International Journal of Plant Research 2015, 5(4): 87-95
DOI: 10.5923/j.plant.20150504.03
Arabidopsis thaliana GCN2 is Involved in Responses
to Osmotic and Heat Stresses
Brenna C. Terry, Xiaoyu Liu, Audrey M. Murphy, Karolina M. Pajerowska-Mukhtar*
Department of Biology, University of Alabama at Birmingham, Birmingham, USA
Abstract Heat, drought, and excess soil solutes are common abiotic stresses placed upon terrestrial plants by their
natural environments. While such conditions are unavoidable, plants have evolved mechanisms of maintaining cellular
homeostasis in the event of abiotic stress. Key regulatory factors often play essential roles in coordinating plants responses
to a variety of stresses. One of such global regulators in Arabidopsis thaliana is General Control Nonderepressible 2
(GCN2), a kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (eIF2α) in response to
amino acid starvation, phytohormones, and various external stresses. GCN2 phosphorylation of eIF2α halts translation,
allowing for alleviation of the Endoplasmic Reticulum stress, and this mechanism is evolutionarily conserved across
eukaryotes. Our data supports a role for GCN2 in response to abiotic stresses in plants. We assayed gcn2 loss-of-function
mutant plants for their responses to heat, drought, and osmotic stress stimulated by salt and alcohol, using gene expression,
root growth, and biomass as parameters. We concluded that GCN2 acts as a negative regulator of plant responses to abiotic
stresses but has a positive role in root growth under normal growth conditions. Exploring the GCN2 regulation of plant
abiotic stress responses offers a possible point of intervention for agricultural and horticultural applications.
Keywords Arabidopsis thaliana, GCN2, Abiotic stress, Salinity, Heat, Osmotic stress, Drought
1. Introduction
As sessile organisms, plants grow in an inconstant
environment that cannot be escaped and frequently imposes
constraints on growth and development. Among the adverse
environmental factors commonly encountered by land
plants are extreme temperatures and osmotic stress caused
by high salinity conditions or periods of drought [1]. They
have, however, evolved adaptive homeostatic cellular
mechanisms to enable them to effectively cope with these
stresses, and such mechanisms require the proper perception
of specific stresses and signal transduction to function and
promote survival. Some responses may be stress-specific,
while others may protect the plant from multiple adversities.
A number of perception and signal transduction pathways
exist in plants. While recent genetic and biochemical
studies provided a wealth of information about the
contributions of various stress response pathways, detailed
mechanistic underpinnings underlying the coordination of
stress responses have yet to be identified [2].
In eukaryotic organisms, polypeptides are translated on
ribosomes and then translocated to the endoplasmic
reticulum (ER), where they undergo modification ,
* Corresponding author:
[email protected] (Karolina M. Pajerowska-Mukhtar)
Published online at http://journal.sapub.org/plant
Copyright © 2015 Scientific & Academic Publishing. All Rights Reserved
assembly, and chaperone-assisted folding before being
exported from the cell or bound to a cellular membrane.
These post-translation modifications ensure proper function
of the resulting proteins [3, 4]. When stresses, including
those imposed on the plant by the environment, become
excessive, the cells attempt to alleviate the adversity by
translating high levels of polypeptides. These polypeptide
chains must be exported to the ER to be folded, but an
abundance of unfolded chains at times can exceed the
capacity of the ER and result in ER stress, characterized by
the accumulation of misfolded proteins within the ER
lumen. ER stress can activate the unfolded protein response
(UPR), a protective mechanism that can be effective in the
restoration of ER function and cellular growth by
upregulating genes necessary for proper folding,
degradation of misfolded polypeptides, and activation of
autophagy. While UPR is an effective mechanism to regain
cellular homeostasis following exposure to mild or
short-lasting stress, under severe or prolonged stress
conditions the cell might instead initiate the programmed
cell death sequence [5-7].
Translation of mRNA requires the presence of initiation
factors, particularly the family of eukaryotic initiation
factors (eIF), all of which vary among plant, animal, and
yeast species. eIF2 is one initiation factor that has been
conserved among many eukaryotes, but differs among
species in its regulation [8]. In mammals and yeasts, alpha
subunit of eIF2 (eIF2α) is phosphorylated in response to
88
Brenna C. Terry et al.: Arabidopsis thaliana GCN2 is Involved in Responses to Osmotic and Heat Stresses
stress, which shuts down protein synthesis. This
translational block is achieved by inhibiting the exchange of
GDP for GTP via the interaction between eIF2α-GDP with
the guanine nucleotide exchange factor eIF2B [9, 10]. A
ternary complex comprising eIF2α, GTP, and tRNAimet is
necessary for translation to occur, as it forms a part of the
43S pre-initiation complex that scans mRNA in the 5’ to 3’
direction in search of an initiation codon to begin
elongation of the polypeptide chain. Phosphorylation of
eIF2α prevents the formation of the ternary complex and
therefore inhibits translation of the mRNA into the target
protein [11]. One well-studied kinase of eIF2α is GCN2
(General Control Nonderepressible 2), which is involved in
regulating translation during amino acid deprivation in
eukaryotes. GCN2 is a transmembrane serine-threonine
kinase that is activated by the binding of its C-terminus to
uncharged transfer RNAs (tRNAs). This binding is
triggered by starvation and amino acid deprivation and
leads to a conformational change in the protein that
activates its kinase activity [11-13]. Subsequent
phosphorylation of eIF2α results in attenuation of mRNA
translation and a reduction of unfolded polypeptides in the
ER. The GCN2-eIF2α signaling can crosstalk with UPR
pathway for the restoration of ER homeostasis and cellular
adaptation mechanisms [14].
In the current study, we investigated the contribution of
Arabidopsis thaliana GCN2 in responses against a range of
abiotic
stresses,
including
heat,
drought
and
hyperosmolarity. Our results demonstrate that GCN2 acts as
a negative regulator of growth in response to osmotic and
drought stresses and is required for transcriptional induction
of a stress-inducible transcription factor TBF1. Collectively,
our data shed light on the roles of this universal regulator in
plant responses to adverse environmental conditions.
2. Materials and Methods
2.1. Plant Material
Present study includes two genotypes of Arabidopsis
thaliana (L.) Heynh., the wild-type accession Landsberg
erecta (Ler) and gcn2 Genetrap insertion line GT8359 in Ler
genetic background. The gcn2 line disrupts locus At3g59410
and was obtained from Cold Spring Harbor Laboratory, New
York. For heat shock and drought experiments, seeds were
sown on Super Fine Germination Mix soil and incubated at
4°C for 72h. The pots with seeds were then transferred to a
controlled growth facility with a 12h light/12h dark
photoperiod at 21°C with 100 μmol/m2/s light intensity and
40% relative humidity. Plants were allowed to grow over the
next 10-12 days, then transplanted into a 72-well flat, where
they continue growing until 5 weeks old. For salinity and
mannitol experiments, 50-75 seeds per genotype were
sterilized by soaking for 2 min in 70% ethanol, followed by 2
min in 100% ethanol and plated on full-strength strength
Murashige and Skoog (MS) [15] until ready to receive
treatment.
2.2. Heat Stress
Five-week-old plants were placed in an incubator at 37°C
for a period of thirty minutes, with a control set of identical
genotypes kept at room temperature. Four plants per
genotype per treatment were included and two technical
replicates were performed per genotype per biological
replicate. Following heat shock, four leaves from each
genotype (one leaf per plant) from each technical replication
were collected, and RNA isolated from the samples was used
for real-time polymerase chain reaction (qRT-PCR) to
compare any differences in gene transcript levels between
the wild-type and mutant genotypes following heat stress
conditions for varying time periods.
2.3. RNA Extraction and q-PCR
Total RNA was extracted from each sample using TRIzol
reagent (Invitrogen) and concentration were measured by
BioPhotometer Plus (Eppendorf) as described previously
[16]. DNA contamination was removed by DNase I
(Ambion) treatment. The cDNA were generated by reverse
transcription through the SuperScript III first-strand
RT-PCR kit (Invitrogen). The relative abundance of
transcript was determined using GoTaq qPCR Master Mix
(Promega) in a RealPlex S MasterCycler (Eppendorf). The
following primer sequences were used: BiP2-F 5’
GACGCCAACGGTATTC 3’, BiP2-R 5’ TGTCTCCAGG
GCATTC 3’; TBF1-F 5’ GTTGGTTCGCCTTCTG 3’;
TBF1-R 5’ CCACACCCCAAACAAT 3’, GCN2-F 5’
CAACACTTTCCCGTTTGCAG
3’,
GCN2-R
5’
GTTGACACTGCACCTGAGTAG 3’, UBQ5-F 5’
GTAAACGTAGGTGAGTCC
3’,
UBQ5-R
5’
GACGCTTCATCTCGTCC 3’.
2.4. Drought Treatment
Two-week-old Ler and gcn2 seedlings were transplanted
in 72-well flats in a randomized way and grown for another
10 days with adequate water supply. At this point, water
was withdrawn from one flat to induce drought conditions
for 13 days while water was provided normally to the
control flat. Then, both flats were watered again for a
three-day recovery period. Following the recovery, aerial
parts of plants were harvested and fresh weights were
determined for the control and drought flats. The flats were
dried for one day in an oven, and another weight
measurement was taken to compare the masses of each
genotype between the control and drought conditions.
2.5. Mannitol Treatment
Sterilized Ler and gcn2 seeds were germinated and
pre-grown on solid, full-strength MS media for one week in
a growth room, then transplanted onto new solid MS plates
containing increasing concentrations of the six-carbon sugar
alcohol mannitol (Fisher Scientific): 0 mM, 100 mM, 150
mM, 200 mM, 250 mM, 300 mM, and 350 mM and grown
vertically in a growth facility. Ler and gcn2 seedlings were
planted side-by-side on each plate, with a total of 72
International Journal of Plant Research 2015, 5(4): 87-95
seedlings per genotype grown for each mannitol
concentration. Beginning with one day following plating in
mannitol, the root lengths were tracked each morning for
four consecutive days, with the tips of each root marked for
each genotype on the plate. ImageJ (http://imagej.nih.gov/ij/)
was used to measure daily incremental root growth.
2.6. Salinity Stress
Sterilized Ler and gcn2 seeds were germinated and
pre-grown on solid, full-strength MS media for four days in
a growth room, then transplanted onto new solid MS plates
containing increasing concentrations of the sodium chloride
(Fisher Scientific): 0 mM, 100 mM, 125 mM, 150 mM, and
200 mM and grown vertically in a growth facility. Root
lengths of each genotype were marked daily for four
consecutive days, then measured and analyzed via the
ImageJ software. Values were compared to those of roots
grown in absence of salt to evaluate the extent of reduction
in root elongation rates for each NaCl concentration.
89
MS-grown roots, it caused a less dramatic effect on the
gcn2 seedlings, which were still growing at the rate of
83.5% of the non-stressed grown plants. At day 2
post-exposure to salt stress, enhanced tolerance of the gcn2
plants became even more pronounced and was detected on
all salt concentrations tested. This trend was maintained
throughout the remainder of the experimental period
assayed. The lowest tested concentration, 100 mM NaCl,
only marginally affected the gcn2 seedlings, while it caused
a clear reduction in the Ler root elongation (~78% by day 4).
Growth on 200 mM NaCl, the highest concentration tested,
severely retarded root elongation of both genotypes;
however, the gcn2 plants still exhibited a trend of a
heightened tolerance (Fig. 2). Overall, we concluded that
loss of GCN2 function leads to a defect in the rates of
seedling root elongation under regular growth conditions,
but confers reduced sensitivity to salt stress.
3. Results
3.1. gcn2 Mutant is More Tolerant to Salinity Stress
GCN2-induced phosphorylation of eIF2α has been well
documented to occur upon mechanical stress and several
phytohormones or their precursors known to be involved in
plant growth and development [17]. However, genetic
evidence linking the GCN2 function in cellular physiology
is still limited. We employed a traditional seedling root
elongation assay on solid MS plates to measure temporal
root growth of vertically grown Ler and gcn2 plants. We
noted that the gcn2 mutants display a moderate, but
statistically significant reduction in root length compared to
Ler, when grown under non-stress conditions (Fig. 1). This
observation prompted us to investigate the relative
reduction in the speed of root elongation in each genotype,
rather than simply quantifying the absolute root lengths
under diverse abiotic stress conditions.
Osmotic stresses are known to activate yeast GCN2 [18].
To shed light on the involvement of GCN2 in responses to
hyperosmolar conditions, we assayed root growth of Ler
and gcn2 plants on media supplemented with increasing
concentrations of salt, representing mild, moderate and
severe salt stress. We transferred regular MS-grown,
four-day-old Ler and gcn2 seedlings on plates
supplemented with 0, 100 mM, 125 mM, 150 mM and 200
mM NaCl and tracked their root elongation in daily
increments over a four-day period. We then compared the
resulting values to those of roots grown under no salt stress.
Starting on day 1 after transfer on NaCl-supplemented
media, there was a noticeable difference in the rates of root
elongation between the Ler and gcn2 seedlings (Fig. 2).
While the salinity stress of 125 mM NaCl slowed down root
elongation of Ler seedlings to 75% of that of the regular
Figure 1. Average Ler and gcn2 root length elongation under non-stress
conditions. A comparison between the daily incremental root length
elongation (cm) in each genotype was made for seedlings grown on solid
MS plates for four days. Error bars represent standard error. Statistical
analysis was performed with Student’s t-test comparing Ler to gcn2 values,
*** p<0.001. Experiments were repeated in three independent biological
replications with similar results
Figure 2. Rates of root elongation in salt-stressed Ler and gcn2 seedlings.
For each increasing NaCl concentration over a period of four days, the root
length elongation as a percentage of the elongation under non-stress
conditions is displayed for each genotype. Error bars represent standard
error. Experiments were repeated in three independent biological
replications with similar results
Brenna C. Terry et al.: Arabidopsis thaliana GCN2 is Involved in Responses to Osmotic and Heat Stresses
3.2. Loss of GCN2 Confers Increased Tolerance to
Osmotic Stress
A
Fresh weight [mg]
600
500
400
300
200
100
0
Ler
B
***
100
80
60
40
20
0
Ler
**
***
Ler-150
***
***
gcn2-150
Ler-250
% root length
80
gcn2-250
*
**
Ler-350
*
60
gcn2-350
***
***
***
40
gcn2
C
8
6
***
4
2
0
Ler
100
gcn2
120
Fresh weight [mg]
To corroborate our findings on the GCN2 involvement in
osmotic stress responses, we next tested responses of the
gcn2 plants to mannitol, a sugar alcohol that is well known
as an osmotic stress-imposing agent. We grew Ler and gcn2
seedlings on regular MS media plates for one week, then
transferred them on fresh MS plates supplemented with
mannitol concentrations ranging from 0 mM to 350 mM.
The growth of roots was assayed daily for four days.
Similar to the salt stress experiment described above, the
values were adjusted for the generally decreased
elongational growth of the gcn2 roots under basal
conditions. In agreement with our observations from the
salinity stress, we observed that the gcn2 plants consistently
outperformed Ler when grown under mannitol stress. After
the first day of exposure, the lowest mannitol concentration
tested, 150 mM, had no significant effects on the gcn2
plants, while causing a reduction of Ler root elongation
down to 88% compared to regular MS-grown plants. This
trend was maintained throughout the entire experimental
period, culminating on day 4, when the Ler root elongation
decreased to 66% while the gcn2 seedlings displayed a
nearly-normal growth rate of 89%. As expected, higher
mannitol concentrations imposed stronger osmotic stress
and led to more profound root elongation defects. After a
four-day-long exposure to 350 mM mannitol, the Ler roots
were dramatically shorter and attained to only ~25% length
of the non-stressed plants.
In contrast, even under these extreme osmotic stress
conditions, the gcn2 seedlings continuously elongated their
roots at 77, 67, 50 and 48% of the control plants on each
day of the assayed period, respectively. This indicates high
levels of tolerance against this form of abiotic stress in the
gcn2 plants, further confirming our earlier observations.
Water loss ratio
90
gcn2
Figure 4. Fresh weights and water loss ratios under drought stress. (A)
fresh weight (in mg) of plants grown under non-drought conditions; (B)
weights for plants following drought stress and a period of recovery; (C)
comparison of water loss between Ler and gcn2 plants, which was
calculated as a ratio of the mass of non-stressed to that of stressed plants.
Error bars represent standard error. Statistical analysis was performed with
Student’s t-test, *** p<0.001. Experiments were repeated in three
independent biological replications with similar results
3.3. gcn2 Mutant Exhibits Decreased Sensitivity to
Drought-triggered Dehydration and Improved
Recovery Following Drought
20
0
1
2
3
4
time [days]
Figure 3. Average Ler and gcn2 root length elongation under non-stress
conditions. A comparison between the daily incremental root length
elongation (cm) in each genotype was made for seedlings grown on solid
MS plates for four days. Error bars represent standard error. Statistical
analysis was performed with Student’s t-test comparing Ler to gcn2 values,
*** p<0.001. Experiments were repeated in three independent biological
replications with similar results
To look deeper into the roles of GCN2 in environmental
stress responses, we next chose to test their reaction to
drought, which is another factor that can cause osmotic
stress. Since both salt and water deficit make it difficult for
plants to uptake water from soil, plants developed several
common mechanisms to respond and deal with these
stresses, with the phytohormone abscisic acid (ABA) being
the central node of convergence between these two
International Journal of Plant Research 2015, 5(4): 87-95
Under natural conditions, drought stress is usually caused
by a combination of insufficient irrigation and elevated
ambient temperatures. For Arabidopsis, a temperate climate
plant, heat stress is defined as exposure to temperatures that
are 10-15°C above its thermal optimum of 23-25°C.
Previous work determined that 30°C is considered a
moderate heat stress for Arabidopsis, while 37°C represents
extreme heat stress [20]. Given that moderate heat stress
fails to induce expression of heat-responsive marker genes
[20], we chose to expose the gcn2 plants to acute heat
treatment. We subjected unstressed, five-week-old soilgrown Ler and gcn2 plants to incubation at 37°C for 30
minutes and subsequently evaluated the downstream
transcriptional responses in heat-stressed plants compared
to control individuals maintained at room temperature. We
assayed expression levels of three well established stress
marker genes: GCN2, TBF1 (also known as heat shock
factor HsfB1) [16], and BiP2, a chaperone of the heat shock
protein 70 (Hsp70) family. We observed that GCN2 itself is
a heat-inducible gene: in Ler plants its expression nearly
doubled following 30 minutes of heat shock (Fig. 5). As
expected, the gcn2 mutant showed only residual levels of
the GCN2 transcript, confirming that it is a null allele. Our
subsequent analyses indicate that TBF1 is differentially
expressed in the gcn2 plants. While its transcript levels are
0.006
GCN2/UBQ5
Ler
gcn2
0.004
0.002
0
0
0.5
0.15
TBF1/UBQ5
3.4. GCN2 is Required for full transcriptional induction
of heat shock-like factor TBF1, but not BiP2,
Following Heat Stress
still heat-inducible, the overall transcript accumulation is
significantly lower than that of Ler (Fig. 5). Finally, we
tested the expression of BiP2, which was shown to be a
direct transcriptional target of TBF1 under biotic stress but
not under heat stress [16]. Intriguingly, we found BiP2
basal levels to be diminished in the gcn2 plants, but its
inducibility was completely unaffected by the GCN2
loss-of-function mutation (Fig. 5). These data indicate that
GCN2 might also be required in a feedback mechanism to
control cellular homeostasis under diverse environmental
stresses.
0.1
***
0.05
0
0
0.5
0
0.5
1.2
BiP2/UBQ5
pathways [19]. We withdrew water from unstressed,
soil-grown 24-day-old Ler and gcn2 plants and allowed the
drought stress to build up over the next 13 days. Then, we
watered the plants and allowed for a three-day rehydration
and recovery period. At this point, we collected the entire
aerial rosette parts of the plants and determined their fresh
weight (Fig.4). Throughout the entire period of this assay,
we also maintained a control, well-watered population of
plants that was evaluated for fresh weight akin to their
drought-stressed counterparts. These control plants did not
display a significant difference in the rosette size (Fig. 4a).
After the drought period was complete, plants of both
genotypes displayed symptoms of dehydration, such as
wilting and various degrees of chlorotic leaf discoloration;
however, the extend of these symptoms was somewhat
more profound in the Ler plants. Strikingly, the gcn2
mutant plants performed significantly better at the recovery
from drought and weighted nearly 40% more than Ler (Fig.
4b). We also calculated a water loss ratio for each genotype
by dividing its average fresh weight of control plants over
the corresponding weight of drought-exposed individuals. A
much lower ratio of 5.2 in the gcn2 plants indicated that this
genotype can cope better with dehydration and has the
ability to recover more promptly than Ler wild-type (ratio
of 7.2) (Fig. 4c). Collectively, we conclude that the gcn2
mutant plants consistently display an enhanced tolerance to
osmotic stresses of various origins.
91
0.9
0.6
0.3
0
time [h]
Figure 5. Transcript accumulation of GCN2, TBF1, and BiP2 at basal
levels and following heat stress for 30 minutes. Error bars represent standard
error. Statistical analysis was performed with Student’s t-test, *** p<0.001.
Experiments were repeated in three independent biological replications with
similar results
92
Brenna C. Terry et al.: Arabidopsis thaliana GCN2 is Involved in Responses to Osmotic and Heat Stresses
4. Discussion
for osmotic tolerance, employing mannitol, unequivocally
demonstrated that the gcn2 plants were more tolerant to
4.1. GCN2 Acts as a Negative Regulator of Growth in
hyperosmotic conditions as illustrated by a less dramatic
Response to Osmotic and Drought Stresses
reduction in root elongation. Similar to our results with salt
Drought and consequently osmotic stress has increasingly stress, the amplitude of this response was directly correlated
become a world-wide issue, representing one of the costliest with mannitol concentration.
Our recent work suggested that GCN2 is involved in
of natural disasters [21] with a severely detrimental impact
on plants, particularly with concern to crop yields. Drought plant responses to the phytohormone gibberellic acid (GA),
leads to a disruption of osmotic homeostasis in plant cells, as exemplified by delays in seed germination, increased
which rely heavily on water for basic metabolic processes accumulation of chlorophyll, changes in leaf blade
including photosynthesis and nutrient transport throughout morphology and altered expression of GA marker genes
the organism. When plant cells are exposed to a solute-rich [15, 30]. It has been previously shown that GA plays a
environment, water leaves the cell through its central role in a number of plant responses to abiotic
semi-permeable membrane in an attempt to create a balance stresses [31]. Under salt stress, survival is enhanced by
of solute and solvent on each side of the membrane through reduced GA response. In Arabidopsis seedlings, exposure to
basic osmosis. As plant cells require a high volume of water salinity was shown to trigger a reduction in endogenous
to perform basic metabolic functions, including bioactive GAs [32, 33], which coincided with inhibitory
photosynthesis, excessive water loss through such osmotic DELLA accumulation [32]. This indicates that salinity
stress can inhibit growth and production [22]. Salinity is stress leads to attenuation of GA responses in wild-type
one major environmental stress that may limit plant plants. In addition, it was also demonstrated that GA
productivity or lead to death. Soils may contain an excess of treatment decreases survival in wild-type plants grown on
salts, most notably sodium and chloride ions. A high salt NaCl, but a GA-deficient biosynthetic mutant ga1-3
environment leads to reduction of the cellular water exhibiting reduced GA signaling, displayed normal growth
potential and disruption of ion homeostasis, resulting in and survival patterns [32]. In another study, seedlings were
both osmotic and ionic stress and therefore altering growth exposed to a low concentration of mannitol, which resulted
and productivity of the plant [23]. Cells of some plants, in a 50% reduction in final leaf size as a result of effects on
including Arabidopsis, may cope by compartmentalizing both cell proliferation and cell expansion [34, 35].
the excess ions away from the cytosol and to the vacuole Differential expression of GA metabolism genes, as well as
via Na+/H+ antiporters, which are encoded by the AtNHX1 accumulation of the GA repressors DELLA proteins and
gene [24], while other species may secrete salt from salt RGA, were observed in proliferating cells of
glands or selectively exclude solutes [23]. Later research, mannitol-treated seedlings [35, 36]. GAs also play a role in
however, revealed that repression of global protein plant responses to soil drying and drought [31, 37]. In a
translation is another primary mechanism involved in study investigating the effects of drought on the
coping with saline stress [25]. This evidence was later transcriptome of emmer wheat, it was reported that this
confirmed by the finding that protein synthesis decreased treatment was associated with a decrease in a GA
significantly in Arabidopsis and rice cells exposed to 200 biosynthetic gene GA2ox expression in the roots [38]. This
mM NaCl [26]. In addition, translation was also repressed is consistent with the need to maintain root growth under
in plants treated with 300 and 400 mM concentrations of water deficit, allowing a redistribution of growth between
roots and shoot. It is plausible that the diminished GA
sugar alcohol mannitol [26].
Previous studies have determined that solute-driven responses in the gcn2 plants offer them an adaptive
osmotic stress promotes Gcn2 activation in yeasts [17, 27], advantage to survive under water-limiting conditions. It is
and GCN2 activation leading to eIF2α phosphorylation has well established that reduced water availability, which is
been demonstrated in animal cells as well, including in the first perceived by the roots, results in closure of the leaf
ability of mammalian renal medulla cells to cope with high stomata and the resulting reduction in transpiration, at least
urea levels [28]. In contrast to the study by Lageix et.al. [17] in part through the action of the stress hormone ABA [39].
that failed to detect eIF2α phosphorylation following NaCl Our recent results show that the gcn2 mutants contain
exposure, our genetic evidence clearly demonstrates that elevated levels of ABA and enhanced epidermal defenses
GCN2 is implicated in responses to salinity stress. Possible against pathogen infection [40], indicating a possible
explanations for this seemingly contrasting observation crosstalk between GA and ABA that is mediated via GCN2
include a different experimental set-up and the fact that our action under both biotic and abiotic stresses. Such crosstalk
experiment followed the whole-plant phenotype over a could be mediated by the RING-H2 zinc finger factor
period of four days, while Lageix and colleagues exposed XERICO that regulates tolerance to drought and ABA
the seedlings to salt treatment for four hours. Further biosynthesis in Arabidopsis [41]. XERICO is a
supporting our results is the fact that Gcn2 activity has been transcriptional downstream target of DELLA proteins [42]
previously cited in response to osmotic stresses including and is transcriptionally induced in the gcn2 plants [15].
salinity in yeast [29]. In addition, our complementary test
International Journal of Plant Research 2015, 5(4): 87-95
4.2. Expression of Heat-shock Factor TBF1, but not of
BiP2, is Dependent on GCN2 in Response to Heat
Stress
Plants, like many other organisms, can experience an
adverse reaction to excessive heat exposure. Many
biochemical processes in plants are heat-sensitive, and
normal plant functions such as growth, reproduction, and
photosynthesis can be disrupted by heat stress. Heat can also
cause irreversible damage to cell structures, such as the
plasma membrane, as well as cell death. Plants have evolved
both short-term and long-term heat tolerance responses to
minimize or prevent damage during heat stress, and
understanding such mechanisms may play a role in the
ability to protect plant species, especially as the temperature
of the Earth’s atmosphere is predicted to rise in the next few
decades [43].
Both transcriptional and translational alterations following
stress, including initiation factor phosphorylation and
translation reduction, have been cited as mechanisms for the
plant response to heat [44, 45]. One mechanism of heat
tolerance studied in Arabidopsis is the interaction of
dehydration-responsive element binding protein 2A, or
DREB2A, with a trimer comprising a DNA polymerase II
subunit and two nuclear factors to activate a promoter of
heat-stress inducible genes, enhancing expression of these
genes [46]. DREB2A was also demonstrated to be regulated
by osmotic stress and ABA (Kim et al. 2012), providing
further evidence for a role of GCN2 in coordinated
regulation of various abiotic stress responses. STZ/ZAT10 is
a zinc-finger protein whose translation is induced by heat
stress [45] as well as salinity and osmotic stress (Mittler et al.
2006), and eIF2α phosphorylation has been determined to
regulate heat stress response in wheat embryos [44]. A
correlation between heat tolerance and expression of a series
of heat-shock proteins (HSPs) has been observed in higher
plants [47]; Arabidopsis strains expressing low levels of
HSP101 demonstrated a low capacity for heat tolerance [47],
while exposure to a temperature of 40°C has been
demonstrated to induce heat shock protein expression and an
overall decrease in the synthesis of normal proteins in
soybeans [48]. Roles of HSPs in heat response may include
protein folding, assembly, degradation, stability, and
translocation, as well as regulation of misfolded proteins
following high stress [49]. In addition, wheat HSP101
paralogs were shown to be activated by drought and ABA
application, implicating an existence of an intricate crosstalk
between various abiotic stress response pathways (Campbell
et al. 2001). Further research revealed that a suite of HSP
families and over twenty heat-shock transcription factors
(Hsfs), each interacting in a complex signaling network, are
responsible for heat tolerance, as well as response to other
abiotic stresses through signaling pathway overlap [16, 50].
TL1-binding transcription factor 1, or TBF1 (also known
as HSFB1), is a heat-shock factor-like protein that binds to
the TL1 cis-element of the promoters of ER-resident genes
which assist post-translational modifications in response to
93
stress. TBF1 translation appears to be regulated by upstream
open reading frames (uORFs) located upstream from the 5’
end of the TBF1 start codon [16]. uORFs are often located
upstream of key cellular growth and proliferation regulators,
such as proto-oncogenes and receptors and proteins involved
in immune responses [51], and play a regulatory role in
translation, though they are capable of repressing and
enhancing translation, depending on the reading frame
sequences and genes downstream. In the instance of
translation repression, ribosomes, following recognition of
uORFs in an mRNA sequence, halt elongation of a
polypeptide and therefore alter the expression of the gene
through impedance of further translation [52]. uORF activity
is sensitive to stress, including metabolic changes resulting
from amino acid starvation, and is regulated by
GCN2-mediated phosphorylation of eIF2α. For instance,
pathogen infection leading to an increase in uncharged
phenylalanine tRNA accumulation triggers eIF2α
phosphorylation in Arabidopsis, which results in TBF1
translation through alleviation of uORF repression of its
expression by allowing direct ribosomal attachment to the
TBF1 start codon [16]. Luminal binding protein 2, or BiP2, is
a molecular chaperone belonging to the HSP70 family and is
located in the ER, where it is involved in nascent peptide
folding, protein translocation, and quality control. The BiP2
promoter contains four TL1 elements that specifically bind
TBF1 in vitro and in vivo, and its expression is compromised
in tbf1 mutants upon salicylic acid application [16]. Given
the existing connection between GCN2, the heat shock factor
TBF1 and the heat shock chaperone BiP2, we tested their
relationship at the transcriptional level. Our results indicate
that GCN2 might indirectly control TBF1 transcript levels
upon heat stress. In the gcn2 plants, translation of TBF1 is
repressed and so is transcription of its direct transcriptional
target genes. Given that the TBF1 promoter itself contains
TL1 elements, it is plausible that upon heat stress, TBF1
transcription and translation are controlled by a
GCN2-mediated positive feedback loop. In contrast, the
unaltered levels of BiP2 expression in the gcn2 plants
following heat shock indicate that plants use a
TBF1-independent route for transcriptional induction of
BiP2 under abiotic stress conditions, as indicated previously
[16].
5. Conclusions
Collectively, our results reveal a role for GCN2 in abiotic
stress responses in Arabidopsis. Drought and osmotic
stresses are frequent factors that can impede plant growth in
the terrestrial ecosystem, and loss of GCN2 function results
in enhanced tolerance to these stresses. Although the lack of
functional GCN2 protein seems to have positive influence on
plant survival under many forms of abiotic stress, its central
and indispensable role in regulating global translation
ensures that this key protein has been preserved during the
evolution of eukaryotes. For example, our data illustrate that
94
Brenna C. Terry et al.: Arabidopsis thaliana GCN2 is Involved in Responses to Osmotic and Heat Stresses
GCN2 controls at least a part of essential heat shock
responses and thus, must be maintained as a part of the
stress-dependent translational regulatory machinery. In this
regard, future directions may involve targeting the GCN2
gene in applied plant breeding, with a focus on agricultural
and horticultural interventions to ensure the profitable and
stable production of economically important plants with
increased heat, drought, and solute osmotic stress tolerance.
ACKNOWLEDGEMENTS
The authors wish to acknowledge Dr. Shahid Mukhtar for
critically reading the manuscript. This work was supported
by NSF-CAREER award (IOS-1350244) to KPM.
REFERENCES
[1]
[2]
[3]
[4]
[5]
Hasanuzzaman M., Nahar K., Fujita M. 2013, Plant Response
to Salt Stress and Role of Exogenous Protectants to Mitigate
Salt-Induced Damages. In: Ahmad P., Azooz M.M., Prasad
M.N.V., editors. Ecophysiology and Responses of Plants
under Salt Stress: Springer New York; p. 25-87.
Chinnusamy V., Schumaker K., Zhu J.K., 2004, Molecular
genetic perspectives on cross‐talk and specificity in abiotic
stress signalling in plants., Journal of Experimental Botany,
55:225-36.
Ron D., Walter P., 2007, Signal integration in the
endoplasmic reticulum unfolded protein response., Nat Rev
Mol Cell Biol, 8:519-29.
Wahyu Indra Duwi F., Lee S.Y., Lee K.O., 2013, The
unfolded protein response in plants: A fundamental adaptive
cellular response to internal and external stresses., Journal of
Proteomics, 93:356-68.
Howell S.H., 2013, Endoplasmic Reticulum Stress Responses
in Plants., Annual Review of Plant Biology, 64:477-99.
[6]
Ruberti C., Brandizzi F., 2014, Conserved and plant-unique
strategies for overcoming endoplasmic reticulum stress.,
Frontiers in Plant Science, 5:69.
[7]
Hetz C., 2012, The unfolded protein response: controlling cell
fate decisions under ER stress and beyond., Nat Rev Mol Cell
Biol, 13:89-102.
[8]
Muñoz A., Castellano M.M., 2012, Regulation of Translation
Initiation under Abiotic Stress Conditions in Plants: Is It a
Conserved or Not so Conserved Process among Eukaryotes?,
Comparative and Functional Genomics, 2012:8.
[9]
Zhang Y., Wang Y., Kanyuka K., Parry M.A.J., Powers S.J.,
Halford N.G., 2008, GCN2-dependent phosphorylation of
eukaryotic translation initiation factor-2α in Arabidopsis.,
Journal of Experimental Botany, 59:3131-41.
[10] Browning K.S., 2004, Plant translation initiation factors: it is
not easy to be green., Biochemical Society transactions,
32:589-91.
[11] Wek R.C., Jiang H.Y., Anthony T.G., 2006, Coping with
stress: eIF2 kinases and translational control., Biochemical
Society transactions, 34:7-11.
[12] Faus I., Zabalza A., Santiago J., Nebauer S.G., Royuela M.,
Serrano R., et al., 2015, Protein kinase GCN2 mediates
responses to glyphosate in Arabidopsis., BMC Plant Biol,
15:14.
[13] Li M.W., AuYeung W.K., Lam H.M., 2013, The GCN2
homologue in Arabidopsis thaliana interacts with uncharged
tRNA and uses Arabidopsis eIF2α molecules as direct
substrates., Plant Biology, 15:13-8.
[14] Hamanaka R.B., Bennett B.S., Cullinan S.B., Diehl J.A.,
2005, PERK and GCN2 Contribute to eIF2α Phosphorylation
and Cell Cycle Arrest after Activation of the Unfolded Protein
Response Pathway., Molecular Biology of the Cell,
16:5493-501.
[15] Liu X., Merchant A., Rockett K.S., McCormack M.,
Pajerowska-Mukhtar K.M., 2015, Characterization of
Arabidopsis thaliana GCN2 kinase roles in seed germination
and plant development., Plant Signaling & Behavior,
10:e992264.
[16] Pajerowska-Mukhtar K.M., Wang W., Tada Y., Oka N.,
Tucker C.L., Fonseca J.P., et al., 2012, The HSF-like
Transcription Factor TBF1 Is a Major Molecular Switch for
Plant Growth-to-Defense Transition., Current Biology,
22:103-12.
[17] Lageix S., Lanet E., Pouch-Pélissier M.-N., Espagnol M.-C.,
Robaglia C., Deragon J.-M., et al., 2008, Arabidopsis eIF2α
kinase GCN2 is essential for growth in stress conditions and
is activated by wounding., BMC Plant Biol, 8:1-9.
[18] Hinnebusch A.G., 2005, Translational regulation of GCN4
and the general amino acid control of yeast., Annual review of
microbiology, 59:407-50.
[19] Jakab G., Ton J., Flors V., Zimmerli L., Métraux J.-P.,
Mauch-Mani B., 2005, Enhancing Arabidopsis Salt and
Drought Stress Tolerance by Chemical Priming for Its
Abscisic Acid Responses., Plant Physiology, 139:267-74.
[20] Xiong L., Ishitani M., Zhu J.-K., 1999, Interaction of Osmotic
Stress, Temperature, and Abscisic Acid in the Regulation of
Gene Expression in Arabidopsis., Plant Physiology,
119:205-12.
[21] Keyantash J., Dracup J.A., 2002, The Quantification of
Drought: An Evaluation of Drought Indices., Bulletin of the
American Meteorological Society, 83:1167-80.
[22] Tholakalabavi A., Zwiazek J.J., Thorpe T.A., 1994, Effect of
Mannitol and Glucose-Induced Osmotic Stress on Growth,
Water Relations, and Solute Composition of Cell Suspension
Cultures of Poplar (Populus deltoides var. occidentals) in
Relation to Anthocyanin Accumulation., In Vitro Cellular &
Developmental Biology Plant, 30P:164-70.
[23] Parida A.K., Das A.B., 2005, Salt tolerance and salinity
effects on plants: a review., Ecotoxicology and
Environmental Safety, 60:324-49.
[24] Apse M.P., Aharon G.S., Snedden W.A., Blumwald E., 1999,
Salt Tolerance Conferred by Overexpression of a Vacuolar
Na+/H+ Antiport in Arabidopsis., Science, 285:1256-8.
International Journal of Plant Research 2015, 5(4): 87-95
95
[25] Kawaguchi R., Bailey-Serres J., 2002, Regulation of
translational initiation in plants., Current Opinion in Plant
Biology, 5:460-5.
[39] Wilkinson S., Davies W.J., 2002, ABA-based chemical
signalling: the co-ordination of responses to stress in plants.,
Plant, Cell & Environment, 25:195-210.
[26] Matsuura H., Kiyotaka U., Ishibashi Y., Kubo Y., Yamaguchi
M., Hirata K., et al., 2010, A short period of mannitol stress
but not LiCl stress led to global translational repression in
plants., Bioscience, Biotechnology, and Biochemistry,
74:2110-2.
[40] Liu X., Kørner C.J., Hajdu D., Guo T., Ramonell K., Argueso
C, Pajerowska-Mukhtar K.M., 2015, Arabidopsis thaliana
AtGCN2 Kinase is Involved in Disease Resistance Against
Pathogens with Diverse Life Styles., International Journal of
Phytopathology, in press.
[27] Mascarenhas C., Edwards-Ingram L.C., Zeef L., Shenton D.,
Ashe M.P., Grant C.M., 2008, Gcn4 Is Required for the
Response to Peroxide Stress in the Yeast Saccharomyces
cerevisiae., Molecular Biology of the Cell, 19:2995-3007.
[41] Ko J.H., Yang S.H., Han K.H., 2006, Upregulation of an
Arabidopsis RING-H2 gene, XERICO, confers drought
tolerance through increased abscisic acid biosynthesis., The
Plant Journal, 47:343-55.
[28] Cai Q., Brooks H.L., 2011, Phosphorylation of eIF2α via the
general control kinase, GCN2, modulates the ability of renal
medullary cells to survive high urea stress., American Journal
of Physiology - Renal Physiology, 301:F1202-F7.
[42] Zentella R., Zhang Z.-L., Park M., Thomas S.G., Endo A.,
Murase K., et al., 2007, Global Analysis of DELLA Direct
Targets in Early Gibberellin Signaling in Arabidopsis., The
Plant Cell, 19:3037-57.
[29] Murguía J.R., Serrano R., 2012, New functions of protein
kinase Gcn2 in yeast and mammals., IUBMB Life, 64:971-4.
[43] Hasanuzzaman M., Nahar K., Alam M.M., Roychowdhury R.,
Fujita M., 2013, Physiological, Biochemical, and Molecular
Mechanisms of Heat Stress Tolerance in Plants., International
Journal of Molecular Sciences, 14:9643-84.
[30] Merchant A., Pajerowska-Mukhtar K., 2015, Arabidopsis
thaliana Dynamic Phenotypic Plasticity in Response to
Environmental Conditions., International Journal of Modern
Botany, 23-8.
[31] Colebrook E.H., Thomas S.G., Phillips A.L., Hedden P., 2014,
The role of gibberellin signalling in plant responses to abiotic
stress., The Journal of Experimental Biology, 217:67-75.
[32] Achard P., Cheng H., De Grauwe L., Decat J., Schoutteten H.,
Moritz T., et al., 2006, Integration of plant responses to
environmentally activated phytohormonal signals., Science,
311:91-4.
[33] Magome H., Yamaguchi S., Hanada A., Kamiya Y., Oda K.,
2004, dwarf and delayed-flowering 1, a novel Arabidopsis
mutant deficient in gibberellin biosynthesis because of
overexpression of a putative AP2 transcription factor., The
Plant Journal, 37:720-9.
[34] Skirycz A., De Bodt S., Obata T., De Clercq I., Claeys H., De
Rycke R., et al., 2010, Developmental stage specificity and
the role of mitochondrial metabolism in the response of
Arabidopsis leaves to prolonged mild osmotic stress., Plant
Physiology, 152:226-44.
[35] Skirycz A., Claeys H., De Bodt S., Oikawa A., Shinoda S.,
Andriankaja M., et al., 2011, Pause-and-stop: the effects of
osmotic stress on cell proliferation during early leaf
development in Arabidopsis and a role for ethylene signaling
in cell cycle arrest., Plant Cell, 23:1876-88.
[36] Claeys H., Skirycz A., Maleux K., Inze D., 2012, DELLA
signaling mediates stress-induced cell differentiation in
Arabidopsis leaves through modulation of anaphasepromoting complex/cyclosome activity., Plant Physiology,
159:739-47.
[37] Golldack D., Li C., Mohan H., Probst N., 2014, Tolerance to
drought and salt stress in plants: Unraveling the signaling
networks., Frontiers in Plant Science, 5:151.
[38] Krugman T., Peleg Z., Quansah L., Chague V., Korol A.B.,
Nevo E., et al., 2011, Alteration in expression of
hormone-related genes in wild emmer wheat roots associated
with drought adaptation mechanisms., Functional &
Integrative Genomics, 11:565-83.
[44] Gallie D.R., Le H., Caldwell C., Tanguay R.L., Hoang N.X.,
Browning K.S., 1997, The Phosphorylation State of
Translation Initiation Factors Is Regulated Developmentally
and following Heat Shock in Wheat., Journal of Biological
Chemistry, 272:1046-53.
[45] Yángüez E., Castro-Sanz A.B., Fernández-Bautista N.,
Oliveros J.C., Castellano M.M., 2013, Analysis of
Genome-Wide Changes in the Translatome of Arabidopsis
Seedlings Subjected to Heat Stress., PLoS ONE, 8:e71425.
[46] Sato H., Mizoi J., Tanaka H., Maruyama K., Qin F., Osakabe
Y., et al., 2014, Arabidopsis DPB3-1, a DREB2A Interactor,
Specifically Enhances Heat Stress-Induced Gene Expression
by Forming a Heat Stress-Specific Transcriptional Complex
with NF-Y Subunits., The Plant Cell, 26:4954-73.
[47] Queitsch C., Hong S.W., Vierling E., Lindquist S., 2000, Heat
shock protein 101 plays a crucial role in thermotolerance in
Arabidopsis., Plant Cell, 12:479-92.
[48] Key J.L., Lin C.Y., Chen Y.M., 1981, Heat shock proteins of
higher plants., Proceedings of the National Academy of
Sciences of the United States of America, 78:3526-30.
[49] Wang W., Vinocur B., Shoseyov O., Altman A., 2003, Role
of plant heat-shock proteins and molecular chaperones in the
abiotic stress response., Trends in Plant Science, 9:244-52.
[50] Swindell W.R., Huebner M., Weber A.P., 2007,
Transcriptional profiling of Arabidopsis heat shock proteins
and transcription factors reveals extensive overlap between
heat and non-heat stress response pathways., BMC Genomics,
8:125.
[51] Kozak M., 1991, An analysis of vertebrate mRNA sequences:
intimations of translational control., The Journal of Cell
Biology, 115:887-903.
[52] Morris D.R., Geballe A.P., 2000, Upstream Open Reading
Frames as Regulators of mRNA Translation., Molecular and
Cellular Biology, 20:8635-42.