Isolation and amplification of modern DNA (HVR and nuclear genes)
Swabs in general are the least invasive way of collecting DNA specimen from humans
and animals for diagnostic purposes. In contrast to blood samples swabs have the additional
benefit of minimizing the exposure to blood-borne pathogens. Swabs are easy to use and readily available. Cells collected on buccal swabs do not require special storage conditions and the
DNA remains usable even after years of storage.
Polymerase chain reaction (PCR) has rapidly become one of the most widely used
techniques in molecular biology and for good reason: it is a rapid, inexpensive and simple
means of producing relatively large numbers of copies of DNA molecules from minute quantities of source DNA material even when the source DNA is of relatively poor quality.
The Master Mix for PCR contains all of the components necessary to make new strands of
DNA in the PCR process. The Master Mix include:
Component
Purpose
Buffer
keeps the master mix at the proper pH so the PCR
reaction will take place.
Deoxynucleotides
provide both the energy and nucleosides for the
synthesis of DNA. It is important to add equal
amounts of each nucleotide (dATP, dTTP, dCTP,
dGTP) to the master mix to prevent mismatches of
bases.
Primers
Short pieces of DNA (20-30 bases) that bind to the
DNA template allowing Taq DNA polymerase enzyme to
initiate incorporation of the deoxynucleotides.
AmpliTaq
polymerase
A heat stable enzyme that adds the
deoxynucleotides to the DNA template.
Template
DNA
The DNA which will be amplified by the PCR
reaction.
CCR5-Δ32HIV Allele (Nuclear gene)
Deletion of 32bp in gene CCR5, which code chemokine co-receptor, is responsible
for the lack of protein expression product at the surface of cellular membrane of T lymphocytes and effects in human resistance to infections, e.g. with HIV-1 virus. Allele Δ32 CCR5
gives a selective advantage without causing identifiable changes in the functioning of immune
system. It is unclear, why the frequency of appearance of this mutation in Europe reaches 5–
14%, and 10,9% in Poland, while it is not present in native population of Africa, Eastern Asia
and both Americas. One of earlier explanations suggests that the agents selecting the allele
with deletion were the medieval plague (Y. pestis) or smallpox (V. major) epidemics in Europe.
Primers (anneling temperature 61 ºC), (length of products: wild 130bp, mutant 98bp)
Left 5’CCAGGAATCATCTTTACCAGATCT 3’
Right 5’ GGACCAGCCCCAAGATGACTA 3’
Hypervariable region of mitochondial DNA – HVR
Circular mitochondrial genome, present in the number of 2 to 10 copies per organelle
consists of ca 16 500 bp. The comparison of mtDNA primary structure is often used in analysis of mammal evolution, since these molecules are directly transmitted (maternal) between
generations and are not subject to recombination, thus it is possible to track the history of single mutations; due to the lack of mtDNA repair and errors introduced by the mitochondrial
polymerase, this genome is highly variable. HVR I (402 bp) located in the control region
beetwen position (15998–16400) are especially important for phylogenetic analysis. They
evolve 5 to 20 times faster than the remaining, coding part. The type of point mutation within
the HVR I defines to which mtDNA haplogroup individual belongs to, describing its descent.
Primers (anneling temperature 54 ºC), (length of products: 381bp)
Left 5’ TCTGTTCTTTCATGGGGAAG 3’
Right 5’ GTCAAGGGACCCCTATCTG 3’
Literatura:
de Silva, E. and M. P. Stumpf (2004). "HIV and the CCR5-Delta32 resistance allele." FEMS Microbiol Lett 241(1): 1-12.
Jagodzinski, P. P., R. Lecybyl, et al. (2000). "Distribution of 32 alelle of the CCR5 gene in the population of Poland." J Hum Genet 45(5):
271-4.
Sigurgardottir, S., A. Helgason, et al. (2000). "The mutation rate in the human mtDNA control region." Am J Hum Genet 66(5): 1599-609.
Max Igman, Kaessmann, H., Paabo, S., and U. Gyllensten (2000) Mitochondrial genome variation and the origin of modern humans, Nature
Mullis, Kary (1990). "The unusual origin of the polymerase chain reaction". Scientific American 262 (4): 56–61, 64–5
Higuchi, R. 1989. Rapid, efficient DNA extraction for PCR from cells or blood. Amplifications 2: 1–3. 9.
MATERIALS – REAGENTS - EQUIPMENT
GeneMATRIX Swab-Extract DNA Purification Kit
PCR reagents (Taq polymerase, primers, dNTP, water)
thermal cycler
thermoblock
centrifuge
vortex
buccal swabs
1,5 ml tubes
weight
PROCEDURE
DNA isolation
1. Apply 40 μl of activation Buffer S onto the spin-column (do not spin) and keep it at
room temperature till transfering lysate to the spin-column.
2. You should abstains from consuming any foods or drinks at least 30 min before sample collection. To further reduce possible interference from unwanted components,
you optionally can rinse mouth twice with water immediately before sample collection.
3. Collect tissue by rolling the buccal swab firmly on the inside of the cheek, approximately 20 times on each side, making certain to move the brush over the entire cheek.
Either extract the DNA immediately, or air dry the brush for 10-15 minutes at room
temperature
4. Cut using scissors the end of the swab stick and place in the 1,5 ml Eppendorf tube
5. Add 400 μl of Lyse S buffer and 10 μl of Proteinase K.
6. Mix by inverting the tube several times or vortexing and incubate for 30 min at 56° C.
7. Add 400 μl of Sol S buffer and mix thoroughly by inverting the tube several times.
8. Incubate for 10 min at 70° C.
9. Add 200 μl of 96-100 % ethanol.
10. Centrifuge the tube with the swab stick for 2 min at 14000 x g.
11. Transfer 600 μl of the lysate to the spin-column placed in the collection tube.
12. Centrifuge for 1 min at 12000 x g.
13. Take out spin-column, discard flow-through and place back spin-column in the collection tube.
14. Transfer the remaining supernatant to the spin-column placed in the collection tube.
15. Centrifuge for 1 min at 12000 x g.
16. Take out spin-column, discard flow-through and place back spin-column in the collection tube.
17. Add 500 μl of Wash SX1 buffer to the spin-column and centrifuge for 1 min at
12000 x g.
18. Take out spin-column, discard flow-through and place back spin-column in the collection tube.
19. Add 500 μl of Wash SX2 buffer to the spin-column and centrifuge for 2 min at
12000 x g.
20. Place the spin-column in a new collection tube (1.5-2 ml) and add 50-100 μl of Elution buffer (10 mM Tris-HCl, pH 8.5) heated to 70° C to elute bound DNA.
21. Incubate the spin-column/collection tube assembly for 5 min at room temperature.
22. Centrifuge the spin-column for 1 min at 12000 x g.
23. Discard the spin-column, cap the collection tube. DNA is ready for analysis/manipulation. It can be stored either at 2÷8° C or at -20°C.
DNA amplification (PCR)
1. Combine the following component for each reaction in a 0.2 ml tube (add polymerase
on end):
Reagent
Volume
Concentration
H2O
17,2 µl
-
Buffer
2,5 µl
10x
dNTP
2 µl
2,5 mM
Primers
0,3 µl each
10 µM
Taq Polymerase
0,2 µl
5 U/µl
DNA extract
2,5 µl
-
2. Prepare a control reaction with no template DNA with an additional 2,5 μl of sterile
water
3. Place tubes in a thermal cycler preheated to 94 degrees C and start with proper times
and anneling temperature.
CCR5
HVR
Number of cycle
30
30
Initial denaturation
94ºC 5min
94ºC 5min
Denaturation
94ºC 30 sec
94ºC 30 sec
Anneling
59ºC 25 sec
54ºC 30 sec
Extention
72ºC 30 sec
72ºC 120 sec
Final Extention
72ºC 7 min
72ºC 7 min
Hold
4ºC ∞
4ºC ∞