JPET#166892 The Journal of Pharmacology and Experimental Therapeutics Supplemental data Cholestyramine Reverses Hyperglycemia and Enhances GLP-1 Release in Zucker Diabetic Fatty Rats Lihong Chen, Judi McNulty, Don Anderson, Yaping Liu, Christopher Nystrom, Sarah Bullard, Jon Collins, Anthony L. Handlon, Ryan Klein, Angela Grimes, David Murray, Roger Brown, David Krull, Bill Benson, Elena Kleymenova, Katja Remlinger, Andrew Young, and Xiaozhou Yao JPET#166892 Figure S-1. (A) Body weight; (B) Two-day cumulative food intake (in 2nd week); (C) Dry fecal weight normalized 24-hour fecal bile acids, glycerol, NEFA and triglycerides concentration (in 2nd week); and (D) Serum bile acids (in 5th week). *p<0.05, **p<0.01, ***p<0.001 vs ZDF control group. JPET#166892 Figure S-2. The effects of cholestyramine on serum lipid profile and liver triglycerides. Seven weeks old male ZDF rats were treated with 1.5% or 4.5% cholestyramine for five weeks. Serum samples were collected weekly before and after treatment without fasting for triglycerides (A), total cholesterol (B), NEFA (C), glycerol (D), and bhydroxybutyrate (E) analysis. Liver samples were collected by the end of the study for liver triglycerides measurement (F). *p<0.05, **p<0.01, ***p<0.001 vs ZDF control group. JPET#166892 Figure S-3. Immunohistology analysis of pancreatic islets. (A) Representative images from different treatment groups. Red (Dylight 649): insulin; blue (DAPI): nucleus. (B) Beta cell proliferation index. Immunofluorescence. Rat pancreas, restricted to the “head” region, was fixed in 10% neutral buffer formalin for 24 to 48hr then routinely processed to paraffin block. Sections were cut at four microns and mounted on positively charged slides. Immunofluorescent (IF) staining was performed on the Leica Bond™ Max IHC/ISH staining platform (Leica Microsystems, Bannockburn, IL). Sections were deparaffinized using Bond™ Dewax followed by several rinses in wash buffer. Endogenous rat IgG was blocked using Rodent Block R (Biocare Medical, Concord, CA) for 15 minutes followed by incubation in guinea pig anti-insulin (Dako, Carpinteria, CA) cat# A0564 at 1/1000 for 30 minutes. Primary antibody was detected using a biotinylated goat anti guinea JPET#166892 pig antibody (Vector Laboratories, Burlingame, CA) at 1/150 for 15 minutes followed by incubation in streptavidin Dylight 649 (KPL, Gaithersburg, MD) at 1/250 for 30 minutes. Sections were counterstained in DAPI (Invitrogen, Carlsbad, CA) at 1/5000 for 5 minutes. Images were collected using an Axioplan epifluorescent microscope (Zeiss, Thornwood, NY) with a 20x objective and a HQ620/60x, Q660LP filter set for Dylight 649 and a D350/50x, 400DCLP filter set for DAPI. Immnohistochemistry. A dual chromagenic IHC method was used to label Ki67 positive cells dark brown and insulin red. Nuclei were stained blue with hematoxylin. This method made it possible to use an automated approach to determine the proliferation index of beta cells. Sections were cut and deparaffinized as in the IF method using the Leica Bond™ Max (Leica Microsystems). Endogenous peroxidase was blocked using 3% aqueous hydrogen peroxide for 10 minutes then washed well in wash buffer. Rodent Block R (Biocare Medical) was applied and incubated for 15 minutes. Next, rabbit anti Ki67 (ThermoFisher, Fremont, CA) #RM9106 at 1/400 was applied and incubated for 30 minutes. Primary antibody was detected using a Rabbit on Rodent HRP polymer (Biocare Medical) for 30 minutes followed by Bond™ Refine DAB (Lecia Microsystems) for 10 minutes then Bond™ DAB enhancement for 5 minutes. The second half of the method was performed using the guinea pig anti-insulin antibody (Dako, Carpinteria, CA) cat# A0564 at 1/1000 that was applied and incubated for 30 minutes. The primary antibody was detected using a biotinylated goat anti guinea pig (Vector Laboratories, Burlingame, CA) at 1/150 for 15 minutes followed by an incubation in streptavidin AP (Biocare Medical) for 15 minutes then in Bond™ AP Red chromagen for 15 minutes. Sections were counterstained in Bond™ automation hematoxylin for 5 minutes. Quantitative Imaging Cytometery (QIC). A workspace was created on the iCyte® Laser Scanning Cytometer (CompuCyte, Westwood, MA) for automated counting of Ki67 positive cells within the pancreatic islets. First a low resolution mosaic scan was performed using argon laser excitation to identify individual islets using a 20x objective and 20µm step size. Next, a high resolution field scan was performed on each islet using argon and HeNe laser excitation, a 20x objective and a 0.5µm step size. Ki67 positive cells were only counted if they contained insulin in their cytoplasm that was detected using peripheral contouring. Islet nuclei were counted in a similar manner and also restricted to insulin positive cells using peripheral contouring. Beta cell proliferation index was calculated by dividing the total number of islet nuclei by the Ki67 count. JPET#166892 JPET#166892 Figure S-4. Relationship between baseline-corrected plasma glucose and insulin. The data is from the same study as in figure 1. Figure legends: blue diamond, Zucker lean control; brown square, ZDF control; green triangle, ZDF + 1.5% cholestyramine; and purple cross, ZDF + 4.5% cholestyramine. JPET#166892 Quadrant A: A decrease in glucose with an increase in insulin. This usually suggests that -cells are able to compensate for the increased insulin resistance. Quadrant B: An increase in glucose with an increase in insulin. This usually suggests that the increased insulin secretion is not sufficient to maintain glucose or an increase in insulin resistance. Quadrant C: A decrease in glucose with a decrease in insulin. This is usually associated with an improvement in insulin sensitivity. Quadrant D: An increase in glucose with a decrease in insulin. This is usually caused by -cell failure. Most of the cholestyramine treated animals, especially those in the 4.5% group, were in quadrant D through the study. This analysis suggested that cholestyramine treatment improved insulin sensitivity in ZDF rats. Some ZDF vehicle animals did not have increased plasma glucose at the end of the study. It might be caused by the surgery performed during the third week of treatment. JPET#166892 Table S-1 Primers and probe for qPCR Gene name FXR SHP TGR5 ABCA1 ABCG5 G6Pase SREBP1c LXR LXR PEPCK Forward Primer Reverse Primer Probe TCAGGAGCCTCTGCTCGATG GAGTTCTGTCAGGCGACCCA GATCTACCAGCCCGAGAACCCTCAGCA CCAGCTTGGATTTCCTCGGT CACAGCCTCATGCTCCCATC TGGCTCCCAAAACCTCCAGGCCAATAT TGGCAAGCCTCATCGTCAT AGTGGCGGTCCAGGACAA CCAACCTGCTCCTGGCCCTAGGC CTAAAGCCTGTCCAGGAGTTCTTTG ACAAGGAGGACGGAAGCTGG TCTTTCAGAACACTTCCAGGAAAGGCA GGCTCCAACACTTCTGTGCC GTCGTGAATCTGGACGTGGC TGACCCAAGGGATCCAATTCATTGAGA TTTCTGCAAGAGTGCGACCG GTGTGTCTGTCCCAGGAGCC TCCCCTTTGCATCTGTCAGTCTTATCCC TACTCCTTCAAGGCTGCCCG GCAGGTACCCACTGGCCTTC TGCTGGACCACAGAAAGGTGGAATCCA GAGGACCAGATCGCCTTGCT CTCCCAGGGTTGTACCTCCG CTGCGATCGAGGTGATGCTTCTGGAGA CCCAGCCTTGGTGGTGTCTAC GGGACTGGGCTGTGACAGTG TGCAGATGGACGCTTCCTTTGCCTTTC CGTGCTGGAGTGGATGTTCG GCCTTTCAAGTTCAGGGCG AAGCTCACTCCCATTGGCTACGTCCCT
© Copyright 2026 Paperzz