Am J Physiol Endocrinol Metab 308: E573–E582, 2015.
First published January 27, 2015; doi:10.1152/ajpendo.00460.2014.
High-fat diet-induced ␤-cell proliferation occurs prior to insulin resistance
in C57Bl/6J male mice
Rockann E. Mosser,1,2 Matthew F. Maulis,1,2 Valentine S. Moullé,5 Jennifer C. Dunn,1,2
Bethany A. Carboneau,4 Kavin Arasi,2 Kirk Pappan,7 Vincent Poitout,5,6 and Maureen Gannon1,2,3,4
1
Department of Veterans Affairs Tennessee Valley, Nashville, Tennessee; Departments of 2Medicine, 3Cell and Developmental
Biology, and 4Molecular Physiology and Biophysics, Vanderbilt University, Nashville, Tennessee; 5Montreal Diabetes
Research Center, Research Center of the University of Montreal Hospital Cente, and 6Department of Medicine, University of
Montreal, Montreal, Quebec, Canada; and 7Metabolon, Inc., Durham, North Carolina
Submitted 7 October 2014; accepted in final form 26 January 2015
high-fat diet; mouse models; insulin resistance; ␤-cell proliferation;
␤-cell mass
␤-CELL COMPENSATION IN RESPONSE TO OBESITY is observed in both
humans and rodent models. Human autopsy studies have revealed that nondiabetic obese individuals have 50% greater
␤-cell mass compared with lean individuals, and pancreata
from type 2 diabetes patients have diminished ␤-cell mass
compared with nondiabetic BMI-matched individuals (7). In
mice, high-fat diet (HFD) feeding leads to increased body
weight and a corresponding expansion in ␤-cell mass via
increased ␤-cell proliferation (19, 35, 43, 46). The ␤-cell
response to HFD feeding in mice could enhance our understanding of the ␤-cell response to energy excess in humans and
help us develop new strategies for augmenting ␤-cell mass in
type 2 diabetes patients, but a key point is to discern early
responses vs. compensatory responses that might occur after
prolonged HFD feeding.
The ␤-cell response to HFD feeding has been studied
extensively; however, the data are difficult to interpret due
Address for reprint requests and other correspondence: M. Gannon, Dept. of
Medicine, Div. of Diabetes, Endocrinology, and Metabolism, Vanderbilt University Medical Center, 2213 Garland Ave., 7465 MRB IV, Nashville, TN
37232-0475 (e-mail: [email protected]).
http://www.ajpendo.org
to varying model systems and experimental designs. Studies
vary in the ␤-cell characteristics measured, the composition
and timing of diet, and mouse genotype, age, and, sex. Only
by combining parallel measurements can a relationship
between ␤-cell adaptations and the progression of dietinduced obesity be defined. The majority of studies utilize
long-term HFD consumption, and the ␤-cell response is
assessed after rodents have been on a HFD for anywhere
from 2 to 12 mo. These studies demonstrated that long-term
HFD consumption induces glucose intolerance, insulin resistance, and enhanced ␤-cell mass and proliferation (2, 6,
17, 26, 27, 32, 40, 44). Some studies have explored the acute
consequences of overnutrition; for example, significant
weight gain and hyperglycemia have been reported in mice
after as little as 1 wk after beginning a diet high in fat (2, 34,
46). ␤-Cell mass expansion due to increased ␤-cell proliferation has been reported in response to only 1 wk of HFD
feeding, and this was suggested to occur in the absence of
insulin resistance (35). However, the value of the intraperitoneal insulin tolerance test (IPITT), which was used in that
study, to assess insulin resistance in mice is limited by the
potentially confounding effect of counterregulatory responses (5, 26) and the very short half-life of insulin in mice
(8). Therefore, in the current study, after the primary screen
using IPITTs, we performed hyperinsulinemic euglycemic
clamps to assess insulin sensitivity with greater sensitivity
as recommended by the Mouse Metabolic Phenotyping Center Consortium (5).
The current study was designed to assess both the onset and
the magnitude of functional and morphological adaptations of
␤-cells in response to HFD feeding. To this end, starting at 8
wk of age, male C57Bl/6J mice were fed either a normal chow
diet (CD) or a HFD for a duration of 11 wk and periodically
examined for indications of insulin resistance, glucose intolerance, ␤-cell mass, and ␤-cell proliferation. We determined not
only when but also the degree to which the parameters change
in response to overnutrition. Here, we report that HFD induces
␤-cell proliferation as early as 3 days after diet initiation, the
earliest this has been shown to occur. Furthermore, we found
that enhanced ␤-cell proliferation induced by HFD feeding
occurs in response to factors not initiated by HFD-induced
insulin resistance (as determined by hyperinsulinemic euglycemic clamp). A precise characterization of the natural progression of ␤-cell proliferation and insulin resistance is key to
understanding the pathogenesis of type 2 diabetes and the
regulation of compensatory ␤-cell proliferation in response to
metabolic and nutritional cues.
E573
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Mosser RE, Maulis MF, Moullé VS, Dunn JC, Carboneau BA,
Arasi K, Pappan K, Poitout V, Gannon M. High-fat diet-induced
␤-cell proliferation occurs prior to insulin resistance in C57Bl/6J male
mice. Am J Physiol Endocrinol Metab 308: E573–E582, 2015. First
published January 27, 2015; doi:10.1152/ajpendo.00460.2014.—Both
short- (1 wk) and long-term (2–12 mo) high-fat diet (HFD) studies
reveal enhanced ␤-cell mass due to increased ␤-cell proliferation.
␤-Cell proliferation following HFD has been postulated to occur in
response to insulin resistance; however, whether HFD can induce
␤-cell proliferation independent of insulin resistance has been controversial. To examine the kinetics of HFD-induced ␤-cell proliferation
and its correlation with insulin resistance, we placed 8-wk-old male
C57Bl/6J mice on HFD for different lengths of time and assayed the
following: glucose tolerance, insulin secretion in response to glucose,
insulin tolerance, ␤-cell mass, and ␤-cell proliferation. We found that
␤-cell proliferation was significantly increased after only 3 days of
HFD feeding, weeks before an increase in ␤-cell mass or peripheral
insulin resistance was detected. These results were confirmed by hyperinsulinemic euglycemic clamps and measurements of ␣-hydroxybutyrate,
a plasma biomarker of insulin resistance in humans. An increase in
expression of key islet-proliferative genes was found in isolated islets
from 1-wk HFD-fed mice compared with chow diet (CD)-fed mice.
These data indicate that short-term HFD feeding enhances ␤-cell proliferation before insulin resistance becomes apparent.
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
E574
Table 1. qRT-PCR sequences
Gene
Forward
Reverse
Ki-67
FoxM1
Cyclin D1
Cyclin D2
Cyclin A2
Cyclin B1
P16
AGCTTCTGTGCTGACCCTGATG
CACTTGGATTGGGACCACTT
CTGACACCAATCTCCTCAACGAC
CACCGACAACTCTGTGAAGC
CTTGGCTGCACCAACAGTAA
TCTTGACAACGGTGAATGGA
CCGTCGTACCCCGATTCAG
TGCAGAAAGGCCCTTGGCATAC
GTCGTTTCTGCTGTGATTCC
GCGGCCAGGTTCCACTTHAGC
TCCACTTCAGCTTACCCAACA
CAAACTCAGTTCTCCCAAAAACA
TCTTAGCCAGGTGCTGCATA
GCACCGTAGTTGAGCAGAAGAG
qRT-PCR, quantitative RT-PCR.
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Fig. 1. Impaired glucose tolerance occurs within 1 wk of HFD feeding and persists throughout the study. A: high-fat diet (HFD)-fed mice () gain weight
progressively over an 11-wk period. Weight of chow diet (CD)-fed mice (Œ) plateaus after week 5. B–F: glucose tolerance tests are shown for weeks 1
(B), 3 (C), 5 (D), 7 (E), and 11 (F). Data are shown as means ⫾ SE [n ⫽ 6 –9 for body weight and 3– 6 for intraperitoneal insulin tolerance test (IPGTT)].
P values were calculated using the unpaired t-test, comparing the difference in weight between CD and HFD within the weekly time points. Significance
for IPGTTs was calculated using the 2-way ANOVA with Sidek correction for multiple comparisons. *P ⱕ 0.05; **P ⱕ 0.01; ***P ⱕ 0.001; ****P ⱕ
0.0001.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
RESEARCH DESIGN AND METHODS
macro within Spectrum (Aperio) was used to identify ␤-cells and
other tissue (15); n ⫽ 3 (weeks 1, 3, 7, and 9 for CD and HFD), 5
(week 11 for CD), or 6 (week 5 for CD and HFD and week 11 for
HFD). ␤-Cell proliferation was determined by immunolabeling sections ⬃400 ␮m apart (⬃5 slides/animal) for insulin and Ki-67
(Abcam; 1:500) or insulin and phosphorylated histone H3 (pHH3,
1:200; Cell Signaling Technology). For Ki-67 labeling, antigen retrieval consisted of microwaving slides for 14 min in 10 mM sodium
citrate buffer; n ⫽ 3 (weeks 3, 7, and 9 for CD and HFD), 4 (3 days
for CD), 5 (3 days for HFD), or 6 (weeks 1, 5, and 11 for CD and
HFD). For pHH3 labeling, antigen retrieval was placed in TEG buffer
at pH 9.0 and microwaved on high power for 1 min and then 10%
power for 7.5 min. Nuclei were labeled with 1 ␮g/ml 4=,6=-diamidino2-phenylindole (DAPI, Molecular Probes, Grand Island, NY) and
mounted with Aqua-Mount (Thermo Scientific, Kalamazoo, MI); n ⫽
3 for all time points and diets. Slides were scanned as above. At least
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Experimental animals. With the exception of hyperinsulinemic euglycemic clamp studies, all experiments were performed in the Vanderbilt University facility. Male C57Bl/6J mice (Jackson Laboratory, Bar
Harbor, ME) were delivered to the Association for Assessment and
Accreditation of Laboratory Animal Care International-accredited Division of Animal Care at Vanderbilt University at 7 wk of age. After 1 wk
of acclimatization, mice were weighed and randomly assigned to one of
two groups: 1) CD (11% kcal from fat, Lab Diet 5LJ5; Purina, St. Louis,
MO) and 2) HFD (60% kcal from fat; BioServ F3282, Frenchtown, NJ).
Mice were housed on a 12:12-h light-dark cycle, receiving water and food
ad libitum. Body weight was obtained prior to starting the diets and prior
to each metabolic measurement. Euthanasia was performed at time of
pancreatic dissection, using isoflurane until the mice were unconscious,
followed by cervical dislocation. These methods are consistent with the
Panel on Euthanasia of the American Veterinary Medical Association.
All procedures were conducted in accordance with Vanderbilt University
Division of Animal Care and Use Committee-approved protocols and
under the supervision of the Division of Animal Care. For hyperinsulinemic euglycemic clamps, male C57Bl/6J mice (Jackson Laboratory, Bar
Harbor, ME) were delivered to the Animal Facility of the Research
Center of the University of Montreal Hospital Cente (CRCHUM) at 7 wk
of age and the clamps performed at 8 wk of age. All procedures were
approved by the Institutional Committee for the Protection of Animals at
the CRCHUM.
Metabolic measurements. Intraperitoneal glucose tolerance tests
(IPGTT) and IPITT were performed as described previously (18). For
IPGTT, animals were fasted for 16 h. Fasting blood glucose was measured from 2 ␮l of tail vein blood with an Accuchek glucometer and
glucose test strips (Abbott Diabetes Care). Animals received an intraperitoneal (ip) injection of filter-sterilized glucose (2 mg dextrose/g body wt),
and blood glucose was measured at 15-, 30-, 60-, 90-, and 120-min
intervals following injection; n ⫽ 3 (weeks 3, 7, and 9) or 6 (weeks 1, 5,
and 11). For IPITT, animals were fasted for 6 h. Fasting blood glucose
was measured as described above, and animals received an ip injection of
0.075 U/ml insulin (recombinant human insulin, no. I9278; SigmaAldrich) in filter-sterilized 1⫻ PBS at 0.1 ml/10 g body wt. Subsequent
changes in blood glucose were measured at 15-, 30-, 60-, 90-, and
120-min intervals following injection; n ⫽ 3 (weeks 3, 7, and 9) or 6
(weeks 1, 5, and 11). Plasma insulin assays were performed as described
in (31), with the modification that blood was harvested from the saphenous veins of 16-h-fasted animals using heparinized Natelson bloodcollecting tubes (Kimble Chase, Rockwood, TN).
Hyperinsulinemic euglycemic clamps. Two-hour hyperinsulinemiceuglycemic clamps were performed in 4-h-fasted mice (n ⫽ 6 for CD
and 7 for HFD), as described previously (4). Briefly, following a 1-min
bolus insulin infusion (85 mU/kg; Humulin R), insulin was infused at 8
mU·kg⫺1·min⫺1. Twenty percent dextrose was infused beginning 5 min
after the insulin infusion to clamp glycemia at ⬃120 mg/dl. Insulin levels
during the steady state were measured at 90 and 120 min using the
AlphaLISA kit. The insulin sensitivity index (M/I) was calculated as the
glucose infusion rate (GIR) divided by the average insulinemia during
the last 30 min of the clamp (I); n ⫽ 6 CD and 7 HFD.
Tissue preparation and histology. At euthanization, pancreata were
processed as described previously (14). Antibodies were guinea pig
anti-insulin (1:500; Dako, Carpinteria, CA), rabbit anti-Ki67 (1:500;
AbCam, Cambridge, MA), Cy2-conjugated anti-guinea pig IgG (1:
300; Jackson Laboratories, Bar Harbor, ME), Cy3-conjugated antirabbit IgG (1:300, Jackson Laboratories), and horseradish peroxidaseconjugated anti-guinea pig IgG (1:300, Jackson Laboratories).
␤-Cell mass, ␤-cell proliferation, and ␤-cell death. Analysis and
quantification of ␤-cell mass was performed as described in (18). For
␤-cell mass assessment, ⬃2% of each pancreas was immunolabeled
and analyzed (5–10 sections/animal, each separated by 250 ␮m).
Slides were scanned at ⫻20 magnification (Scan Bright field Scope
System; Aperio, Vista, CA), and an algorithm developed from a Genie
E575
Fig. 2. Area under the curve (AUC) reveals that HFD causes the greatest
changes in late time points of IPGTTs. AUC was determined from 0 to 120 min
(A), 0 to 30 min (B), and 30 to 120 min (C). Œ, CD; , HFD. Data are shown
as means ⫾ SE (n ⫽ 3– 6). The unpaired t-test was used for comparing CD and
HFD areas under the curve. *P ⱕ 0.05, comparisons between diets {(*)comparison between CD weekly time points; [*]comparison between HFD weekly
time points}. **P ⱕ 0.01; ***P ⱕ 0.001; ****P ⱕ 0.0001.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
E576
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
RESULTS
Weight gain and impaired glucose tolerance in HFD-fed
mice. To correlate the consumption of HFD with changes in
body weight, glucose homeostasis, and ␤-cell growth, 8-wk-
old male mice were either maintained on CD or switched to
HFD. The average initial body weight for the CD group was
identical to the HFD group (20.4 ⫾ 2.1 vs. 20.5 ⫾ 1.5 g,
respectively). Mice from each diet were examined at 1, 3, 5, 7,
9, and 11 wk after the start of the study for body weight,
glucose homeostasis, ␤-cell mass, and ␤-cell proliferation.
HFD-fed mice weighed significantly more than CD-fed mice
throughout the study, starting with an initial weight gain of
1.1 ⫾ 0.9 g (P ⫽ 0.006) in the 1st wk compared with the static
weight of the CD group (⫺0.7 ⫾ 1.5 g, P ⫽ not significant)
(Fig. 1A). The largest weight increase for both diets occurred
between weeks 3 and 5, where CD-fed mice gained 3.9 ⫾ 1.0 g
(P ⫽ 0.001) and HFD-fed mice gained a similar 3.7 ⫾ 1.1 g
(P ⫽ 0.008). After week 5, the HFD group continued to gain
weight, showing an 8.4 ⫾ 1.5-g (P ⫽ 0.0001) increase over the
next 6 wk, whereas body weights of CD-fed mice plateaued
during this time frame with an insignificant increase in body
weight of 1.6 ⫾ 0.8 g.
Changes in glucose tolerance in response to both acute
and long-term HFD consumption were tracked by performing an IPGTT every other week. As expected from previously published studies, glucose tolerance was already impaired after 1 wk of HFD and was consistently impaired
throughout the study despite unchanged fasting blood glucose (Fig. 1, B–F). To depict subtle but significant changes
in glucose tolerance as mice were maintained on HFD, we
calculated the area under the curve for glucose (AUCglc)
both between diets and between intradiet time points (Fig. 2,
A–C). The AUCglc for HFD-fed mice increased gradually
between weeks 1 and 9 and culminated with a highly
significant increment in AUCglc from weeks 9 to 11 (P ⫽
0.001); the AUCglc for CD-fed mice was relatively unchanged (Fig. 2A). The gradual increase in HFD-fed AUCglc
between weeks 1 and 9 was due to an elevation in glucose
during the first 30 min of the IPGTTs (Fig. 2B). In fact, the
Fig. 3. Insulin tolerance was enhanced in HFD-fed mice in week 1 but worsened gradually over time. Insulin tolerance tests are shown for weeks 1 (A and D), 5 (B and
E), and 11 (C and F). Results for each time point normalized to fasting blood glucose levels are shown in D–F. Œ, CD; , HFD. Data are shown as means ⫾ SE
(n ⫽ 3– 6); significance was calculated using 2-way ANOVA with Sidek correction for multiple comparisons. *P ⱕ 0.05; **P ⬍ 0.01; ***P ⱕ 0.001; ****P ⱕ
0.0001.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
5,000 insulin-positive cells/mouse were counted using MetaMorph
software. Calculations were made by dividing the number of insulin/
Ki-67 or insulin/pHH3 colabeled cells by the total number of insulinpositive cells. To assess ␤-cell death, terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling (TUNEL) was performed using the ApoAlert Kit (Clontech) according to the manufacturer’s instructions (16). For TUNEL assay, pancreata (3 sections/
animal) from three CD- and three HFD-fed animals were analyzed at
each of three time points (3 days, 1 wk, and 11 wk).
Quantitative RT-PCR. Islet RNA from 1-wk-treated mice was
isolated, and quantitative RT-PCR (qRT-PCR) was performed as
described previously (1). Primer sequences are listed in Table 1. Data
are shown as 2⫺⌬⌬CT (24); n ⫽ 6.
Metabolomic analysis. Whole liver, epididymal fat, skeletal muscle (gastrocnemius, soleus, and plantaris muscles), bone (fibula and
tibia), and plasma were collected from 9-wk-old C57Bl/6J mice
either fed a HFD (n ⫽ 8) or maintained on a CD (n ⫽ 8) for 1 wk.
Tissues were dissected, flash-frozen, and kept at ⫺80°C before
being shipped to Metabolon (Durham, NC) for metabolite analysis.
Sample preparation, instrument analysis, and data processing analysis were performed by Metabolon, as detailed in previous publications (9, 27).
Statistical analysis and calculations. Data are shown as means ⫾
SE (12). P values were calculated with either the two-tailed unpaired
Student’s t-test or the two-way ANOVA with the Sidek correction for
multiple comparisons as indicated. P values ⱕ0.05 were considered
significant, and P values ⬎0.05 were not reported. For metabolomic
data shown in Fig. 5B, any missing values were assumed to be below
the detection limit and were imputed with the minimum observed
value. Following imputation and log transformation, P values were
calculated using the Welsh two-sample t-test, and estimates of the
false discovery rate (q value) were calculated to account for multiple
comparisons, as described previously (36).
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
E577
last 90 min of the IPGTTs remained relatively consistent
between intradiet time points, with the exception of week 11
in the HFD-fed group, when a large increase in AUCglc
occurs (Fig. 2C).
Insulin resistance is not apparent with short term HFD feeding,
but impaired insulin tolerance develops with prolonged HFD
feeding. The progression of impaired glucose tolerance in response to both acute and long-term HFD suggests impairments in
insulin secretion and/or insulin sensitivity. First, we determined
the effects of short- and long-term HFD feeding on insulin
tolerance. Since injection of insulin can dramatically lower blood
glucose levels, mice were fasted for only 6 h prior to insulin
injection. Fasting blood glucose concentrations were not altered in
response to short-term HFD feeding but were elevated with
long-term HFD feeding (Fig. 3C). Interestingly, mice fed HFD for
1 wk exhibited a significantly enhanced decline in blood glucose
during the latter time points of the IPITT (Fig. 3A), and this was
still apparent after normalization to fasting blood glucose (Fig.
3D). In week 5, the blood glucose concentrations of the HFD-fed
group were indistinguishable from controls (Fig. 3, B and E).
After 11 wk of HFD feeding, we observed elevated blood glucose
throughout the test relative to CD-fed mice (Fig. 3C). These data
show that insulin tolerance in HFD-fed mice gradually diminished
with duration of HFD, whereas the CD-fed mice maintained a
consistent response throughout the study. However, after normalization to basal glucose concentrations, insulin tolerance in the
long-term HFD-fed mice was only slightly compromised at the
later time points (Fig. 3F). Similar to week 5, there was no
significant difference between the diets at weeks 3, 7, and 9 (data
not shown).
Plasma was assayed every other week for circulating
insulin in response to glucose. Although there was a significant increase in plasma insulin in response to the glucose
challenge in animals fed HFD for 1 wk, this response was
reduced by 50% compared with the response of the CD-fed
group (Fig. 4A). The CD-fed plasma insulin response remained consistent through week 11 (Fig. 4, B and C). Plasma
insulin values for HFD-fed mice were virtually unchanged
for weeks 1–7 (Fig. 4, A and B, and data not shown). As
predicted, hyperinsulinemia was apparent in long-term
HFD-fed mice (Fig. 4C). Fasting plasma insulin was elevated in HFD-fed mice by week 9 (data not shown) and
Fig. 5. Insulin sensitivity is not modified
after 1 wk of HFD. A: blood glucose during
hyperinsulinemic euglycemic clamp. B: the
average glucose infusion rate is calculated
during the 90- to 120-min period where
blood glucose levels are identical between
CD- and HFD-fed mice. C: plasma insulin at
120 min trends higher for HFD mice but is
not significantly different from CD mice. D:
insulin sensitivity between CD and HFD is
not changed, as indicated by similar insulin
sensitivity index (M/I) values. Data are
shown as means ⫾ SE. Open bars, CD (n ⫽
6); black bars, HFD (n ⫽ 7).
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Fig. 4. Hyperinsulinemia became evident after 11 wk of HFD feeding. Fasting and glucose-induced plasma insulin secretion were assayed at weeks 1 (A), 5 (B),
and 11 (C). Open bars, CD; black bars, HFD. Data are shown as means ⫾ SE (n ⫽ 5– 6); significance was calculated with the paired t-test and 2-way ANOVA
with Sidek correction for calculation of multiple comparisons. *P ⱕ 0.05; **P ⱕ 0.01.
E578
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
exacerbated further in week 11 (Fig. 4C), at which point it
was nearly fourfold higher in the HFD-fed group compared
with the CD-fed group (P ⫽ 0.02). Despite elevated fasting
plasma insulin in HFD-fed mice at week 11, they still
presented with a moderate but significant response to the
initial glucose challenge at 15 min (P ⫽ 0.03).
Our data at later time points agree with a wealth of previously published studies demonstrating insulin resistance after
prolonged HFD feeding. The more provocative finding of the
present study is a lack of apparent insulin resistance 1 wk after
initiation of HFD. To more rigorously investigate whether
insulin resistance is present after 1 wk of HFD feeding, we
performed hyperinsulinemic euglycemic clamps (Fig. 5). The
GIR required to maintain blood glucose levels (Fig. 5A) at the
target level was not different between the two groups (Fig. 5B).
Although circulating insulin levels at the end of the clamp were
slightly higher in the HFD-fed group (Fig. 5C), this difference
was not statistically significant, and the M/I index was not
different between both groups (Fig. 5D). These results suggest
that insulin sensitivity was unaltered after 1 wk of HFD.
In humans, elevations of the metabolite ␣-hydroxybutyrate
(␣-HB) in plasma are indicative of insulin resistance (11, 13).
Given the results from the IPITT and hyperinsulinemic euglycemic clamps suggesting lack of insulin resistance at 1 wk of
HFD feeding, we queried results from metabolomic analyses of
metabolically relevant tissues (including plasma) to determine
whether levels of ␣-HB were increased in response to HFD at
this time point. Metabolomic analysis of liver, skeletal muscle,
epididymal fat, bone, and plasma collected from 1-wk-HFDand -CD-fed mice revealed decreased ␣-HB in the liver (0.62fold lower, P ⫽ 0.002, q ⫽ 0.012) and adipose tissue (0.73fold lower, P ⫽ 0.011, q ⫽ 0.002) in HFD-fed mice compared
with CD-fed mice; ␣-HB was unchanged in other tissues,
including plasma, at this time point (Fig. 6).
␤-Cell mass expansion begins after 3 wk of HFD consumption.
␤-Cell mass expansion is well established in long-term HFD
feeding studies; however, the timing of this expansion is less
clear. To address this, ␤-cell mass was determined every other
week between 1 and 11 wk (Fig. 7). A significant increase in
␤-cell mass was observed after 3 wk of HFD feeding; however,
this increase was not sustained throughout the treatment period. The ␤-cell mass within each diet group remained relatively constant until week 9, when a significant increase was
observed in both groups. Compared with the chow-fed animals,
a further increase in ␤-cell mass was observed between weeks
9 and 11 in the HFD-fed group. Comparison between the two
Fig. 7. ␤-Cell mass expansion in response to HFD first becomes evident in
week 3. ␤-Cell mass in HFD-fed mice compared with CD-fed mice was
slightly elevated in week 3, becoming significantly elevated during weeks
9 –11. Open bars, CD; black bars, HFD. Data are shown as means ⫾ SE (n ⫽
3– 6); P values were calculated using the unpaired t-test. *P ⱕ 0.05; **P ⱕ
0.01; ***P ⱕ 0.001.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Fig. 6. Assessment of ␣-hydroxybutyrate (␣-HB) in plasma, bone, muscle, liver, and adipose tissue collected from 1-wk-HFD- (gray boxes) and CD-fed mice
(white boxes) revealed significantly decreased ␣-HB in the liver and adipose tissue of HFD-fed mice. Data are shown as means ⫾ SE; P values were calculated
using the unpaired t-test (n ⫽ 8). *P ⱕ 0.05; **P ⱕ 0.01.
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
diets at the 11-wk time point revealed a 1.3-fold increase in
␤-cell mass for HFD-fed mice over CD-fed mice (P ⫽ 0.001).
␤-Cell proliferation was induced with short-term HFD
feeding. To ascertain the kinetics of the ␤-cell-proliferative
response to HFD feeding, pancreata were assayed at different
durations of HFD for ␤-cell proliferation using Ki-67 and
pHH3 immunolabeling. Whereas CD-fed mice exhibited a
constant low percentage of Ki-67/insulin double-positive cells
throughout the study, ␤-cell proliferation in the HFD-fed group
was dynamic and enhanced after just 3 days (Fig. 8A). Compared with CD, ␤-cell proliferation was enhanced 2.6-, 2.2-,
2.9-, and 2.3-fold for the HFD-fed mice at 3 days (P ⫽ 0.05),
E579
1 wk (P ⫽ 0.00005), 5 wk (P ⫽ 0.0001), and 7 wk (P ⫽
0.003), respectively. Similar results were obtained using pHH3
as a proliferative marker; the greatest enhancement in ␤-cell
proliferation was observed after only 3 days of HFD, and an
increase in ␤-cell proliferation was maintained at 1 wk of HFD
but was no longer apparent at 11 wk of HFD (Fig. 8B).
Since a significant increase in ␤-cell proliferation was detected within 1 wk of HFD treatment, qRT-PCR was conducted
on RNA from isolated islets at 1 wk to analyze changes in gene
expression for key proliferative genes. Expression of Ki67,
Foxm1, cyclin A2, and cyclin B1 was upregulated 1.6-, 1.6-,
1.7-, and twofold (P ⫽ 0.003, 0.00004, 0.03, and 0.01),
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Fig. 8. ␤-Cell proliferation was elevated substantially
after 3 days (0.4 wk) of HFD feeding. ␤-Cell proliferation in CD-fed mice did not significantly change
throughout the study, as assessed by immunolabeling
for either Ki-67 (A) or phosphorylated histone H3 (B);
␤-cell proliferation was acutely affected by HFD feeding after only 3 days. C: quantitative RT-PCR for genes
positively and negatively associated with ␤-cell proliferation was performed after 1 wk of diet. Open bars,
CD; black bars, HFD. Data are shown as means ⫾ SE
(n ⫽ 3– 6); significance was calculated with the paired
t-test and 2-way ANOVA with Sidek correction for
calculation of multiple comparisons. *P ⱕ 0.05; **P ⱕ
0.01; ***P ⱕ 0.001; #P ⬍ 0.0597.
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
E580
respectively, in 1-wk-HFD-fed mouse islets compared with CD
islets. Expression of cyclins D1 and D2 was unchanged. Expression of the cell cycle inhibitors cdkn2A (p16), cdkn1A
(p21), and cdkn1B (p27) was not changed significantly in
HFD-fed mice (Fig. 8C).
DISCUSSION
Table 2. Summary of results
Duration of HFD
Parameters
3 Days
1 Wk
3 Wk
5 Wk
7 Wk
9 Wk
11 Wk
Glucose tolerance
Insulin tolerance
Fasting insulin
Glucose-stimulated insulin secretion
␣-Hydroxylbutyrate
␤-Cell mass
␤-Cell proliferation
␤-Cell death
ND
ND
ND
ND
ND
ND
Increased
No change
Impaired
Improved
No change
Impaired
Decreased
No change
Increased
No change
Impaired
ND
No change
ND
ND
Increased
No change
ND
Impaired
No change
No change
No change
ND
No change
Increased
ND
Impaired
No change
No change
ND
ND
No change
Increased
ND
Impaired
No change
Increased
ND
ND
No change
No change
ND
Impaired
Impaired
Increased
Impaired
ND
Increased
No change
No change
HFD, high-fat diet; ND, not determined. All caparisons are with animals on control diet for the same duration.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
Long-term HFD feeding can result in insulin resistance,
glucose intolerance, and fasting hyperglycemia and can impact
the ␤-cell, resulting in hyperinsulinemia, increased ␤-cell proliferation, and increased ␤-cell mass. However, little is known
about the initiation, extent, and duration of ␤-cell proliferation
in response to HFD feeding or the relationship between ␤-cell
proliferation and insulin resistance. Understanding how and
when the ␤-cell adapts to increased consumption of fat could
lead to advances in diabetes therapy. In the current study, we
found that overt insulin resistance does not precede proliferation; quite the contrary, ␤-cell proliferation begins within 3
days of a HFD being started, weeks before insulin resistance is
detected. The results from our analyses of HFD duration are
summarized in Table 2.
Genetic background, age, and sex are three confounding
variables in previous mouse studies that make interpreting the
␤-cell response to HFD consumption difficult (10, 20, 42). We
chose C57Bl/6J mice because of the significant and welldocumented HFD-induced effects on ␤-cell adaptation in this
strain (19, 37, 38, 43). Age is another variable that has a large
impact on ␤-cell proliferation. ␤-Cell proliferation in response
to HFD declines sharply after 7 mo of age, becoming nearly
nonexistent after 12 mo (0.07%/day) (39, 43). Conversely,
examining very young mice could be problematic due to
changing hormone levels associated with normal growth and
puberty. Therefore, we chose 8-wk-old mice since these mice
have reached sexual maturity and are still young enough to
exhibit robust ␤-cell proliferation (33). The sex of the mice
was another factor taken into consideration. We chose male
mice because, although both male and female mice experience
similar weight gain on HFD, glucose tolerance and insulin
secretion are more severely impaired in males, whereas ␤-cell
mass in females is resistant to the effects of HFD (14, 29).
The current study clearly defines how glucose tolerance,
insulin sensitivity, and hyperinsulinemia change with progressive consumption of a HFD and, more importantly, how these
relate to ␤-cell proliferation. Previous studies reported impaired glucose tolerance in as little as 3 days to 1 wk in
HFD-fed mice but did not examine the progressive changes
that occur in glucose tolerance with increased duration on HFD
(2, 24, 28, 29, 39, 42). Our study agrees with a previous report
that impaired glucose tolerance occurs after 3 days of HFD and
is maintained through 12 wk of HFD feeding (44). However,
this previous study utilized only AUC to report the IPGTT
results. The present study clearly indicates that the impaired
glucose tolerance observed 1 wk after HFD feeding is confined
to the 30-min time point, suggesting an intact early insulin
response after short-term HFD feeding and a diminished second-phase response. Whereas IPGTTs for CD-fed animals
remained relatively steady from week to week throughout the
study, the HFD-fed group showed worsening glucose tolerance
with increased diet duration, particularly during the first 30
min. This effect may be attributable to a number of factors,
including adiposity-related changes in the rate of glucose
absorption and impaired first-phase insulin secretion. Interestingly, the latter 90 min of the HFD-fed IPGTTs did not deviate
until week 11. A significant increase in circulating insulin in
response to glucose was observed for both diets at week 1;
however, the insulin levels in HFD-fed mice were not sufficient to maintain proper glucose homeostasis. Although the
elevated fasting plasma insulin in week 11 HFD-fed mice
suggested insulin resistance, there was still an intact response
to glucose injection.
Mice fed HFD for 1 wk showed a more significant decline in
blood glucose in response to exogenous insulin than CD-fed
mice. These data are supported by a previous report where
nonfasted 1-wk-HFD-fed mice exhibited increased insulin sensitivity, which becomes apparent when results in that study are
normalized for fasting blood glucose (35). On the surface, it
appears that HFD-fed mice are more insulin sensitive; however, further scrutiny suggests otherwise. Insulin has an estimated circulating half-life of 10 min in mice (8); therefore,
after the first 30 min of the IPITT, all exogenous insulin should
be cleared. The blood glucose measurements between 30 and
60 min are more indicative of secondary effects (e.g., counterregulatory hormone responses). Interestingly, a study done in
humans more than four decades ago reported a similar phenomenon where “mild” diabetic test subjects were more insulin
tolerant during the latter time points of the test (40). These
authors suggested that this may be due to increasing endogenous insulin levels in the “mild” diabetic patients; contrary to
this, our plasma insulin data imply that the lowering of blood
glucose during the latter part of the IPITT is not due to an
increase in endogenous insulin. Thus, at present it is unclear
why 1 wk HFD feeding appears to improve insulin tolerance,
but these results warrant further investigation.
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
3 days of starting a diet high in fat. This is exciting evidence
showing that adult pancreatic ␤-cells can indeed respond robustly to proliferative cues without the complications of insulin
resistance. To our knowledge, this is the first study to definitively indicate that HFD-induced ␤-cell proliferation precedes
overt insulin resistance, although this was suggested by the
study from Stamateris et al (35). These studies lay the groundwork for defining the proliferative signals that are present in
response to HFD.
ACKNOWLEDGMENTS
We thank Anastasia Coldren (Vanderbilt) for help with islet isolations and
Wade M. Calcutt (Vanderbilt) for assistance with gas chromatography-mass
spectrometry. We thank Dr. Thierry Alquier (University of Montreal), Grace
Fergusson (CRCHUM), and Mélanie Ethier (CRCHUM) of the Rodent Metabolic Phenotyping Core Facility of the CRCHUM for help with hyperinsulinemic euglycemic clamps, Dr. David Wasserman (Vanderbilt) for critical
reading and helpful discussions of the manuscript, and members of the Gannon
Laboratory for helpful discussions about the project.
GRANTS
This work was funded by grants from the Veterans Administration
(1BX000990-01A1 to M. Gannon), Juvenile Diabetes Research Foundation
(17-2012-26 to M. Gannon and V. Poitout), National Institute of Diabetes and
Digestive and Kidney Diseases (NIDDK; R01-DK-58096 to V. Poitour), and
a ADA/TAKEDA Mentor-Based Postdoctoral Fellowship Award (7-10-BETA-03 to M.G.). V. Poitout holds the Canada Research Chair in Diabetes and
Pancreatic ␤-Cell Function. Islet isolations and slide scanning were performed
in the Islet Procurement and Analysis Core of the Vanderbilt Diabetes
Research and Training Center supported by NIDDK Grant DK-20593.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
R.E.M., V.P., and M.G. conception and design of research; R.E.M.,
M.F.M., V.S.M., J.C.D., B.A.C., K.A., and K.P. performed experiments;
R.E.M., V.S.M., J.C.D., B.A.C., K.P., V.P., and M.G. analyzed data; R.E.M.,
K.P., V.P., and M.G. interpreted results of experiments; R.E.M., B.A.C., K.P.,
and M.G. prepared figures; R.E.M. drafted manuscript; R.E.M., K.A., K.P.,
V.P., and M.G. edited and revised manuscript; B.A.C. and M.G. approved final
version of manuscript.
REFERENCES
1. Ackermann Misfeldt A, Costa RH, Gannon M. Beta-cell proliferation,
but not neogenesis, following 60% partial pancreatectomy is impaired in
the absence of FoxM1. Diabetes 57: 3069 –3077, 2008.
2. Ahrén B, Pacini G. Insufficient islet compensation to insulin resistance
vs. reduced glucose effectiveness in glucose-intolerant mice. Am J Physiol
Endocrinol Metab 283: E738 –E744, 2002.
4. Alquier T, Peyot ML, Latour MG, Kebede M, Sorensen CM, Gesta S,
Ronald Kahn C, Smith RD, Jetton TL, Metz TO, Prentki M, Poitout
V. Deletion of GPR40 impairs glucose-induced insulin secretion in vivo in
mice without affecting intracellular fuel metabolism in islets. Diabetes 58:
2607–2615, 2009.
5. Ayala JE, Samuel VT, Morton GJ, Obici S, Croniger CM, Shulman
GI, Wasserman DH, McGuinness OP. Standard operating procedures
for describing and performing metabolic tests of glucose homeostasis in
mice. Dis Model Mech 3: 525–534, 2010.
6. Berglund ED, Li CY, Poffenberger G, Ayala JE, Fueger PT, Willis SE,
Jewell MM, Powers AC, Wasserman DH. Glucose metabolism in vivo
in four commonly used inbred mouse strains. Diabetes 57: 1790 –1799,
2008.
7. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC.
Beta-cell deficit and increased beta-cell apoptosis in humans with type 2
diabetes. Diabetes 52: 102–110, 2003.
8. Cresto JC, Lavine RL, Buchly ML, Penhos JC, Bhathena SJ, Recant
L. Half life of injected 125I-insulin in control and ob/ob mice. Acta
Physiol Lat Am 27: 7–15, 1977.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
␤-Cell proliferation was increased as early as 3 days after
HFD feeding was initiated, a finding supported by the upregulation of key ␤-cell-proliferative genes at 1 wk. FoxM1, a
transcription factor required for postnatal ␤-cell proliferation
and elevated in islets from HFD-fed mice (14, 47), is activated
by the G2 cyclin, cyclin A2 (21). Furthermore, cyclin B1 is a
downstream target of FoxM1 during the G2/M transition,
whereas cyclins D1 and D2, predominant during G1, are
unaffected by Foxm1 overexpression (23). These data are
further supported by a recent study that found similar changes
in proliferative gene expression in islets from mice fed HFD
for 1 wk (35). The impaired glucose tolerance and diminished
plasma insulin concentration after 1 wk of HFD feeding may
be due in part to this observed increase in ␤-cell proliferation.
Oncology studies have shown that proliferating cells effectively switch to a less efficient metabolism (45), and although
controversial, some studies suggest that proliferating ␤-cells
are partially dedifferentiated (reviewed in Ref. 17). Therefore,
actively proliferating ␤-cells may temporarily experience decreased functionality. Although maximal ␤-cell proliferation is
observed after 3 days or 1 wk of HFD, a detectable increase in
␤-cell mass is not observed until 3 wk. A delay between
increased ␤-cell proliferation and a detectable increase in
␤-cell mass was not unexpected, as this also occurs in maternal
islets during pregnancy, where productive cell divisions must
accumulate to translate into measurable increases in ␤-cell
mass. We also assessed whether there was an increase in ␤-cell
death in response to HFD feeding that might explain the delay
in ␤-cell mass increase but were unable to detect any increase
in TUNEL-labeled insulin⫹ cells in the HFD-fed animals
compared with controls at 3 days, 1 wk, or 11 wk of HFD (data
not shown).
Based on previous studies that reported HFD-induced insulin resistance in as few as 3–7 days after initiation of HFD
feeding (2, 22, 32, 44), we expected to detect symptoms of
insulin resistance in 1-wk-HFD-fed mice. Instead, the present
studies suggest that insulin resistance occurs much later, after
at least 5 wk of HFD-feeding. The later time points are
concurrent with an increase in insulin resistance, as evidenced
by the growing impairment in glucose tolerance, hyperinsulinemia, and the worsening insulin tolerance in weeks 9 and 11.
The absence of insulin resistance after 1 wk of HFD was
supported by similar M/I indices in hyperinsulinemic euglycemic clamps. Metabolomics assessment of ␣-HB, a plasma
biomarker of insulin resistance in humans (11), confirmed the
absence of insulin resistance in multiple tissues of 1-wk-CDand -HFD-fed mice, thus validating this biomarker in mouse
models. Our results are supported by two studies; one study
failed to detect insulin resistance in 1-wk-HFD-fed mice, and
another measured insulin resistance in skeletal muscle, adipose
tissue, and liver and found that insulin resistance was detectable after 3 wk of HFD feeding (28, 35). Together, these results
suggest that ␤-cells initially proliferate in response to a change
in diet or an unknown HFD-induced factor before they respond
to insulin resistance. As HFD consumption continues, insulin
resistance increases, and hyperinsulinemia and enhanced ␤-cell
mass ensue. However, at later stages of HFD feeding, ␤-cell
proliferation declines and glucose tolerance becomes more
impaired.
In conclusion, our data suggest that ␤-cell proliferation in
response to HFD feeding is highly dynamic, occurring within
E581
E582
␤-CELL REPLICATION PRIOR TO INSULIN RESISTANCE
27. Nieman DC, Shanely RA, Gillitt ND, Pappan KL, Lila MA. Serum
metabolic signatures induced by a three-day intensified exercise period
persist after 14 h of recovery in runners. J Proteome Res 12: 4577–4584,
2013.
28. Park SY, Cho YR, Kim HJ, Higashimori T, Danton C, Lee MK, Dey
A, Rothermel B, Kim YB, Kalinowski A, Russell KS, Kim JK.
Unraveling the temporal pattern of diet-induced insulin resistance in
individual organs and cardiac dysfunction in C57BL/6 mice. Diabetes 54:
3530 –3540, 2005.
29. Pettersson US, Waldén TB, Carlsson PO, Jansson L, Phillipson M.
Female mice are protected against high-fat diet induced metabolic syndrome and increase the regulatory T cell population in adipose tissue.
PLoS One 7: e46057, 2012.
31. Plank JL, Frist AY, LeGrone AW, Magnuson MA, Labosky PA. Loss
of Foxd3 results in decreased beta-cell proliferation and glucose intolerance during pregnancy. Endocrinology 152: 4589 –4600, 2011.
32. Posey KA, Clegg DJ, Printz RL, Byun J, Morton GJ, VivekanandanGiri A, Pennathur S, Baskin DG, Heinecke JW, Woods SC, Schwartz
MW, Niswender KD. Hypothalamic proinflammatory lipid accumulation,
inflammation, and insulin resistance in rats fed a high-fat diet. Am J
Physiol Endocrinol Metab 296: E1003–E1012, 2009.
33. Rankin MM, Kushner JA. Adaptive beta-cell proliferation is severely
restricted with advanced age. Diabetes 58: 1365–1372, 2009.
34. Reimer MK, Ahren B. Altered beta-cell distribution of pdx-1 and
GLUT-2 after a short-term challenge with a high-fat diet in C57BL/6J
mice. Diabetes 51, Suppl 1: S138 –S143, 2002.
35. Stamateris RE, Sharma RB, Hollern DA, Alonso LC. Adaptive ␤-cell
proliferation increases early in high-fat feeding in mice, concurrent with
metabolic changes, with induction of islet cyclin D2 expression. Am J
Physiol Endocrinol Metab 305: E149 –E159, 2013.
36. Storey JD, Tibshirani R. Statistical significance for genomewide studies.
Proc Natl Acad Sci USA 100: 9440 –9445, 2003.
37. Surwit RS, Kuhn CM, Cochrane C, McCubbin JA, Feinglos MN.
Diet-induced type II diabetes in C57BL/6J mice. Diabetes 37: 1163–1167,
1988.
38. Surwit RS, Seldin MF, Kuhn CM, Cochrane C, Feinglos MN. Control
of expression of insulin resistance and hyperglycemia by different genetic
factors in diabetic C57BL/6J mice. Diabetes 40: 82–87, 1991.
39. Teta M, Long SY, Wartschow LM, Rankin MM, Kushner JA. Very
slow turnover of beta-cells in aged adult mice. Diabetes 54: 2557–2567,
2005.
40. Tomasi T, Sledz D, Wales JK, Recant L. Insulin half-life in normal and
diabetic subjects. Rev Neuropsychiatr Infant 14: 315–317, 1966.
42. Toye AA, Lippiat JD, Proks P, Shimomura K, Bentley L, Hugill A,
Mijat V, Goldsworthy M, Moir L, Haynes A, Quarterman J, Freeman
HC, Ashcroft FM, Cox RD. A genetic and physiological study of
impaired glucose homeostasis control in C57BL/6J mice. Diabetologia 48:
675–686, 2005.
43. Tschen SI, Dhawan S, Gurlo T, Bhushan A. Age-dependent decline in
beta-cell proliferation restricts the capacity of beta-cell regeneration in
mice. Diabetes 58: 1312–1320, 2009.
44. Turner N, Kowalski GM, Leslie SJ, Risis S, Yang C, Lee-Young RS,
Babb JR, Meikle PJ, Lancaster GI, Henstridge DC, White PJ, Kraegen EW, Marette A, Cooney GJ, Febbraio MA, Bruce CR. Distinct
patterns of tissue-specific lipid accumulation during the induction of
insulin resistance in mice by high-fat feeding. Diabetologia 56: 1638 –
1648, 2013.
45. Vander Heiden MG, Cantley LC, Thompson CB. Understanding the
Warburg effect: the metabolic requirements of cell proliferation. Science
324: 1029 –1033, 2009.
46. Winzell MS, Ahrén B. The high-fat diet-fed mouse: a model for studying
mechanisms and treatment of impaired glucose tolerance and type 2
diabetes. Diabetes 53, Suppl 3: S215–S219, 2004.
47. Zhang H, Ackermann AM, Gusarova GA, Lowe D, Feng X, Kopsombut UG, Costa RH, Gannon M. The FoxM1 transcription factor is
required to maintain pancreatic beta-cell mass. Mol Endocrinol 20: 1853–
1866, 2006.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00460.2014 • www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.3 on July 31, 2017
9. Evans AM, DeHaven CD, Barrett T, Mitchell M, Milgram E. Integrated, nontargeted ultrahigh performance liquid chromatography/electrospray ionization tandem mass spectrometry platform for the identification
and relative quantification of the small-molecule complement of biological
systems. Anal Chem 81: 6656 –6667, 2009.
10. Fearnside JF, Dumas ME, Rothwell AR, Wilder SP, Cloarec O, Toye
A, Blancher C, Holmes E, Tatoud R, Barton RH, Scott J, Nicholson
JK, Gauguier D. Phylometabonomic patterns of adaptation to high fat
diet feeding in inbred mice. PLoS One 3: e1668, 2008.
11. Ferrannini E, Natali A, Camastra S, Nannipieri M, Mari A, Adam
KP, Milburn MV, Kastenmuller G, Adamski J, Tuomi T, Lyssenko V,
Groop L, Gall WE. Early metabolic markers of the development of
dysglycemia and type 2 diabetes and their physiological significance.
Diabetes 62: 1730 –1737, 2013.
12. Fontes G, Zarrouki B, Hagman DK, Latour MG, Semache M,
Roskens V, Moore PC, Prentki M, Rhodes CJ, Jetton TL, Poitout V.
Glucolipotoxicity age-dependently impairs beta cell function in rats despite a marked increase in beta cell mass. Diabetologia 53: 2369 –2379,
2010.
13. Gall WE, Beebe K, Lawton KA, Adam KP, Mitchell MW, Nakhle PJ,
Ryals JA, Milburn MV, Nannipieri M, Camastra S, Natali A, Ferrannini E; RISC Study Group. alpha-hydroxybutyrate is an early biomarker
of insulin resistance and glucose intolerance in a nondiabetic population.
PLoS One 5: e10883, 2010.
14. Golson ML, Misfeldt AA, Kopsombut UG, Petersen CP, Gannon M.
High Fat Diet Regulation of ␤-Cell Proliferation and ␤-Cell Mass. Open
Endocrinol J 4: 68 –79, 2010.
15. Golson ML, Bush WS, Brissova M. Automated quantification of pancreatic ␤-cell mass. Am J Physiol Endocrinol Metab 306: E1460 –E1467,
2014.
16. Golson ML, Maulis MF, Dunn JC, Poffenberger G, Schug J, Kaestner
KH, Gannon MA. Activated FoxM1 attenuates streptozotocin-mediated
␤-cell death. Mol Endocrinol 28: 1435–1447, 2014.
17. Granger A, Kushner JA. Cellular origins of beta-cell regeneration: a
legacy view of historical controversies. J Intern Med 266: 325–338, 2009.
18. Henley KD, Gooding KA, Economides AN, Gannon M. Inactivation of
the dual Bmp/Wnt inhibitor Sostdc1 enhances pancreatic islet function.
Am J Physiol Endocrinol Metab 303: E752–E761, 2012.
19. Hull RL, Kodama K, Utzschneider KM, Carr DB, Prigeon RL, Kahn
SE. Dietary-fat-induced obesity in mice results in beta cell hyperplasia but
not increased insulin release: evidence for specificity of impaired beta cell
adaptation. Diabetologia 48: 1350 –1358, 2005.
20. Kooptiwut S, Kebede M, Zraika S, Visinoni S, Aston-Mourney K,
Favaloro J, Tikellis C, Thomas MC, Forbes JM, Cooper ME, Dunlop
M, Proietto J, Andrikopoulos S. High glucose-induced impairment in
insulin secretion is associated with reduction in islet glucokinase in a
mouse model of susceptibility to islet dysfunction. J Mol Endocrinol 35:
39 –48, 2005.
21. Laoukili J, Alvarez M, Meijer LA, Stahl M, Mohammed S, Kleij L,
Heck AJ, Medema RH. Activation of FoxM1 during G2 requires cyclin
A/Cdk-dependent relief of autorepression by the FoxM1 N-terminal domain. Mol Cell Biol 28: 3076 –3087, 2008.
22. Lee YS, Li P, Huh JY, Hwang IJ, Lu M, Kim JI, Ham M, Talukdar
S, Chen A, Lu WJ, Bandyopadhyay GK, Schwendener R, Olefsky J,
Kim JB. Inflammation is necessary for long-term but not short-term
high-fat diet-induced insulin resistance. Diabetes 60: 2474 –2483, 2011.
23. Leung TW, Lin SS, Tsang AC, Tong CS, Ching JC, Leung WY,
Gimlich R, Wong GG, Yao KM. Over-expression of FoxM1 stimulates
cyclin B1 expression. FEBS Lett 507: 59 –66, 2001.
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(⫺Delta Delta C(T)) Method.
Methods 25: 402–408, 2001.
26. McGuinness OP, Ayala JE, Laughlin MR, Wasserman DH. NIH
experiment in centralized mouse phenotyping: the Vanderbilt experience
and recommendations for evaluating glucose homeostasis in the mouse.
Am J Physiol Endocrinol Metab 297: E849 –E855, 2009.