously,19 and sequenced with a dye-terminator cycle-sequencing
system (ABI PRISM 377, Perkin-Elmer Applied Biosystems).
BMPR-II sequence (exons 1 to 13) analysis was performed, as
described previously and with primer sequences available on the
Internet.20 In addition, we looked for mutations in the A10 microsatellite region of TGF-␤RII, as described previously.12 This region is
prone to 1- or 2-bp deletions that lead to premature truncation of the
protein and a reduction in gene expression and has been associated
with a loss of responsiveness to the growth inhibitory effects of
TGF-␤1 in vascular smooth muscle cells12 and tumor cells.21
Statistical Analysis
Data were expressed as mean⫾SEM and analyzed with GraphPad
Prism version 3.0 (GraphPad Software). Comparisons were made by
Student’s t test or1-way ANOVA with the Tukey post hoc test as
appropriate. A value of P⬍0.05 indicated statistical significance.
Results
Clinical Characteristics of Pulmonary
Hypertensive Patients
The clinical and demographic information available for pulmonary hypertensive cases is shown in the Table.
Effect of TGF-␤1 and BMPs on DNA Synthesis
In control cells, PDGF (10 ng/mL) and thrombin (3 U/mL)
led to an increase in 3H-thymidine incorporation of 284⫾62%
and 149⫾14%, respectively. The response was similar in
cells from patients with PPH (PDGF 277⫾31%; thrombin
189⫾10%) and SPH (PDGF 367⫾61%, thrombin 174⫾12%;
792
Circulation
August 14, 2001
Clinical Data for Patients With Pulmonary Hypertension
BMPR2 Mutation
Analysis
Sex/Age, y
Underlying
Condition
PAP
s/d/m, mm Hg
Final
Diagnosis
1
F/37
VSD
NA
SPH
No
2
M/40
VSD
127/55/81
SPH
No
3
M/27
VSD
170/80/120
SPH
No
4
M/36
VSD
82/51/65
SPH
No
5
M/22
VSD
NA
SPH
No
6
M/42
None
100/50/69
PPH
No
7
F/41
None
69/53/61
PPH
No
8
F/52
None
100/35/60
PPH
9
F/41
None
100/48/60
PPH
10
F/41
None
87/53/54
FPPH
11
M/29
None
90/30/50
PPH
Patient
1471 C to T
PGI2
Treatment
No
Yes
2q33 allele sharing
No
No
PAP indicates pulmonary arterial pressure; s/d/m, systolic/diastolic/mean; PGI2, prostaglandin I2;
VSD, ventricular septal defect; and FPPH, familial PPH.
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
P⬎0.05). In contrast, clear differences were demonstrated in
the response of PASMCs from PPH patients (compared with
SPH and normal controls) to TGF-␤1 and BMPs. Incubation
of serum-deprived donor or SPH PASMCs with TGF-␤1 led
to inhibition of basal 3H-thymidine incorporation at 24 hours
(Figure 1). In PPH cells, TGF-␤1 consistently stimulated
3
H-thymidine incorporation (Figure 1). In serum-stimulated
PASMCs, a similar inhibition of 3H-thymidine incorporation
by TGF-␤1 was observed in PASMCs from controls and
patients with SPH, whereas stimulation was still apparent in
PPH cells (data not shown).
Incubation of serum-deprived control and SPH PASMCs
with BMP-2, -4, or -7 led to inhibition of basal and serumstimulated 3H-thymidine incorporation at 24 hours (Figure 2).
However, BMPs failed to significantly suppress basal and
serum-stimulated 3H-thymidine incorporation in cells from
patients with PPH (Figure 2).
serum-stimulated proliferation over a 15-day period (Figure
3), which suggests that PASMCs from patients with PPH do
not possess an intrinsically enhanced growth response to
nonspecific mitogenic stimuli. The effect of TGF-␤1 and
BMPs on serum-stimulated proliferation of PASMCs was
Effect of TGF-␤1 and BMPs on Proliferation
Analysis of growth curves of cells from controls and patients
with PPH and SPH revealed no difference in the rate of
Figure 1. Basal 3H-thymidine incorporation in PASMCs derived
from normal controls (open bars; n⫽7) and patients with SPH
(checkered bars; n⫽4) or PPH (solid bars; n⫽5) in response to
incubation with 0.1% FBS with or without TGF-␤1. *P⬍0.05 vs
corresponding 0.1% FBS without TGF-␤1.
Figure 2. Basal 3H-thymidine incorporation in PASMCs derived
from normal controls (open bars; n⫽6) and patients with SPH
(checkered bars; n⫽4) or PPH (solid bars; n⫽4) in response to
incubation with 0.1% FBS with or without BMP-2 (A), BMP-4
(B), or BMP-7 (C). *P⬍0.05 vs corresponding 0.1% FBS without
BMP.
Morrell et al
TGF-␤ Superfamily and Human PASMC Growth
793
Figure 3. Rates of proliferation of PASMCs from control subjects (n⫽9) and patients with PPH (n⫽6) and SPH (n⫽5) in
response to 10% FBS.
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
also examined. TGF-␤1 and BMP-2, -4, and -7 all inhibited
the serum-stimulated proliferation of PASMCs from normal
subjects and patients with SPH (Figure 4). In contrast,
TGF-␤1 enhanced the serum-stimulated proliferation of
PASMCs from PPH patients. Furthermore, BMPs failed to
significantly reduce proliferation rates of PASMCs from
patients with PPH (Figure 4).
Figure 5. Detection of TGF-␤ superfamily receptor mRNA
expression by RT-PCR in PASMCs from control subjects and
patients with SPH and PPH. Representative ethidium bromide–
stained gels demonstrating expression of mRNA transcripts for
TGF-␤RI, TGF-␤RII, Act R2, and BMPR-II.
Expression Profile of TGF-␤
Superfamily Receptors
mRNA transcripts for TGF-␤ superfamily type I (ALK-1,
TGF-␤RI, Act RI, and BMP RIB) and type II (TGF-␤RII,
BMPR-II, ActR2, and ActR2B) receptors were present in total
RNA isolated from PASMCs (Figure 5). We were unable to
detect mRNA transcripts for BMP RIA. Specificity of the
reactions for RNA was confirmed by the absence of PCR
products when samples were run without reverse transcriptase.
Receptor Binding Studies
Specific binding of 125I-TGF-␤1 was demonstrated in cells from
controls and PPH patients and was ⬇50% of total binding.
Competition binding curves demonstrated concentrationdependent competition by unlabeled ligand (Figure 6). 125ITGF-␤1 binding was not inhibited by an excess of unlabeled
BMP-2, -4, or -7 (100 ng/mL; data not shown). The affinity
(IC50) of this site was similar in PASMCs from patients with
PPH (1.23⫾0.39 ng/mL; n⫽3), patients with SPH (2.18⫾0.26
ng/mL; n⫽3), and controls (1.07⫾0.35 ng/mL; n⫽4). In addition, binding site density was similar in PPH (10 329⫾1659
Figure 4. Rates of proliferation of PASMCs from control subjects (A; n⫽4) and patients with SPH (B; n⫽3) and PPH (C; n⫽4)
in response to 10% serum, in presence or absence of TGF-␤1
(10 ng/mL), BMP-2, BMP-4, or BMP-7 (100 ng/mL). In control
and SPH cells, TGF-␤1 and BMPs suppressed rate of PASMC
proliferation. In PPH cells, TGF-␤1 stimulated cell proliferation
and BMPs failed to significantly suppress growth. *P⬍0.01 vs
10% serum alone.
Figure 6. Characterization of 125I-TGF-␤1 binding sites in
PASMCs from patients with PPH (n⫽3) or SPH (n⫽3) and controls (n⫽4). Graphs show equilibrium competition binding for
125
I-TGF-␤1 in presence of increasing concentrations of unlabeled TGF-␤1.
794
Circulation
August 14, 2001
Figure 7. Identification of cell surface receptors for 125I-TGF␤1
by radioligand cross-linking. Predicted position of specific
receptors is shown on right. Binding was conducted in presence
or absence of excess of unlabeled TGF-␤1 or BMP-4. No difference was detected in proportion of total binding to each receptor subtype in PASMCs from control and PPH subjects.
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
sites/cell), SPH (10 350⫾750 sites/cell), and controls
(10 966⫾2918 sites/cell).
Receptor Cross-Linking
One potential mechanism for the divergent functional responses to TGF-␤1 in PPH smooth muscle cells is an
alteration in the proportion of type I and type II receptors.18
Analysis of cross-linking gels indicated that the proportion of
total binding of 125I-TGF-␤1 to bands corresponding to TGF␤RI, TGF-␤RII, and TGF-␤RIII was similar in cells derived
from patients and controls (Figure 7). In addition, BMP-4
failed to compete for 125I-TGF-␤1 binding.
Mutation Analysis
We found no evidence of mutation in the coding sequence of
ALK-1 or the A10 microsatellite region of TGF-␤RII. Mutation analysis of the coding region of BMPR2 in 5 samples
from patients with PPH revealed a missense (C to T at
position 1471) mutation in exon 11 in 1 patient with apparently sporadic PPH. The mutation is predicted to lead to
substitution of a tryptophan for the arginine residue at
position 491 of the amino acid sequence, within the kinase
domain of the BMPR-II receptor. An additional PASMC
isolate was derived from a patient with familial PPH in whom
linkage had previously been established with 2q33, the
chromosomal region containing BMPR2, although no specific
mutations were identified.
Discussion
The main finding of this study is that smooth muscle cells
isolated from the pulmonary artery of patients with PPH
exhibit altered growth responses to the BMPR-II ligands
BMP-2, -4, and -7 compared with cells isolated from
normal controls or patients with a similar degree of
pulmonary hypertension secondary to congenital heart
disease. Another finding was that PASMCs from patients
with PPH exhibit a heightened growth response to TGF-␤1,
which is not a known ligand for BMPR-II, suggesting more
widespread disruption of TGF-␤ superfamily signaling in
these cells. Moreover, our data suggest that the mechanism
for the altered growth response to TGF-␤1 is not due to
alterations in TGF-␤ type I/type II receptor ratios or
downregulation of the TGF-␤RII receptor.
These studies were prompted by the recent discovery that
mutations in BMPR2 underlie many cases of familial and
sporadic PPH.6,8 Because hypertrophy and hyperplasia of vascular smooth muscle and endothelial cells almost certainly
contribute to the formation of obliterative lesions in PPH, we
hypothesized that deleterious BMPR2 mutations might disrupt
the growth-inhibitory effects of TGF-␤ superfamily members on
vascular smooth muscle. Although the effects of BMPR-II
mutation on endothelial function remain to be determined, our
findings support this hypothesis and point toward a common
molecular defect in PASMCs from patients with PPH. Despite
this, we identified a BMPR2 mutation in only 1 of 5 patients with
apparently sporadic PPH. This is consistent with the reported
frequency of BMPR-II mutations of 26% in patients with
“sporadic” PPH.8 However, it is likely that the actual frequency
of BMPR2 mutations in PPH is higher than this, because the
direct sequencing methods used in this and other studies may not
detect mutations in regulatory regions or large gene deletions or
rearrangements. The remaining PPH case in the present study
had familial PPH and came from a family in which linkage was
established with the BMPR2 locus, although again, no mutation
was identified. We have recently found that mutations in Alk-1,
which encodes an orphan TGF-␤ type I receptor, may also be
associated with PPH in families with the condition hereditary
hemorrhagic telangiectasia (R.C.T., unpublished observations,
2001). However, screening of ALK-1 revealed no mutations in
the present study.
Our RT-PCR data are consistent with a previous report
showing expression of multiple type I receptors for the TGF-␤
superfamily in rat aortic smooth muscle.22 Although the expression of TGF-␤RII by vascular smooth muscle is well documented,10,18 there is little information regarding the expression of
BMPR-II by vascular cells. Binding sites for 125I-BMP2 have
been identified on a wide variety of cell lines derived from
fibroblasts, keratinocytes, astrocytes and kidney epithelial cells,
as well as tumor cells from diverse organs,23 although BMP2 can
also bind to the type II receptor Act RIIB.
Numerous studies have examined the effects of TGF-␤1 on
vascular smooth muscle biology. The effects of TGF-␤1 on
cell growth are context specific in that they depend on the
developmental stage at which cells are studied, the tissue of
origin, and the presence of other regulatory factors.24 In
general, TGF-␤1 inhibits the proliferation and migration of
smooth muscle and endothelial cells,25 most likely by inhibition of cyclin-dependent kinases and by downregulation of
c-myc.24 The effects of BMPs on vascular cell growth have
been less extensively investigated, but the emerging consensus is that BMPs inhibit the proliferation of vascular smooth
muscle15 and promote differentiation of smooth muscle phenotype,14 although stimulation of vascular smooth muscle cell
chemotaxis has also been reported.26 Although the present
study showed clear differences in the response to TGF-␤1 and
BMPs in PPH cells, one potential limitation is that we used
cells from large proximal vessels rather than peripheral
arteries, which are considered the main site of disease.
Although these studies demonstrate one of the important
functional consequences of dysfunctional BMPR-II signaling
Morrell et al
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
in PASMCs, the precise molecular mechanism of the altered
responses to BMPs remains to be determined in PPH.
Transient transfection of cell lines with mutant BMPR-II led
to reduced activation of a luciferase reporter construct containing a Smad binding element, which suggests impaired
signaling by Smad proteins.27 The surprising finding in the
present study was the stimulation of DNA synthesis and
proliferation in response to TGF-␤1 in PPH cells. Our data
and those of others suggests that TGF-␤1 is not a ligand for
the BMPR-II receptor,23 which indicates that dysfunctional
TGF-␤ superfamily signaling in PPH cells is more widespread than suggested by mutations in BMPR-II alone.
Potential mechanisms for the abnormal response to TGF-␤1
include loss of TGF-␤RII receptor function, which commonly
occurs as a somatic mutation in pancreatic and colonic
tumors.25,28 However, our mutation analysis, receptor binding, and cross-linking data suggest that an alternative mechanism exists for altered TGF-␤1 responses in PPH cells. An
alternative mechanism may involve reduced activation of
inhibitory Smad proteins as a consequence of loss of
BMPR-II function, which alters the response to other TGF-␤
superfamily members. In support of this, BMPs are potent
inducers of the inhibitory Smads 6 and 7,29 which feed back
to inhibit TGF-␤ receptor signaling. Loss of Smad 6 and
Smad 7 negative feedback might have a permissive effect on
TGF-␤1–induced proliferative responses. In epithelial cells,
resistance to the antiproliferative action of TGF-␤ is a
consequence of failure to downregulate c-Myc and to prevent
cyclin-dependent kinase inhibitory gene responses.24 The role
of these pathways in the abnormal TGF-␤1–induced proliferation of PPH cells requires further study. Furthermore, our
results do not explain the selectivity of PPH for the pulmonary as opposed to the systemic circulation. Because systemic
vascular cells will be similarly affected by germline mutations in BMPR2, additional factors must determine pulmonary vascular selectivity.
In summary, the present study demonstrates that an important
functional abnormality of PASMCs isolated from patients with
PPH is resistance to the antiproliferative effects of TGF-␤1 and
BMPs. This abnormality may result directly from mutations/
dysfunction in BMPR-II and/or closely related signaling pathways. The TGF-␤ superfamily plays a critical role in the
development and maintenance of the integrity of the normal
vasculature. Thus, the altered cellular responses may contribute
to the formation of lesions that lead to the vascular obliteration
observed in the pulmonary arteries of patients with PPH.
Acknowledgments
This study was supported by the British Heart Foundation (program
grant RG/2000012 to Drs Trembath and Morrell). Dr Morrell was
funded by a Medical Research Council Clinician Scientist Fellowship.
References
1. Rubin LJ. Primary pulmonary hypertension. N Engl J Med. 1997;336:
111–117.
2. Pietra GG, Edwards WD, Kay JM, et al. Histopathology of primary
pulmonary hypertension. Circulation. 1989;80:1198 –1206.
3. Cool CD, Stewart JS, Werahera P, et al. Three-dimensional reconstruction of pulmonary arteries in plexiform pulmonary hypertension
using cell-specific markers. Am J Pathol. 1999;155:411– 419.
TGF-␤ Superfamily and Human PASMC Growth
795
4. Deng Z, Haghighi F, Helleby L, et al. Fine mapping of PPH1, a gene for
familial primary pulmonary hypertension, to a 3-cM region on chromosome 2q33. Am J Respir Crit Care Med. 2000;161:1055–1059.
5. Nichols WC, Koller DL, Slovis B, et al. Localization of the gene for
familial primary pulmonary hypertension to chromosome 2q31–32. Nat
Genet. 1997;15:277–280.
6. The International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germ-line mutations in BMPR2, encoding a TGF-␤ receptor,
cause familial primary pulmonary hypertension. Nat Genet. 2000;26:81–84.
7. Deng Z, Morse JH, Slager SL, et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic
protein receptor-II gene. Am J Hum Genet. 2000;67:737–744.
8. Thomson JR, Machado RD, Pauciulo MW, et al. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene
encoding BMPR-II, a receptor member of the TGF-␤ family. J Med
Genet. 2000;37:741–745.
9. Pepper MS. Transforming growth factor-beta: vasculogenesis, angiogenesis,
and vessel wall integrity. Cytokine Growth Factor Rev. 1997;8:21–43.
10. McCaffrey TA. TGF-␤s, and TGF-␤ receptors in atherosclerosis. Cytokine Growth Factor Rev. 2000;11:103–114.
11. Stenmark KR, Mecham RP. Cellular and molecular mechanisms of pulmonary vascular remodeling. Annu Rev Physiol. 1997;59:89 –144.
12. McCaffrey TA, Du B, Consigli S, et al. Genomic instability in the type II
TGF-␤1 receptor gene in atherosclerotic and restenotic vascular cells.
J Clin Invest. 1997;100:2182–2188.
13. Adam PJ, Regan CP, Hautmann MB, et al. Positive- and negative-acting
Kruppel-like transcription factors bind a transforming growth factor beta
control element required for expression of the smooth muscle cell differentiation marker SM22alpha in vivo. J Biol Chem. 2000;275:
37798 –37806.
14. Dorai H, Vukicevic S, Sampath TK. Bone morphogenetic protein-7
(OP-1) inhibits smooth muscle cell proliferation and stimulates the
expression of markers that are characteristic of SMC phenotype in vitro.
J Cell Physiol. 2000;184:37– 45.
15. Nakaoka T, Gonda K, Ogita T, et al. Inhibition of rat vascular smooth
muscle proliferation in vitro and in vivo by bone morphogenetic
protein-2. J Clin Invest. 1997;100:2824 –2832.
16. Morrell NW, Upton PD, Kotecha S, et al. Angiotensin II activates MAPK
and stimulates growth of human pulmonary artery smooth muscle via AT1
receptors. Am J Physiol. 1999;277:L440 –L448.
17. Gao C, Gressner G, Zoremba M, et al. Transforming growth factor ␤
(TGF-␤) expression in isolated and cultured rat hepatocytes. J Cell
Physiol. 1996;167:394 – 405.
18. McCaffrey TA, Consigli S, Du B, et al. Decreased type I/type II TGF-␤
receptor ratio in cells derived from human atherosclerotic lesions. J Clin
Invest. 1995;96:2667–2675.
19. Berg JN, Gallione CJ, Stenzel TT, et al. The activin receptor-like kinase
1 gene: genomic structure and mutations in hereditary hemorrhagic telangiectasia type 2. Am J Hum Genet. 1997;61:60 – 67.
20. BMPR2 Primer sequences. Available at: http://www.leicester.ac.uk/ge/
rt7/index.html. Accessed 2001.
21. Kim S-J, Im Y-H, Markowitz SD, et al. Molecular mechanisms of
inactivation of TGF-b receptors during carcinogenesis. Cytokine Growth
Factor Rev. 2000;11:159 –168.
22. Agrotis A, Samuel M, Prapas G, et al. Vascular smooth muscle cells
express multiple type I receptors for TGF-b, activin, and bone morphogenetic proteins. Biochem Biophys Res Commun. 1996;219:613– 618.
23. Iwasaki S, Tsuruoka N, Hattori A, et al. Distribution and characterization
of specific cellular binding proteins for bone morphogenetic protein-2.
J Biol Chem. 1995;270:5476 –5482.
24. Massagué J, Blain SW, Lo RS. TGF␤ signaling in growth control, cancer,
and heritable disorders. Cell. 2000;103:295–309.
25. Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth
factor ␤ in human disease. N Engl J Med. 2000;342:1350 –1358.
26. Willette RN, Gu JL, Lysko PG, et al. BMP-2 gene expression and effects
on human vascular smooth muscle cells. J Vasc Res. 1999;36:120 –125.
27. Machado RD, Pauciulo MW, Thomson JR, et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary
hypertension. Am J Hum Genet. 2001;68:92–102.
28. Grady WM, Rajput A, Myeroff L, et al. Mutation of the type II transforming
growth factor-beta receptor is coincident with the transformation of human colon
adenomas to malignant carcinomas. Cancer Res. 1998;58:3101–3104.
29. Afrakhte M, Moren A, Jossan S, et al. Induction of inhibitory Smad6 and
Smad7 mRNA by TGF-␤ family members. Biochem Biophys Res
Commun. 2000;249:505–511.
Altered Growth Responses of Pulmonary Artery Smooth Muscle Cells From Patients With Primary
Pulmonary Hypertension to Transforming Growth Factor- β1 and Bone Morphogenetic Proteins
Nicholas W. Morrell, Xudong Yang, Paul D. Upton, Karen B. Jourdan, Neal Morgan, Karen K. Sheares
and Richard C. Trembath
Downloaded from http://circ.ahajournals.org/ by guest on July 31, 2017
Circulation. 2001;104:790-795
doi: 10.1161/hc3201.094152
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2001 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the World
Wide Web at:
http://circ.ahajournals.org/content/104/7/790
Data Supplement (unedited) at:
http://circ.ahajournals.org/content/suppl/2001/08/10/104.7.790.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in
Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once
the online version of the published article for which permission is being requested is located, click Request Permissions in
the middle column of the Web page under Services. Further information about this process is available in thePermissions
and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/
Morrell et al
SUPPLEMENT
TGF-␤ Superfamily and Human PASMC Growth
7
Source of primer sequences and conditions used for RT-PCR
Primers
Annealing
Temperature
Product
Length
Mg2⫹
(mM)
Receptor
Reference and Accession Numbers
TGF␤ R1
McCaffrey et al. J. Mol. Cell. Cardiol. 1999;31:1627–42.
Accession: L11695
sense 5⬘ACCATCGTGAATGGCATC3⬘
antisense 5⬘GCAGGCAGAAAGGAATCAG3⬘
57.5
250
2
Act R1
Carcamo et al. Mol. Cell Biol. 1994;14:3810
Accession: U14722
sense 5⬘TCCAAAGACAAGACGCTCC3⬘
antisense 5⬘ATCATCTTCCCCATCACCC3⬘
60.4
899
2
BMP R1A
Ide et al. Cancer Res. 1997;57:5022–27
Accession: Z22535
sense 5⬘GCATAACTAATGGACATTGCT3⬘
antisense 5⬘TAGAGTTTCTCCTCCGATGG3⬘
51.5
1401
2
BMP R1B
Ide et al. Oncogene 1997;14:1377
Accession: D89675
sense 5⬘CACTCCCATTCCTCATCAAAG3⬘
antisense 5⬘TCAGCAATACAGCAAGTTCC3⬘
59.3
801
2
ALK 1
Alexander et al. J. Clin. Endocrinol. Metab.
1997;81:783–790
Accession: Z22533
sense 5⬘CGACGGAGGCAGGAGAAGCAG3⬘
antisense 5⬘TGAAGTCGCGGTGGGCAATGG3⬘
70.5
565
2
TGF␤ RII
Lin HY et al. Cell 1992;68:775
Accession: M85079
sense 5⬘CCAACAACATCAACCACAACAC3⬘
antisense 5⬘TCATTTCCCAGAGCACCAG3⬘
60.4
678
2
BMP-RII
Accession: U25110
sense 5⬘TAACTACCACTCCTCCCTC3⬘
antisense 5⬘CACCAGTCTATTTCCAGTC3⬘
51.5
791
2
Act R2
Alexander et al. J. Clin. Endocrinol.
Metab. 1997;81:783–790
Accession: D31770
sense 5⬘GCAAAATGAATACGAAGTCTA3⬘
antisense 5⬘GCACCCTCTAATACCTCTGGA3⬘
55.5
434
2
Act R2B
Alexander et al. J. Clin. Endocrinol.
Metab. 1997;81:783–790
Accession: L10640
sense 5⬘CAACTTCTGCAACGAGCGCTT3⬘
antisense 5⬘GCGCCCCCGAGCCTTGATCTC3⬘
55.0
283
1