Plant Mol Biol (2007) 63:519–532
DOI 10.1007/s11103-006-9106-y
Isolation and characterization of the cytoplasmic male sterilityassociated orf456 gene of chili pepper (Capsicum annuum L.)
Dong Hwan Kim Æ Jeong Gu Kang Æ Byung-Dong Kim
Received: 21 April 2006 / Accepted: 30 October 2006 / Published online: 21 January 2007
Springer Science+Business Media B.V. 2007
Abstract Cytoplasmic male sterility (CMS) in plants
is known to be associated with novel open reading
frames (ORFs) that result from recombination events
in the mitochondrial genome. In this study Southern
and Northern blot analyses using several mitochondrial
DNA probes were conducted to detect the presence of
differing band patterns between male fertile and CMS
lines of chili pepper (Capsicum annuum L.). In the
CMS pepper, a novel ORF, termed orf456, was found
at the 3¢-end of the coxII gene. Western blot analysis
revealed the expression of an approximately 17-kDa
product in the CMS line, and the intensity of expression of this protein was severely reduced in the restorer
pepper line. To investigate the functional role of the
ORF456 protein in plant mitochondria, we carried out
two independent experiments to transform Arabidopsis with a mitochondrion-targeted orf456 gene construct by Agrobacterium-mediated transformation.
About 45% of the T1 transgenic population showed the
male-sterile phenotype and no seed set. Pollen grains
from semi-sterile T1 plants were observed to have defects on the exine layer and vacuolated pollen phenotypes. It is concluded that this newly discovered orf456
may represent a strong candidate gene – from among
GenBank accession number DQ116040 (orf456 genomic
sequence), DQ126683 (pepper coxII genomic sequence)
D. H. Kim J. G. Kang B.-D. Kim (&)
Department of Plant Science, College of Agriculture and
Life Sciences, and Center for Plant Molecular Genetics and
Breeding Research, Seoul National University, Seoul 151921, Korea
e-mail: [email protected]
the many CMS-associated mitochondrial genes – for
determining the male-sterile phenotype of CMS in chili
pepper.
Keywords Arabidopsis thaliana Capsicum
annuum L. Cytoplasmic male sterility (CMS) Mitochondrial mutant Mitochondrial targeting
signal orf456
Introduction
Cytoplasmic male sterility (CMS) is a maternally
inherited trait that leads to the failure to produce
functional pollens. The gene associated with the CMS
trait has been identified in the mitochondrial genome
(Schnable and Wise 1998). Specific genes implicated in
CMS have been reported for maize (Dewey et al.
1986), petunia (Young and Hanson 1987), bean (Johns
et al. 1992), Brassica (Bonhomme 1992; Grelon et al.
1994), radish (Makaroff et al. 1990), sunflower
(Moneger et al. 1994), rice (Akagi 1995), carrot
(Kanzaki et al. 1991), sorghum (Tang et al. 1996) and
many others. Although these CMS-associated genes
are usually generated by intra-molecular rearrangement of mitochondrial DNA (mtDNA) (Hanson 1991),
the open reading frames (ORFs) share no significant
sequence homology, and it is still not clear just how
these genes act in CMS plants to produce mitochondrial dysfunction (Hanson and Bentolila 2004).
Several attempts have been made to transform these
CMS-associated genes into fertile plants. The orf239,
which is the CMS-associated mtDNA sequence of
common bean (Abad et al. 1995), has been transformed into tobacco, with or without mitochondrial
123
520
targeting sequences. The transformed tobacco plants
exhibited a semi-sterile or male-sterile phenotype, despite the fact that the protein may not have been targeted to the mitochondria (He et al. 1996). Another
CMS-associated gene, the urfS sequence of the pcf
gene that encodes a 25-kDa protein in petunia, has
been transformed into petunia and tobacco plants with
constructs that contain mitochondrial targeting sequences. The expression of the PCF protein was detected in the mitochondria of transgenic petunia and
tobacco plants, although plant fertility was not affected
(Wintz et al. 1995).
In chili pepper (Capsicum annuum L.), CMS was
first documented in the PI 164835 line from India
(Peterson 1958). CMS pepper has subsequently been
utilized for the production of F1 hybrids in South
Korea and world wide. This so-called Peterson’s CMS
line is the only source of hybrid F1 pepper seeds.
Despite the agricultural importance of CMS pepper,
not a great deal of attention has been paid to the
molecular analysis of the CMS genes in pepper. Based
on the results of a restriction fragment length polymorphism analysis of male-fertile and CMS pepper,
we recently reported that the coxII and atp6-2 regions
of these two lines have different DNA structures
(Kim et al. 2001). We subsequently developed CMSspecific SCAR (sequence-characterized amplified region) markers on the basis of the sequence data (Kim
and Kim 2005).
The CMS trait can be suppressed by the action of
the Rf gene in nucleus (Hanson and Bentolila 2004).
Genetic studies between CMS mitochondrial factors
and nuclear Rf genes in pepper have been reported by
several groups. However, just how many Rf genes
actually affect the CMS trait in pepper has not yet been
clearly determined. Suggestions to date include the
existence of the Rf gene as one or two major Rf genes
or, alternatively, as a major dominant gene with several
modifier genes (Peterson 1958; Novak et al. 1971;
Wang et al. 2004). In a study on fertility restoration in
CMS pepper, Wang et al. (2004) recently detected one
major quantitative trait locus (QTL) and four additional minor QTLs. Based on these reports, we
hypothesized that there may be more than one CMSinducing factor in pepper mitochondria. Despite the
fact that we had already detected transcriptional differences in the atp6 gene between the CMS and restorer line (Kim and Kim 2006a), we focused on
investigating a second CMS-associated gene in pepper.
We report here our detection of a CMS-associated
gene in pepper, orf456, and present evidence that it
generates the male-sterile phenotype in transformed
Arabidopsis when introduced together with mito-
123
Plant Mol Biol (2007) 63:519–532
chondrion-targeting sequences. Based on this evidence,
we propose that orf456 is a strong candidate gene for
determining the male-sterile phenotype of CMS in chili
pepper.
Results
Southern blot analysis was performed using eight
mitochondrial gene-specific probes which had been
reported to be associated to CMS in other higher
plants (Table 2). Of these, four probes, namely, atpA,
atp6, coxI, and coxII revealed RFLPs between malefertile and CMS pepper lines (Fig. 1a). Northern blot
analysis between the male-fertile and CMS mtDNAs
revealed an absence of differences with the atpA, atp6,
and coxI probes but the coxII transcripts showed different band patterns (the uppermost bands indicated
by arrows in Fig. 1b). We therefore subjected the coxII
gene region to analysis by inverse PCR. The ORF
FINDER program (http://www.ncbi.nlm.nih.gov/gorf/)
predicted a new ORF, which we termed orf456, in the
3¢-end region of the coxII gene in the CMS line
(Fig. 1c). Differences in the nucleotide sequences of
the fertile and CMS coxII flanking regions were
apparent in the 3¢-end non-coding region, which lies
41 nt in the 3¢-direction from the stop codon of the
coxII gene (Fig. 2).
In the case of rice, incomplete RNA editing events,
which produce malfunctional proteins, have been
associated with fertility restoration (Iwabuchi et al.
1993). To test this possibility we amplified DNA
complementary to orf456 from both CMS (S/rf/rf)
pepper and restorer (S/Rf/Rf) pepper lines and compared these samples for the occurrence of RNA editing. All of the orf456 clones from the CMS and restorer
lines shared the same single editing site at 150 nt
downstream from the start codon. The RNA editing
from C to U would result in a silent mutation
(Leu fi Leu) (Fig. 2).
The RT-PCR and Northern blot analyses confirmed
that orf456 was transcribed in sterile and restorer lines
as both of these carried the S-cytoplasm that induces
the CMS phenotype in chili peppers (Fig. 3a, b). The
primer region and sequences spanning the orf456
coding sequence for the RT-PCR experiments are
shown in Fig. 1c and Table 1, respectively. RT-PCR
with the primer pair of (1) and (3) revealed that the
456-bp orf456 gene was transcribed exclusively in the
S-cytoplasm of the pepper. RT-PCR with the primer
pairs of (2) and (3) generated an 804-bp product
exclusively in the S-cytoplasm, which indicated that the
orf456 gene is co-transcribed with the coxII gene
Plant Mol Biol (2007) 63:519–532
521
Fig. 1 Southern and Northern blot analysis of male-fertile and
cytoplasmic male-sterile (CMS) mitochondrial (mt)DNAs.a
Southern blot analysis of mtDNAs digested with EcoRI, HindIII,
and BamHI hybridized with eight mitochondrial probes (coxI,
coxII, coxIII, atpA, atp6, atp9, cob, and nad9 genes) to compare
male-fertile (F) and CMS (S) lines in Capsicum annuum L.
Polymorphic bands between the male-fertile and CMS line are
indicated by arrows. b Northern blot analysis of mtRNAs with
four mitochondrial probes (atpA, atp6, coxI, and coxII). The
coxII gene showed polymorphic band patterns of RNA tran-
scripts (indicated by arrow). c Schematic structure of the malefertile and CMS coxII 5¢ and 3¢ flanking regions determined by
inverse PCR. The horizontal arrowheads indicate the primer
region used for inverse PCR and the reverse transcription (RT)PCR experiments. Primers a, b, c, and d were used for the
inverse PCR experiment. Primers (1), (2), and (3) were used for
the RT-PCR experiment. The oligonucleotide sequences are
listed in the Table 1. The length of the nucleotide sequence of
each region is represented above that region. F Male fertile, S
CMS pepper
upstream (Fig. 3a). Northern blot data on male-fertile
and CMS total RNAs also showed that orf456 was
transcribed exclusively in the sterile S-cytoplasm.
Northern blot analysis was carried out to determine the
difference between orf456 transcription in the restorer
and CMS lines. The electrophoresis of the RNA shown
in Fig. 3b was run for a longer time than that depicted
in Fig. 1b in order to obtaine more distinct RNA
bands. Although less intensive bands were obtained for
the CMS line (which seemed to result from an
inequality of RNA transfer to membrane) than for the
restorer line, there was little difference in the RNA
banding patterns (Fig. 3b).
The BLAST search of the nucleotide databases revealed no significant homology with orf456, with the
exception that the 5¢-region (40–91 nt) of orf456
showed 90% homology with the 5¢-non-coding region
of the mitochondrial atp6 gene of Helianthus annuus
(GenBank number X82388; Spassova et al. 1994). The
transmembrane region is a common feature of proteins
123
522
Fig. 2 Comparison of
nucleotide sequences of coxII
3’ flanking region between
male fertile (upper) and CMS
(lower) lines. The coxII 5’
flanking and coding
sequences (7- 2792) were
omitted. The coxII coding
sequence can be found in the
GenBank by the accession
number of DQ126683. The 5’
nucleotide sequences
common to male fertile and
CMS were shown in gray
characters. Asterisks indicated
the start sites of sequence
divergence. The orf456, a
new-made open reading
frame (456-bp) at CMS coxII
downstream region,
underlined between the start
(ATG) and stop (TAA)
codons in bold characters, was
found by the program ‘ORF
finder’ in NCBI homepage.
EcoRI enzyme sites were
indicated by parentheses. The
sequence homologous to the
5’-non-coding region of the
mitochondrial atp6 gene of
H. annuus was indicated by
upper dots. The C to T editing
site 159 bp downstream from
the start codon was indicated
by a small character
Plant Mol Biol (2007) 63:519–532
Fertile
TAA 2795
1 (GAATTC)
2796 AGCGCGGAAGCTTAAGCGGAAATGAAAGAGGAGGTTGAGG GAAGCCACT
AAATTGAGGGCTTCGCTCGCTCGCTCTAACGCTCGTTTAGTAGACAGCGA
GTGGAGTGCATAAGCCCCTTTAGAGATAGGGGTGAGTACTACACGAGCT
CGTAAGTAAAGTACGGAACGAGCCTTGTCTACGAAGCAGAGCGACCTCAT 3040
CTTGCTTGCTTCTGGCGAAGCTTCTAGCTCTAAATAATAGG(GAATTC)
*
CM S
TAA 2795
1 (GAATTC)
2796 AGCGCGGAAGCTTAAGCGGAAATGAAAGAGGAGGTTGAGG TTATGAAGTC
ACTTAGCCGTATACTATACAAAGGGAAAGGCGTCGGTACGGAGTCACGTC
AGCTGTGGATATAGACTAGGCTATAAGGAACGGAGTCTTAAACTATGGACC
••••••••••••••••••••••
GAGACAGATATATAGAAAGTGTGCAGTGAGGGTGCTTGTAAATCACTAGGT
•••••••••••••••••••••••
AGCCTAGCTCGACCCAAGCAATGCCCAAAAGTCCCATGTATTTCTGGTTAA
ACAAACCAGCAATTTCCGACAAGTCTTTCTTCATTGGAAGAGCAAGAAGCG
GAACTACAACATTTACATGCAATTTCACCATGAATTTTATTGATTATGGCACA
TTGTTTACTTTTTCTTTTTATCTcGGTATTTCAATCGGCATTTTTGCGGGCCG
GTTTTTTGAGCGAAGTGAAGTTTTACAGGAATTGGAGAACTTCCAGCTAGA
AAAAATAAAACTGAAAACGGAAGCAGAACTGCAATTTCTTTGTAGAGAGCA
CTTGAGAATGAATGAAGAATTACAATTACCTGTTCCAGATGGAACGAGTAT
GCACATCTCCGACTTTTTAGGGAAAGCCTTTTTGGTCGACGAGACTGTGAG
GGAACGAATATTAGGGCTGACTCAAATTTATATGGATCTAAAAAACAATGGA
GCAACCGAGTAACTTTTTTCTTTTATTTTTAGACTATTATAGCAATTTGTTTA
GCGCTTTTTAATATATTCGTCTGTCGCCGTTGCAGCTAAAATAACGGAGGA
TGGAGGCGGGGAGGGGAGGGGGACATCAAATGGATTCAAGTTTGAACAAA
ACAGGAAGAGGTTCGATTCCTCTTTGATGTTGTTAAGCCAAGAGCGCCAAG
CGCATGCGCGAAATGAGAGCGTCAGGAATGGAAAGGCAAAACCTACTATG
CACCAAGTCCAGGAACCCGAGTCCGAGTACAGTGAATCAAGGAAGAGACT
GCAGCTTCATCAGCTCAATGCAAGGTCCGTCGAAATCTTCCGGAGGGGTC
TAGCATCCCGTAGGTCAGTTACTCCAGCGCCACAGTTCGACAGCTCGGGA
AATACCTCTCACGCCCACGGTCGTCTTTTGACCACGCAATGACCTTCCCAG
AATGGGTTGCAGAAAGCAGAATCTCAAAGGGGGAACCCCATCCAGGGGAT 4385
ATGCAGATAGAGCGCCCAAGACTTGGCAGGGAACGGGACCGTGATTCTGA
AGAGGAACAGACAAGAGGAAAGCAAGGCCAAGAAGCCTCCGGGATAGACT
CCTCCCTCTATACGTGGGAGCAACATAGACAGTTCCTCTTCCCTGAAGCCG
AGGCCAAACTAACATATCCTGTTTCTCCCGAAACAACGGATTCCTCACCCT
CAGGAGCCCCAAGTAACGAATCCGAATGCCTATCTCCCGTTTAATAAGACT
TATTGGAATGGAAGAAGGAGAGTAGTCCTCTGGTCATCAGTTAGTAGTTCA
ATAATCCCAGTAGTTGTCCTCTTGCCTAAAAAAAGGAGTCAGCCCAACATG
GACAATGATAGGCAGACCAAAGATTTACGCAGTCCTTGCGTGCTTGCTTTG
CGCACC(GAATTC)
encoded by CMS-associated genes in plants (data not
shown). This gene was also predicted to encode a
transmembrane protein with a molecular mass of
17 kDa.
To verify that the orf456 transcript was really
translated into a protein, the orf456 cDNA was cloned
into the pTrcHis2-TOPO expression vector. An IPTGinduced band of the expected size (approximately
21 kDa; i.e., the 17-kDa ORF456 plus the 4-kDa His
tag) was detected by 12% SDS-PAGE in the insoluble
fraction of the E. coli extracts (Fig. 3c). The identity of
this band was confirmed by Western blot analysis using
the anti-His tag antibody (Fig. 3d). The induced
ORF456 polypeptide (2.5 mg) was eluted for injection
into a rabbit. When the anti-ORF456 antibodies were
tested against protein extracts from fertile and CMS
mitochondria, a single band of about 17 kDa was detected exclusively in the CMS line (Fig. 3e). Furthermore, the band intensity of the ORF456 product was
123
*
severely diminished in the restorer line that carried the
Rf gene with S cytoplasm background (Fig. 3f). The
presence of the nuclear Rf gene in the restorer line is
known to suppress expression of the CMS trait and,
consequently, to restore pollen fertility in CMS plants.
To further ascertain the association between the
orf456 gene and the CMS trait in pepper, we designed
constructs for Arabidopsis transformation. The detailed structure of the orf456 and egfp genes with
restriction sites that were used in the insert construction is shown in Fig. 4a. In the first construct (referred
to as coxIV-orf456), the orf456 sequence was fused to
the mitochondrial transit peptide sequence of the
presequence (54 codons) of the nuclear coxIV gene of
yeast for mitochondrial targeting of the protein. The
second construct (referred to as nontargeting-orf456)
did not contain the mitochondrion-targeting peptide
sequence. A third construct (coxIV-gfp) was designed
using the coxIV presequence and egfp (720 bp) in
Plant Mol Biol (2007) 63:519–532
Fig. 3 RNA and protein expression analysis of orf456 gene. a
RT-PCR analysisof orf456, which is located in the 3’ region of
the coxII gene in the CMS line. RT-PCR with primer (1) and (3)
pair was performed to detect whether newly-made orf456 is
really and uniquely transcribed in the CMS line. RT-PCR with
the primer (2) and (3) pair was performed to detect whether the
orf456 gene is co-transcribed with coxII located on the upstream
region. b Northern blot analysis of total RNAs extracted from
each tissue of the male-fertile, CMS, and restorer line with the
orf456 cDNA probe. About 20 lg/lane RNA from each tissue
was loaded onto a 1.2% agarose gel and transferred to a N+
nylon membrane. The bands which showed polymorphism in Fig.
1b are indicated by arrows. F Fertile, S CMS, R restorer line. c
Induction of the ORF456-His recombinant fusion protein by
isopropyl-beta-D-thiogalactopyranoside (IPTG). Each Escherichia coli protein extract (15 lg) separated into a soluble (S) and
insoluble (I) fraction was loaded onto a 12% sodium dodecyl
sulfate-polyacrylamide electrophoresis gel (SDS-PAGE). The
induced ORF456-His recombinant protein is indicated by an
523
arrow. d Western blot analysis of the ORF456-His recombinant
protein using the His-tag antibody. The IPTG-induced ORF456His recombinant protein was detectedin the insoluble fraction
(arrow indicated). Weak expression of the ORF456-His
recombinant protein was also detected in the insoluble fraction
even at no addition of IPTG. e Western blot analysis using the
anti-ORF456 antibody on mitochondrial proteins from malefertile and CMS pepper. The analysis was performed on about
30 lg of purified mitochondrial protein from male-fertile (F) and
CMS (S) pepper. Protein extracts from the insoluble fraction of
E. coli containing ORF456-His recombinant protein were used
as positive control (I). Molecular mass markers in kiloDaltons
(kDa) are shown to the left. f Western blot analysis using antiORF456 antibody on mitochondrial proteins from CMS (S) and
restorer (R) pepper. Purified mitochondrial proteins from CMS
and restorer were loaded on the SDS-PAGE gel. The antimitochondrial ATPase subunit a (ATPa) antibody was used as a
control. Molecular mass markers in kiloDaltons are shown to the
left. M Western view size marker (Elpisbio, Korea)
123
524
Plant Mol Biol (2007) 63:519–532
order to investigate whether the coxIV presequence
was capable of transporting a protein of interest into
plant mitochondria. The primer pairs used for constructing the insert are listed in Table 1.
The EGFP fusion construct was transiently expressed in onion epidermal cells following particle
bombardment. The Mitotracker CMSRox dye was
used to detect mitochondria. The GFP fluorescence
image and the Mitotracker dye image matched perfectly (Fig. 4b), indicating that the coxIV presequence
from yeast could target a translation product of interest
in plant cell mitochondria.
The first (coxIV-orf456) and the second (non-targeting-orf456) constructs were used to transform Arabidopsis using the floral dip method (Clough and Bent
1998). The flower phenotype of the non-targetingorf456 transformants was normal and similar to that of
the wild-type plant. However, the anthers of coxIVorf456 T1 plants exhibited a male-sterile phenotype
(Fig. 5). At the early stage of development, the anthers
of coxIV-orf456 transformants developed normally.
However, the coxIV-orf456 transformants at the
dehiscent stage did not produce any pollen grains and
Table 1 Oligonucleotides
used in this study. The
restriction enzyme sequences
for cloning were indicated by
underline
123
normal siliques (Fig. 5j). To confirm the function of
orf456 in producing the male-sterile phenotype, two
independent transformation tests were conducted.
About 45% of the total transgenic Arabidopsis T1
plants that contained coxIV-orf456 exhibited the malesterile phenotype (Fig. 6a). RNA gel blot analysis with
nine kanamycin-resistant T1 plants revealed that malesterile T1 plants (nos. 1, 2, and 3 in Fig. 6c) strongly
expressed the orf456 gene. Several plants (nos. 4, 5, 7,
and 9) that were kanamycin resistant but did not, or
only slightly, express the targeted orf456 gene had a
fertile phenotype indistinguishable from that of the
wild type. Interestingly, two T1 plants (nos. 8 and 11)
showing some expression were revealed to have a
semi-fertile phenotype and poor seed setting when
compared to the wild-type or other fertile transformants. In the first transformation experiment, three T1
plants (nos. 8, 11, and 15) out of 51 transgenic T1 plants
had the semi-fertile phenotype. Therefore, T2 progenies from two semi-fertile T1 transformants (nos. 8 and
15) were grown under the same conditions, and the
fertility of the T2 plants was evaluated. More than 60%
of the T2 progenies of T1 lines nos. 8 and 15 had the
Oligonucleotide
name
Sequence (5¢-3¢)
Application
cob-F
cob-R
nad9-F
nad9-R
atpA-F
atpA-R
atp6-F
atp6-R
atp9-F
atp9-R
coxI-F
coxI-R
coxII-F
coxII-R
coxIII-F
coxIII-R
Primer a
Primer b
Primer c
Primer d
Primer (1)
Primer (2)
Primer (3)
BamHI-coxIVF
SmaI-coxIVR
SmaI-DcoxIVR
orf456-F
SacI-orf456R
egfp-F
SacI-egfpR
AGCATTTGATAGATTATCCAACCCC
GAATGGGCGTTATGGCAAAGAA
CATGGGAATAGATCTGATACCAAT
GCAAAATCGAAATAGCGAAATTCTT
ATTTTCAAGTGGATGAGATCGGT
GATCACAGAATCCATTGACAGCT
TATTTCTCATTCACAAATCCC
AGCATCATTCAAGTAAATACAGAT
ATGTTAGAAGGTGCAAAATCA
GAAAACGAATGAGATCAGAAAGGC
TAACCACAAGGATATAGGGACTC
GATTGTTACGACCACGAAGAAAC
GATGCAGCGGAACCATGGCAATTA
ACTGCACTGACCATAGTAAACTCC
ATGATTGAATCTCAGAGGCAC
ACCACCCCACCAATAGATAGA
GCCATAAAGCGCGACCCAAGATCCATGATACGAA
GAGAATTGACCTATTCATAGAGTGATCCTATGATC
CTTGGCTGGTAGAACCACTCTATTG
GAAGGAGTTTACTATGGTCAGTGCAG
ATGCCCAAAAGTCCCATGTAT
GAAGGAGTTTACTATGGTCAGTGCAG
TTACTCGGTTGCTCCATTGT
GGATCCATGTTGTCACTACGTCAATCTATAAGA
CCCGGGACCCTCTTTAGCACCAGGACC
CCCGGGTTTTTGCTGAAGCAGATATCT
ATGCCCAAAAGTCCCATGTATTT
GAGCTCTTACTCGGTTGCTCCATTGTT
ATGGTGAGCAAGGGCGAGGAGC
GAGCTCTTACTTGTACAGCTCGTC
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Probe
Inverse PCR
Inverse PCR
Inverse PCR
Inverse PCR
RT-PCR
RT-PCR
RT-PCR
pCAMBIA2300
pCAMBIA2300
pCAMBIA2300
pCAMBIA2300
pCAMBIA2300
pCAMBIA2300
pCAMBIA2300
Plant Mol Biol (2007) 63:519–532
525
Fig. 4 a Construction of orf456 and egfp-1 transgene for
Arabidopsis transformation. The diagram shows the strategy
for cloning each gene construct into the modified pCAMBIA2300 plant transformation vector. The egfp indicates the
green fluorescent protein (GFP) variants purchased from
Clontech (Palo Alto, Calif.). Amino acid sequences of the cox4
presequence (mitochondria-targeting sequence) are shown below
the cox4’ gray box. NPTII Neomycin phosphotransferase II
gene, MCS multi-cloning site, NOS ter NOS terminator site, LB
left border, RB right border, Kmr kanamycin resistance gene. b
Images of GFP fluorescence in the onion transient expression
assay. The left image depicts the mitochondrial-targeting GFP
fluorescence, the right image shows staining with the Mitotracker
CMXRox red dye (Molecular Probes, Eugene, Ore.) The
merged picture is shown below
Fig. 5 Phenotype of non-targeting-orf456 and mitochondriatargeting coxIV-orf456 transgenic T1 Arabidopsis plant. a
Feature of non-targeting-orf456 Arabidopsis T1 transformant. b
Feature of mitochondria-targeting coxIV-orf456 Arabidopsis T1
transformant. c Flower of non-targeting-orf456 T1 transformant;
normal pollen grains were observed (inset). d Flower of
mitochondria-targeting coxIV-orf456 Arabidopsis T1 transformant; male-sterile phenotype with no pollen grains was observed
(inset). e Anther morphology of non-targeting-orf456 T1 transformant; enlarged photograph from inset within c. Normal pollen
grains are shown. f Pistil morphology of non-targeting-orf456 T1
transformant. g Anther morphology of mitochondria-targeting
coxIV-orf456 T1 transformant. Enlarged photograph from inset
within d. No pollen grains were observed (arrow). h Pistil
morphology of mitochondria-targeting coxIV-orf456 T1 transformant. I Silique formation of non-targeted-orf456 transformant
along the developmental stage. Normal silique was produced. j
Silique formation of mitochondria-targeting coxIV-orf456 transformant along the development stages. Normal silique was not
produced
male-sterile phenotype (Fig. 6b). Three male-fertile
(nos. 1, 2, 7) and three male-sterile (nos. 4, 10, 14) T2
plants from the T1 line no. 8 transformant were used
for Northern blot analysis (Fig. 6d). The transgenic
plants showing the male-sterile phenotype were detected to have strong orf456 expression levels.
123
526
Plant Mol Biol (2007) 63:519–532
b Fig. 6 Fertility evaluation on transgenic Arabidopsis plants from
two independent transformation experiments. Three T1 plants
(#8, #11, #15) showing semi-sterile phenotype are indicated by
asterisk. This classification was based on anther morphology at
the dehiscent stage and seed sets. Double-hatched bar indicates
the number of total plants used for each transformation
experiment. Single-hatched bar indicates the number of male
fertile T2 transformants. White bar indicates the number of male
sterile T1 transformants. 35S-GFP CaMV35S::egfp construct
(positive control), 35S-ORF CaMV35S::orf456 construct (nontargeting), 35S-CXORF CaMV35S::coxIV::orf456 construct
(mitochondria-targeting). b Result of fertility evaluation on
transgenic T2 Arabidopsis progenies (T2 from T1 nos. 8 and 15
showing the semi-sterile phenotype). Double-hatched bar indicates the number of total plants used for each transformation
experiment, single-hatched bar indicates the number of malefertile T2 transformants, white bar indicates the number of malesterile T2 transformants. The observed plant number of each
transformant is shown above each bar. WT Wild type (ecotype
Columbia), 35S-GFP CaMV35S::egfp construct (positive control), 35S-ORF CaMV35S::orf456 construct (non-targeting),
35S-CXORF CaMV35S::coxIV::orf456 construct (mitochondriatargeting). This classification was based on anther morphology at
the dehiscent stage and seed sets. c PCR and Northern blot
analysis on T1 Arabidopsis transgenic plants. Wild-type plant and
nine coxIV-orf456 T1 transgenic plants were used for the
analysis. For the PCR analysis, Primer (1) and (3) in Table 1
was used. Full-length orf456 cDNA was used for the Northern
blot analysis. Total RNA (15 lg) was loaded onto a 1.2%
formaldehyde gel. Fertility evaluation was carried out under a
stereo-microscope at least three times at different flowering
periods. T1 nos. 8 and 11 plants showing the semi-sterile
phenotype are indicated with asterisks. d Northern blot analysis
of T2 Arabidopsis transgenic plants. Three male-fertile and three
male-sterile T2 transgenic plants from T1 no. 8 plant were
selected and used for analysis. WT Wild type
Light microscopy examination was unable to find
pollen grains in the anther epidermis of coxIV-orf456
transformants (Fig. 5g). However, pollen-like grains
were observed within the anther locules following
aceto-carmine staining (data not shown). The plasmolysis test was performed to check the intactness of
pollen-like grains. When placed in hypertonic (25%
glycerol) solution, the pollen-like grains burst within
10 min (Fig. 7b), while the wild-type pollen grains remained intact even after 24 h (Fig. 7a).
Each anther of the coxIV-orf456 transformants and
wild-type plants were collected at the dehiscent stage
and fixed for light microscopy (LM), scanning electron
microscopy (SEM), and transmission electron microscopy (TEM). Pollen grains within the anther locules
were squeezed out and observed under SEM. While
the pollen from the wild-type plants had the normal
phenotype (Fig. 7c, d), most of the pollen from the
coxIV-orf456 transformants had abnormal exine surfaces (Fig. 7e and f, arrows). Wild-type anthers contained many dehiscent pollen grains in the anther sac
123
(Fig. 7g, h). However, the coxIV-orf456 anthers did not
dehiscence and there was no pollen in the anther sac
(Fig. 7I, j).
Anthers at the dehiscent stage were cross-sectioned
and observed by LM and TEM. Under LM, the coxIVorf456 anthers were found to contain vacuolated pollen
grains (Fig. 7l), while the wild-type anthers showed
normal features (Fig. 7k) (Bowman 1993). More detailed features of the pollen grains were obtained by
TEM. The wild-type pollen grains were filled with
normal cytoplasmic components (Fig. 7m and n), while
the coxIV-orf456 male-sterile anthers contained
abnormally vacuolated pollen grains, even at the
dehiscent stage (Fig. 7o, p).
Discussion
In all CMS systems investigated up to date, the CMS
has resulted from changes in the organization of
mitochondrial genes. RFLP analysis has been used in
Plant Mol Biol (2007) 63:519–532
527
Fig. 7 Light microscopy (LM) and electron microscopy photographs of anther and pollen of wild-type and mitochondriatargeting coxIV-orf456 T1 plants. a Pollen grain of wild-type
Arabidopsis plant stored in a 25% glycerol hypertonic solution
for 24 h. b Pollen grain of mitochondria-targeting coxIV-orf456
T1 Arabidopsis plant stored with 25% glycerol hypertonic
solution for 10 min. c Scanning electron microscope (SEM)
picture of pollen grains of wild-type A. thaliana. Bar: 10 um. d
SEM picture on pollen grain of wild type A. thaliana. Bar: 5 um.
e SEM picture on pollen grains of mitochondria-targeting coxIVorf456 T1 plant. Bar: 10 um. f SEM picture on pollen grain of
mitochondria-targeting coxIV-orf456 T1 plant. The abnormal
exine layer of the pollen grain is shown and indicated by arrows.
Bar: 5 lm. g SEM picture of the anther at the dehiscent stage
from wild-type A. thaliana. Bar: 50 lm. h SEM picture enlarged
from the inset within g. Bar: 10 lm. I SEM picture on anther at
dehiscent stage from mitochondria-targeting coxIV-orf456 T1
plant. Bar: 50 lm. j SEM picture enlarged from the inset within
I. Bar: 10 lm. k LM picture of cross-sectioned anther at
dehiscent stage from wild type A. thaliana. l LM picture of
cross-sectioned anther at dehiscent stage from wild-type A.
thaliana. Vacuolated pollen grains are indicated by arrows. m
Transmission electron microscopy (TEM) picture of crosssectioned pollen grains of wild-type A. thaliana. Bar: 5 lm. n
Enlarged view of inset within picture m of wild-type A. thaliana.
Bar: 2 lm. o TEM picture of cross-sectioned pollen grains of the
mitochondria-targeting coxIV-orf456 T1 plant. Bar: 5 lm. p
Enlarged view of inset within picture o of the mitochondriatargeting coxIV-orf456 T1 plant. Abnormal vacuoles within the
pollen grain were observed and are indicated by arrows.
Bar: 2 lm
several plant species to detect differences in mtDNA
structure between male-fertile and CMS lines, resulting
in the successful identification of CMS-associated
genes (rice, Akagi et al. 1994; rye, Dohmen et al. 1994;
sorghum, Sane et al. 1994; sunflower, Spassova et al.
1994). In the present study, four of the eight mitochondrial genes used as probes resulted in RFLP
polymorphisms. The Northern blot analysis of these
polymorphisms in the male-fertile and CMS lines revealed that only one of these genes (coxII) showed
different banding patterns. Based on these results from
the RFLP and Northern analyses (Fig. 1a, b), we postulated that the flanking region of the coxII gene may
have undergone some degree of alteration to its
structure. To date, more than 50 genes, however, have
been identified in several plant mitochondria (Kubo
et al. 2000; Notsu et al. 2002; Sugiyama et al. 2005;
Unseld et al. 1997). For our RFLP analysis, we used
eight highly likely candidate genes as probes that had
been reported to be associated to CMS in other higher
plants (Table 2); nevertheless, we cannot eliminate the
possibility that other polymorphic bands could be
present since we did not use all of the known mitochondrial genes as probes in this study. In a similar
fashion, it is possible that more transcriptional aber-
rations (CMS-associated or not) could have been detected if the Northern analysis had been carried out
with more gene probes. Therefore, there is a definite
possibility that other CMS-associated factors may be
present in addition to orf456 and atp6.
Northern blot analysis revealed the presence of
multi-banding transcripts, among which coxII in particular showed one polymorphic band. This multibanding pattern of mitochondrial genes has been reported in other higher plants and is considered to
result from various RNA processing events, such as
RNA splicing, multiple 5¢ initiation or 3¢ termination
sites, dicistronic transcription, and polyadenylation in
plant mitochondria (Cooper et al. 1990; Kuhn et al.
2001; Kuhn and Binder 2002; Menassa et al. 1999;
Pruitt and Hanson 1989). To obtain more detailed
information on the coxII multi-banding transcripts, it
will be necessary to investigate the transcript
extremities using the methods like circular RT-PCR,
RACE-PCR, or primer extension, among others. The
results from such studies will help exclude any differences in transcriptional regulation between CMS
and restorer lines.
A novel ORF, orf456, was detected in the 3¢-noncoding region of the mitochondrial coxII in the CMS
123
528
Plant Mol Biol (2007) 63:519–532
Table 2 Mitochondrial genes associated with the CMS phenotype in several higher plants
Mt probes used in this Plant Species
study
References
atpA
Radish
atp6
Sunflower
Brassica napus
Rice
Makaroff et al.
(1990)
Köhler et al. (1991)
Singh et al. (1996)
Iwabuchi et al.
(1993)
Levings III (1990)
Mohr et al. (1993)
atp9
T-Maize
Triticum
timopheevi
T-Maize
Sunflower
Petunia
CoxI
coxII
Sorghum
Teosinte
Petunia
CoxIII
Rice
cob
nad9
Sunflower
Beet
Levings III (1990)
Köhler et al. (1991)
Prutt and Hanson
(1989)
Tang et al. (1996)
Cooper et al. (1990)
Prutt and Hanson
(1989)
Iwabuchi et al.
(1993)
Köhler et al. (1991)
Ducos et al. (2001)
line but not in the male-fertile cytoplasm of the pepper
(C. annuum L.). Transcripts of orf456 were detected in
the CMS and restorer lines that carried the CMSinducing S cytoplasm, but not in the fertile N line
(Fig. 2). There was very little difference in the banding
patterns of the orf456 transcripts between the CMS and
the restorer lines (Fig. 2c), indirectly indicating that
nuclear restoration by the restorer gene (Rf) may be
mediated by regulation at the post-transcriptional or
translational level rather than at the transcriptional
level. Indeed, Western blot analysis did detect a severely reduced level of ORF456 protein band in the
restorer line relative to the CMS line (Fig. 3d), indicating that the expression of orf456 is modulated at the
translational level by the nuclear encoded Rf gene.
When we investigated an RNA editing event between CMS and restorer orf456 cDNA, only one C to
U editing site was detected at +150 nt from the start
codon and this was a silent mutation (ctc fi ctt;
Leu fi Leu) (Fig. 2). We conclude that although an
RNA editing event does occur, it has no consequence
on CMS restoration in chili peppers.
To investigate the biological function of the orf456
gene, we adopted an Arabidopsis transformation
method in which mitochondrion-targeting sequences
(coxIV presequence of the yeast nuclear origin) were
used to localize the orf456 gene product into plant
mitochondria. The coxIV presequence for mitochondria localization has been used previously by the group
123
of M.R. Hanson (Cornell University) to successfully
target proteins (Köhler et al. 1997). While the Hanson
lab used a partial 5¢-region (87 bp), we used a full (162bp) targeting signal sequence (Fig. 4a). The coxIV
presequence (partial or full) is expected to be utilized
for mitochondrial targeted vector construction in plant
biotechnology.
Transgenic experiments with other CMS-associated
sequences, such as the pcf (petunia) and T-urf13 (Tmaize) genes, have been attempted by several
researchers (Chaumont et al. 1995; Wintz et al. 1995).
However, these experiments failed to generate any
male-sterile transgenic plants, probably due to the
improper localization of the CMS-associated protein in
plant cells or the weak promotion of the CaMV35S
promoter in anther tissues. In the present study of the
coxIV-orf456 transformants, approximately 45% of the
Arabidopsis plants showed the male-sterile phenotype
in the T1 generation. This successful transformation of
Arabidopsis with the pepper orf456 gene which resulted in male sterility is an important finding in terms
of research on the CMS mechanism – even though we
did not observe a fully male-sterile phenotype in neither the T1 nor the T2 generation in all of the transgenic populations. This incomplete penetrance may be
the consequence of transgene inactivation.
The precise molecular mechanism of CMS in pepper
has not been resolved to date. On the basis of the
microscopy data, however, we could observe that pollen
maturation might be disturbed and, therefore, incomplete. Two representative male-sterile features were
detected in the CMS pepper line: (1) defects in the exine
layer and (2) vacuolated pollen grains. With respect to
defects in exine layer, the coxIV-orf456 sterile anthers
did not shed any pollen grains and failed to produce any
siliques during the microspore developmental stage
(Fig. 5g, I). Although pollen-like grains were detected
within the coxIV-orf456 anther locules, the pollen grains
themselves had defects on the exine surface, as evidenced by their easy rupturing in a hypertonic solution
(Fig. 7b, e, f). In a recent investigation, Luo et al. (2006)
studied CMS pollen grains by microscopy and reported
features similar to our results. In the CMS line, they
detected several defects in mitochondria within the
tapetum, which plays an important role in providing
nutrition, such as lipids and protein components, to the
developing pollen walls (Piffanelli et al. 1998). These
mitochondrial defects may result in premature cellular
degradation of the tapetum and suppress viable pollen
grain development, particularly in parts of the pollen cell
wall such as the exine layer. The exine layers of the CMS
pollen grains were poorly visible, and the cell walls appeared to be thin when compared to those of the fertile
Plant Mol Biol (2007) 63:519–532
pollen grain. These defects resulted in the cellular
components of the pollen grains being released into the
locular space and the pollen grains collapsing within a
relatively short time (Luo et al. 2006). In the vacuolated
pollen grains, subsequent observations using TEM
showed abnormally vacuolated pollen grains (Fig. 7l, o,
p). In fact, vacuolated pollen grains appear in the middle
stage of the normal developmental process of pollen
grains (Bowman 1993). These results indicate that the
maturation of pollen grains has not been completed, and
that this immaturity could be the cause of male sterility.
In an earlier report, we suggested that the atp6
genes may be one candidate for causing the CMS
condition. Our results indicate that the expression of
the orf456 gene is controlled at the post-transcriptional or translational level. Conversely, atp6 genes
are regulated by the Rf gene at the transcriptional
level (Kim and Kim 2006a). This leaves one major
question: ‘‘Which one of these genes can be considered to be the major CMS-associated gene?’’ Clarification of this question will require further
experimental approaches, such as map-based Rf gene
cloning, and yeast two hybrid screening of ORF456
(in this study) or YATP6-2 (Kim and Kim 2006a) will
help resolve the question. We recently developed a
pepper line with a major Rf gene-linked cleaved
amplified polymorphic sequence (CAPS) marker by
amplified AFLP analysis (Kim et al. 2006) and mapped into SNU2 pepper linkage map (Lee et al. 2004).
The identification of Rf genes in pepper by means of
a map-based cloning strategy will accelerate the
characterization of major and minor CMS genes and
their Rf-CMS interacting mechanism.
In conclusion, the orf456 gene may represent one
candidate from among the CMS-associated mitochondrial genes in chili pepper (Capsicum annuum L.).The
transgenic Arabidopsis line developed here will be
helpful for gaining insights into the molecular mechanisms of CMS in pepper (Capsicum annuum L.).
Experimental procedures
Plant materials
The near-isogenic male fertile (N/rf/rf genotype),
male-sterile (S/rf/rf), and restorer (S/Rf/Rf) lines of
chili pepper (Capsicum annuum) cv. Milyang were
used in this study. These plants were provided by J.H.
Yoo of Hungnong Seed Co. in Korea. Arabidopsis
thaliana ecotype Columbia plants were used for the
transformation experiments.
529
RFLP and Northern blot analyses
The extraction of mtDNA and subsequent membrane
transfer were performed as previously described (Kim
et al. 2005). Total anther RNA was extracted using a
Nucleospin kit (Macherey-Nagel Co, Germany). For
the Northern blot analysis, total RNA samples (20 lg)
from the flowers, leaves, and anther tissues of sterile,
fertile, and restorer lines were fractionated and transferred to a Hybond N+ nylon membrane (Amersham
Pharmacia Biotech, Piscataway, N.J.) by capillary
blotting (Sambrook et al. 1989). The blots were
hybridized with the radioactively labeled orf456 DNA
probe at 60C for 16 h, with a final wash in 0.5· SSC,
0.1% SDS.
Inverse PCR for the flanking and coding sequences
of the coxII gene
Inverse PCR was carried out as previously described
(Kim et al. 2005). The primer sequences (primers a and
b for the 5¢-flanking region; primers c and d for the 3¢flanking region) used in the inverse PCR experiments
are listed in Table 1. A new ORF was identified using
the ORF FINDER program on the NCBI website.
RT-PCR and Northern blot analysis
Total anther RNA (3 lg) was used for first-strand
cDNA synthesis using M-MLV reverse transcriptase
(Invitrogen). The PCR reaction was performed with
specific primer pairs (10 pM) listed in Table 1.
Extraction of mitochondrial proteins
Approximately 500 fertile (N/rf/rf), CMS (S/rf/rf), and
restorer (S/Rf/Rf) pepper seeds were germinated in
two rolls of germination paper in the dark at room
temperature. Seven-day-old etiolated shoots of pepper
were homogenized in five volumes of buffer I [0.3 M
mannitol, 50 mM Tris-HCl, 3 mM EDTA, 1 mM 2mercaptoethanol, 0.1% BSA, 1% PVP-40, 1 tablet per
50 ml of proteinase inhibitor mixture (Roche, Germany); pH adjusted to 7.5 with KOH]. Additional steps
were performed as described by Millar et al. (2001),
with the exception that we used 28% Percoll centrifugation.
Antibody generation and Western blotting
The 456-bp orf456 cDNA (151 amino acids, predicted
molecular weight of 17 kDa) was cloned into the
pTrcHis2-TOPO expression vector (Invitrogen),
123
530
thereby creating a translational fusion with the His tag
epitope (approximately 4 kDa), and introduced into
the Top10 strain of E. coli. For antibody production,
the His tag-fused recombinant protein was purified
from the SDS-PAGE gel. Polyclonal antibodies against
the purified recombinant ORF456 (2.5 mg) were raised
in rabbits (LabFrontier, Seoul, Korea). Fertile and
CMS mitochondrial proteins (30 lg) were separated on
a 12% SDS-PAGE system and transferred to a nitrocellulose membrane. The membrane was blocked with
5% skim milk in buffer solution [10 mM Tris-HCl (pH
7.5), 150 mM NaCl, 0.1% Tween-20] for 1 h at 25C,
followed by incubation first in primary antibody for 1 h
at 25C and then in secondary antibody for 1 h at 25C.
The primary antibody was a rabbit anti-His tag antibody (Invitrogen), which was diluted 1:1000. The secondary antibody was peroxidase-labeled anti-rabbit
antibody (Pierce, Rockford, Ill.), which was diluted
1:10000. The blots were developed in the WEST-ZOL
plus solution (iNtRON Biotechnology, Korea). For
antibody production, the His tag-fused recombinant
protein was purified from the SDS-PAGE gel. Polyclonal antibodies against purified recombinant
ORF456 (2.5 mg) were raised in rabbits (LabFrontier).
Fertile and CMS mitochondrial proteins (30 lg) were
separated on 12% SDS-PAGE gels and transferred to
a nitrocellulose membrane. Western blot analysis using
anti-ORF456 antibodies was performed as described
above.
Transient expression in onions
The egfp sequence was amplified from the pEGFP-1
vector (Clontech). The presequence (54 codons) of
the nuclear coxIV gene of yeast (strain Y187) was
used as the mitochondrial transit peptide sequence.
This was amplified by PCR and used for mitochondria-targeting the ORF456 protein. The amplified
coxIV target sequence and egfp sequence were ligated
using T4 DNA ligase (Promega, Madison, Wis.) and
then cloned into the pCAMBIA2300 vector (MRC,
Cambridge, UK). The fusion constructs in the
pCAMBIA2300 vector were transiently expressed in
onion epidermal cells after transfection. Mitochondrial localization was examined by confocal laser
scanning microscopy using the Radiance 2000 MultiPhoton Imaging System (Bio-Rad, Hercules, Calif.) at
the National Instrumentation Center for Environmental Management (NICEM, Seoul, Korea). The
Mitotracker Red CMXRox dye (Molecular Probes)
was used for the detection of mitochondria in the
onion epidermal cells.
123
Plant Mol Biol (2007) 63:519–532
Expression of orf456 in E. coli and Arabidopsis
The cDNA fragment of orf456 was amplified from the
CMS pepper. The expression of orf456 in E. coli
TOP10 cells was induced by adding 1 mM IPTG. The
plasmids, which contained the coxIV presequence plus
orf456 or egfp, were digested with BamHI and SacI for
cloning into the plant transformation vector pCAMBIA2300. A non-targeting construct, which contained
truncated coxIV plus orf456, was made using the following strategy. Since the non-targeting-coxIV construct contains an XbaI site (+61 bp) within itself,
following ligation to the orf456 gene, the fusion constructs were digested with XbaI. In the case of the nontargeting-orf456 insert, only 16 bp of the coxIV presequence was fused to the 5¢-region of the orf456 inserts. Each insert was confirmed by restriction enzyme
digestion and sequencing. Detailed primer sequences
for transgene constructs are shown in Table 1. The
Agrobacterium tumefaciens-mediated transformation
was performed according to the modified floral-dip
method (Clough and Bent 1998).
Pollen staining and plasmolysis
For the pollen plasmolysis test, the anthers were
pressed open (by gently pressing the cover glass to
release the pollen grains) in 20 ll of hypertonic solution (20% glycerol) on glass slides. After 10 min of
incubation at room temperature, the solution was
covered with a glass coverslip and photographed under
light microscopy.
Light microscopy (LM) and electron microscopy
(SEM and TEM)
For microscopic observation, the anthers were collected from flowers of wild-type and coxIV-orf456
male-sterile transformants. Prepared samples were
observed by LM (Axiophoto; Zeiss, Germany) after
staining with a 0.01% aniline blue solution (Sigma, St.
Louis, Mo.). For SEM, dried samples were mounted on
aluminum stubs with carbon tape and sputter coated
with gold/palladium. The samples were viewed in an
Amray 1000 SEM (JSM-5410LV) with an accelerating
voltage of 5 kV and an emission of 40 M. For TEM,
thin sections (40–50 nm in thickness) were prepared
with an ultramicrotome (MTX, RMC Industries, Tucson, Ariz.). The thin sections were collected on nickel
grids (1-GN, 150 mesh) and stained with 2.5% uranyl
acetate for 20 min. After the grids had been washed
with pure water, the specimen was stained with lead
citrate for 7 min at room temperature. After double-
Plant Mol Biol (2007) 63:519–532
staining, observations were made under a TEM (JEM1-1; JEOL, Tokyo, Japan).
Acknowledgements This research was supported by a grant
from the Center for Plant Molecular Genetics and Breeding
Research (CPMGBR) via the Korea Science and Engineering
Foundation (KOSEF) and the Korea Ministry of Science and
Technology (MOST). Dr. Yoo Jae Hyoung is acknowledged for
the generous gift of plant material and discussions.
References
Abad AR, Mehrtens BJ, Mackenzie SA (1995) Specific expression in reproductive tissues and fate of a mitochondrial
sterility-associated protein in cytoplasmic male sterile bean.
Plant Cell 7:271–285
Akagi H (1995) Genetic diagnosis of cytoplasmic male sterile
cybrid plants of rice. Theor Appl Genet 90:948–951
Akagi H, Sakamoto M, Shinjyo C, Shimada H, Fujimura T
(1994) A unique sequence located downstream from the rice
mitochondrial atp6 may cause male sterility. Curr Genet
25:52–58
Bonhomme S (1992) Sequence and transcript analysis of the
Nco2.5 Ogura-specific fragment correlated with cytoplasmic
male sterility in Brassica cybrids. Mol Gen Genet 235:340–
348
Bowman JL (1993) Arabidopsis: an atlas of morphology and
development. Springer, Berlin Heidelberg New York, pp
277–283
Chaumont F, Bernier B, Buxant R, Williams ME, Levings CS III,
Boutry M (1995) Targeting the maize T-urf13 product into
tobacco mitochondria confers methomyl sensitivity to
mitochondrial respiration. Proc Natl Acad Sci USA
92:1167–1171
Clough SJ, Bent AF (1998) Floral dip: A simplified method for
Agrobacterium-mediated transformation of Arabidopsis
thaliana. Plant J 16:735–743
Cooper P, Butler E, Newton KJ (1990) Identification of a maize
nuclear gene which influences the size and number of cox2
transcripts in mitochondria of perennial teosintes. Genetics
126:461–467,
Dewey RE, Levings CS III, Timothy DH (1986) Novel recombinations in the maize mitochondrial genome produce a
unique transcriptional unit in the Texas male-sterile cytoplasm. Cell 44:439–449
Dohmen G, Hessberg H, Geiger HH, Tudzynski P (1994) CMS
in rye: comparative RFLP and transcript analyses of
mitochondria from fertile and male-sterile plants. Theor
Appl Genet 89:1014–1018
Ducos E, Touzet P, Boutry M (2001) The male sterile G
cytoplasm of wild beet displays modified mitochondrial
respiratory complexes. Plant J 26:171–180
Grelon M, Budar F, Bonhomme S, Pelletier G (1994) Ogura
cytoplasmic male-sterility (CMS)-associated orf138 is translated into a mitochondrial membrane polypeptide in malesterile Brassica cybrids. Mol Gen Genet 243:540–547
Hanson MR (1991) Plant mitochondrial mutations and male
sterility. Annu Rev Genet 25:461–486
Hanson M, Bentolila S (2004) Interactions of mitochondrial and
nuclear genes that affect male gametophyte development.
Plant Cell 16:S154-S169
He S, Abad AR, Gelvin SB, Mackenzie SA (1996) A cytoplasmic
male sterility-associated mitochondrial protein causes pollen
531
disruption in transgenic tobacco. Proc Natl Acad Sci USA
93:11763–11768
Iwabuchi M, Kyozuka J, Shimamoto K (1993) Processing
followed by complete editing of an altered mitochondrial
atp6 RNA restores fertility of cytoplasmic male sterile rice.
EMBO J 12:1437–1446
Johns C, Lu M, Lyznik A, Mackenzie S (1992) A mitochondrial
DNA sequence is associated with abnormal pollen development in cytoplasmic male sterile bean plants. Plant Cell
4:435–449
Kanzaki H, Takeda M, Kameya T (1991) Sequence analysis of a
mitochondrial DNA fragment isolated from cultured cells of
carrot cytoplasmic male-sterile strain. Jpn J Genet 66:719–724
Kim DH, Kim BD (2005) Development of SCAR markers for
early identification of cytoplasmic male sterility genotype in
chili pepper (Capsicum annuum L.). Mol Cells 20:416–422
Kim DH, Kim BD (2006a) The organization of mitochondrial
atp6 gene region in male fertile and CMS lines of pepper
(Capsicum annuum L.). Curr Genet 49:59–67
Kim DH, Kang JG, Kim SJ, Kim BD (2001) Identification of
cox2 and atp6 regions as associated to CMS in Capsicum
annuum by using RFLP and long accurate PCR. J Kor Soc
Hortic Sci 42:121–127
Kim DS, Kim DH, Yoo JH, Kim BD (2006) Cleaved amplified
polymorphic sequence and amplified fragment length polymorphism markers linked to the fertility restorer gene in
chili pepper (Capsicum annuum L). Mol Cells 21:135–140
Köhler RH, Horn R, Loss A, Zetsche K (1991) Cytoplasmic
male sterility in sunflower is correlated with the cotranscription of a new open reading frame with the atpA
gene. Mol Gen Genet 227:369–376
Köhler RH, Zipfel WR, Webb WW, Hanson MR (1997) The
green fluorescent protein as a marker to visualize plant
mitochondria in vivo. Plant J 11:613–621
Kubo T, Nishizawa S, Sugawara, Itchoda N, Estiati A, Mikami T
(2000) The complete nucleotide sequence of the mitochondrial genome of sugar beet (Beta vulgaris L.) reveals a novel
gene for tRNACys(GCA). Nucleic Acids Res 28:2571–2576
Kuhn J, Tengler U, Binder S (2001) Transcript lifetime is
balanced between stabilizing stem loop structures and
degradation promoting polyadenylation in plant mitochondria. Mol Cell Biol 21:731–742
Kuhn J, Binder S (2002) RT-PCR analysis of 5¢ to 3¢ end
identifies mRNAs identifies the extremities of cox2 transcripts in pea mitochondria. Nucleic Acids Res 30:439–446
Lee JM, Nahm SH, Kim YM, Kim BD (2004) Characterization
and molecular genetic mapping of microsatellite loci in
pepper. Theor Appl Genet 108:619–627
Levings III CS (1990) The Texas cytoplasm of maize: cytoplasmic male sterility and disease susceptibility. Science
250:942–947
Luo XD, Dai LF, Wang SB, Wolukau JN, Jahn M, Chen JF
(2006) Male gamete development and early tapetal degeneration in cytoplasmic male-sterile pepper investigated by
meiotic, anatomical and ultrastructural analyses. Plant
Breed 125:395–399
Makaroff CA, Apel IJ, Palmer JD (1990) Characterization of
radish mitochondrial atpA-associated sequences and relationship with male sterility. Plant Mol Biol 15:735–746
Menassa R, L’Homme Y, Brown GG (1999) Post-transcriptional
and developmental regulation of a CMS-associated mitochondrial gene region by a nuclear restorer gene. Plant J
17:491–499
Millar AH, Sweetlove LJ, Giege P, Leaver CJ (2001) Analysis of
the Arabidopsis Mitochondrial Proteome. Plant Physiol
127:1711–1727
123
532
Mohr S, Schulte-Kappert E, Odenbach W, Oettler G, Kück U
(1993) Mitochondrial DNA of cytoplasmic male-sterile
Triticum timopheevi: rearrangement of upstream sequences
of the atp6 and orf25 genes. Theor Appl Genet 86:259–268
Moneger R, Smart CJ, Leaver CJ (1994) Nuclear restoration of
cytoplasmic male sterility in sunflower is associated with the
tissue-specific regulation of a novel mitochondrial gene.
EMBO J 13:8–17
Notsu Y, Masood S, Nishikawa T, Kubo N, Akiduki G,
Nakazono M, Hirai A, Kadowaki K (2002) The complete
sequence of the rice (Oryza sativa L.) mitochondrial
genome: frequent DNA sequence acquisition and loss
during the evolution of flowering plants. Mol Genet
Genomics 268:434–445
Novak F, Betiacb J, Dubovsky J (1971) Cytoplasmic male
sterility in sweet pepper (Capsicum annuum L.). Biol Plant
12:275–280
Peterson PA (1958) Cytoplasmically inherited male sterility in
Capsicum. Am Nat 92:111–119
Piffanelli P, Ross HE, Murphy DJ (1998) Biogenesis and
function of the lipidic structures of pollen grains. Sex Plant
Reprod 11:65–80
Prutt KD, Hanson MR (1989) Cytochrome oxydase subunit II
sequences in petunia mitochondria: two intron-containing
genes and an intron-less pseudogene associated with cytoplasmic male sterility. Curr Genet 16:281–291
Sane AP, Nath P, Sane PV (1994) Mitochondrial ATP synthase
genes may be implicated in cytoplasmic male sterility in
sorghum bicolor. J Biosci 19:43–55
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: A
laboratory manual, 2nd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor
Schnable PS, Wise RP (1998) The molecular basis of cytoplasmic
male sterility and fertility restoration. Trends Plant Sci
3:175–180
123
Plant Mol Biol (2007) 63:519–532
Singh M, Hamel N, Menassa R, Li XQ, Young B, Jean M,
Landry BS, Brown GG (1996) Nuclear genes associated
with a single Brassica CMS restorer locus influence transcripts of three different mitochondrial gene regions.
Genetics 143:505–516
Spassova M, Moneger F, Leaver CJ, Petrov P, Atanassov A,
Nijkamp HJ, Hille J (1994) Characterization and expression
of the mitochondrial genome of a new type of cytoplasmic
male-sterile sunflower. Plant Mol Biol 26:1819–1831
Sugiyama Y, Watase Y, Nagase M, Makita N, Yagura S, Hirai A,
Sugiura M (2005) The complete nucleotide sequence and
multipartite organization of the tobacco mitochondrial
genome: comparative analysis of mitochondrial genomes in
higher plants. Mol Gen Genomics 272:603–615
Tang HV, Pring DR, Shaw LC, Salazar RA, Muza FR, Yan B,
Schertz KF (1996) Transcript processing internal to a
mitochondrial open reading frame is correlated with fertility
restoration in male-sterile Sorghum. Plant J 10:123–133
Unseld M, Marienfeld JR, Brandt P, Brennicke A (1997) The
mitochondrial genome of Arabidopsis thaliana contains 57
genes in 366,924 nucleotides. Nat Genet 15:57–61
Wang LH, Zhang BX, Lefebvre V, Huang SW, Daubèze AM,
Palloix A (2004) QTL analysis of fertility restoration in
cytoplasmic male sterile pepper. Theor Appl Genet
109:1058–1063
Wintz H, Chen HC, Sutton CA, Conley CA, Cobb A, Ruth D,
Hanson MR (1995) Expression of the CMS-associated urfS
sequence in transgenic petunia and tobacco. Plant Mol Biol
28:83–92
Young EG, Hanson MR (1987) A fused mitochondrial gene
associated with cytoplasmic male sterility is developmentally regulated. Cell 50:41–49