research communications
ISSN 2053-230X
Purification, crystallization and characterization of
the Pseudomonas outer membrane protein FapF, a
functional amyloid transporter
Sarah L. Rouse,a Wlliam J. Hawthorne,a Sebastian Lambert,b Marc L. Morgan,a
Stephen A. Harea and Stephen Matthewsa*
Received 15 September 2016
Accepted 8 November 2016
a
Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, England, and bBiological Sciences,
National University of Singapore, 14 Science Drive 4, Singapore 117543, Singapore. *Correspondence e-mail:
[email protected]
Edited by G. G. Privé, University of Toronto,
Canada
Keywords: amyloid transporter; bacterial outer
membrane; FapF; Pseudomonas; C8E4.
Bacteria often produce extracellular amyloid fibres via a multi-component
secretion system. Aggregation-prone, unstructured subunits cross the periplasm
and are secreted through the outer membrane, after which they self-assemble.
Here, significant progress is presented towards solving the high-resolution
crystal structure of the novel amyloid transporter FapF from Pseudomonas,
which facilitates the secretion of the amyloid-forming polypeptide FapC across
the bacterial outer membrane. This represents the first step towards obtaining
structural insight into the products of the Pseudomonas fap operon. Initial
attempts at crystallizing full-length and N-terminally truncated constructs by
refolding techniques were not successful; however, after preparing FapF106–430
from the membrane fraction, reproducible crystals were obtained using the
sitting-drop method of vapour diffusion. Diffraction data have been processed
to 2.5 Å resolution. These crystals belonged to the monoclinic space group C121,
with unit-cell parameters a = 143.4, b = 124.6, c = 80.4 Å, = = 90, = 96.32
and three monomers in the asymmetric unit. It was found that the switch to
complete detergent exchange into C8E4 was crucial for forming well diffracting
crystals, and it is suggested that this combined with limited proteolysis is a
potentially useful protocol for membrane -barrel protein crystallography. The
three-dimensional structure of FapF will provide invaluable information on the
mechanistic differences of biogenesis between the curli and Fap functional
amyloid systems.
1. Introduction
Amyloids, fibrillar proteinaceous aggregates with a cross-strand structure, are commonly associated with human
disease states such as Alzheimer’s and Parkinson’s. However,
certain bacteria have evolved to exploit such fibres to their
advantage by secreting monomeric subunits in a highly
controlled manner and allowing their self-assembly as part of a
biofilm matrix. This matrix assists them in attachment to their
host (animal or surface), persistence in infection and antibiotic
resistance. Understanding the molecular basis for controlled
amyloid formation is of great interest, not only for new strategies to counter bacterial infection, but also to inspire the
design of therapeutic approaches to pathogenic amyloidogenesis in humans. The model systems that have been best
characterized to date are curli from Escherichia coli and
892
http://dx.doi.org/10.1107/S2053230X16017921
Acta Cryst. (2016). F72, 892–896
research communications
functional amyloid protein from Pseudomonas (Fap). These
two systems form morphologically similar fibres despite being
genetically distinct (Dueholm et al., 2010).
The curli system has been extensively studied, with structures available for all but one of the encoded proteins [CsgA
(Tian et al., 2015), CsgC (Taylor et al., 2011), CsgE (Shu et al.,
2016) and CsgG (Cao et al., 2014; Goyal et al., 2013, 2014)]. In
contrast, no structural information exists for the more recently
discovered Fap system. Both of these systems require the
polypeptide amyloid subunit to be transported across the
complex bacterial outer membrane (OM). In curli, the
membrane component CsgG was found to be a nonameric
-barrel in which each monomer contributes four -strands
to a central 36-residue OM channel. The integral membrane
component from the fap operon, FapF, is similarly predicted
to be a -barrel membrane protein; however, bioinformatics
analyses suggest that its structure is likely to be more akin to
the fatty-acid transporter -barrels [e.g. FadL (van den Berg et
al., 2004) and TodX (Hearn et al., 2008)]. This suggests that the
two membrane components are distinct, raising the intriguing
prospect that the mechanism of amyloid secretion is
completely independent. Structural predictions using
PSIPRED (Bryson et al., 2005) indicate that FapF comprises
an 30-residue helical region at the N-terminus, followed by
an 60-residue disordered region and then an integral
membrane -barrel component.
We set out to solve the structure of the FapF outer
membrane protein. As our initial efforts to crystallize fulllength FapF proved challenging, N-terminally truncated
constructs were designed based on molecular-weight information from limited proteolysis (Fig. 1). These were expressed
and purified from the outer membrane fraction of E. coli and
used for crystallization trials. A complete detergent exchange
into tetraethylene glycol monooctyl ether (C8E4) during
chromatographic purification was essential for forming well
diffracting crystals and suggests that this could be a useful step
worth considering for membrane -barrel proteins that remain
challenging to work with (Carpenter et al., 2008). Reproducible crystals that diffract to 2.4 Å resolution were grown
for a construct comprising residues 106–430 of FapF, which
represents a major step towards providing the first structural
insight into the Fap machinery.
Figure 1
(a) Limited proteolysis of FapF. SDS–PAGE gel showing samples of FapF digested over a range of time periods with trypsin and chymotrypsin, with
samples taken periodically over the course of 180 min as indicated (labelled in minutes). The protein is processed to produce stable fragments of
approximately 35 or 31 kDa (indicated with arrows). Lane MW contains molecular-weight marker (labelled in kDa). (b) Purification of FapF. Superdex
200 (GE Healthcare) gel-filtration profile of FapF106–430 in 0.5% C8E4. The main peak at 65 ml corresponds to FapF106–430. Inset, SDS–PAGE of fractions
from the FapF106–430 nickel purification: M, marker; F, flowthrough; W1, first wash; W2, second wash; E, elution peaks 1 and 2.
Acta Cryst. (2016). F72, 892–896
Rouse et al.
Pseudomonas outer membrane protein FapF
893
research communications
Table 1
Macromolecule-production information.
Source organism
DNA source
Forward primer
Reverse primer
Cloning vector
Expression vector
Expression host
Complete amino-acid sequence
of the construct produced
Full-length FapF
Truncated FapF
Pseudomonas PAO1
Pseudomonas PAO1 gDNA
Pseudomonas UK4
pMMB190Ap:UK4fapA-F
TACTTCCAATCCATGGCGACGGAATCCGAG
TATCCACCTTTACTGTCAGAAGTAGTAGGGGAATTT
GGCCGGTACCAAGGATGATTCGGAGCCGGC
CCGGAAGCTTTTAGAAGTAGTACGGGAATTTCAGGC
pNIC-NTH
pNIC-NTH
E. coli BL21(DE3)
pRSF-1b
pRSF-1b
E. coli Lemo21
MHHHHHHHSSGVDLGTENLYFQSMATESEVEALKKELLELRQRYEAQQNALMVLEQRVRQVEAQPQAPQPQRLVKSIQPPAQARNDANAVAGTYGASLKDDGAPAPSVENIYQDASGFFGGGTFSLETGLTYSHYDTRQLFLNGFLALDSIFLGNIGVDQIDADIWTLDLTGRYNWNQRWQVDINAPVVYRESTYQSAGAGGSTSQITEKSVTGDPRLGDVSFGVAYKFLDESESTPDAVVSLRVKAPTGKDPYGIKLKQVPGNNNLNVPDDLPTGNGVWSITPGISLVKTVDPAVLFGSLSYTYNFEESFDDINPQQGVKTGGKVKLGNWFQLGVGVAFALNEKMSMSFSFSELISQKSKVKQDGQSWQTVSGSDANAGYFGLGMTYAVSNRFSIVPSLSIGITPDAPDFTFGVKFPYYF
MKKTAIAIAVALAGFATVAQATSHHHHHHGTKDDSEPAQSVSNLYNEASGFFGNGKFSFETGITYARYDARQLTLNGFLALDSIFLGNINLDRIKADNWTLDLTGRYNLDNRWQFDVNVPVVYRESTYQSGGASGGDPQATSEESVSRDPTIGDVNFGIAYKFLDESATMPDAVVSVRVKAPTGKEPFGIKLVRSTANDNLYVPESLPTGNGVWSITPGLSLVKTFDPAVLFGSVSYTHNLEDSFDDISSDVNQKVGGKVRLGDSFQFGVGVAFALNERMSMSFSVSDLIQRKSKLKPDGGGWQSIVSSDANAGYFNVGMTIAASENLTIVPNLAIGMTDDAPDFTFSLKFPYYF
Table 2
Crystallization.
Method
Plate type
Temperature (K)
Protein concentration (mg ml1)
Buffer composition of protein
solution
Composition of reservoir solution
Volume and ratio of drop
Volume of reservoir (ml)
Sitting-drop vapour diffusion
24-well cell-culture plate
293
10
20 mM Tris–HCl pH 8, 150 mM NaCl,
0.5% C8E4
100 mM sodium citrate, 20–30%(w/v)
PEG 400, 100 mM NaCl
800 nl, 1:1
80
200 mM NaCl, 0.1% LDAO, 0.5% C8E4 (Generon), 20 mM
imidazole, washed again with 30 ml 20 mM Tris–HCl pH 8.0,
200 mM NaCl, 0.5% C8E4 (Generon), 20 mM imidazole and
eluted with 20 mM Tris–HCl pH 8.0, 200 mM NaCl, 0.5%
C8E4 (Generon), 500 mM imidazole. The eluted fractions
were gel-filtrated into 20 mM Tris–HCl pH 8.0, 150 mM NaCl,
0.5% C8E4 using a Superdex 200 column (GE Healthcare)
and the fractions corresponding to the main elution peak at
65 ml were collected and concentrated to 10 mg ml1. See
Table 1 for macromolecule-production information.
2. Materials and methods
2.2. Crystallization
2.1. Macromolecular production
Conditions for crystallization of FapF106–430 were initially
screened by the sitting-drop vapour-diffusion method at 20 C
using sparse-matrix crystallization kits from Hampton
Research and Molecular Dimensions in MRC 96-well optimization plates (Molecular Dimensions), with 100 nl protein
solution and 100 nl reservoir solution, using a Mosquito
nanolitre high-throughput robot (TTP Labtech). Protein
crystals were obtained in a reproducible manner from 100 mM
sodium citrate, 20–30%(w/v) PEG 400, 100 mM NaCl. These
were manually optimized, screening over sodium citrate in the
pH range 5.5–6.5 in one dimension and an NaCl concentration
gradient of 50–100 mM in the second dimension using MRC
96-well plates with up to 400 nl protein solution and 400 nl
reservoir solution. See Table 2 for crystallization information.
Full-length FapF from Pseudomonas strain PAO1 was
expressed as insoluble inclusion bodies and refolded from
urea via dialysis into 20 mM Tris–HCl pH 8, 200 mM NaCl,
1% LDAO (Sigma). Based on the limited proteolysis of fulllength FapF (Fig. 1), an N-terminally truncated FapF (residues
106–430; FapF106–430) from Pseudomonas strain UK4 was
cloned into a pRSF-1b vector with an OmpA leader signal
sequence and an N-terminal His tag.
Constructs were transformed into either E. coli BL21(DE3)
or Lemo21 cells (New England Biolabs) and grown to an
OD600 of 0.6–0.8 at 37 C in autoinducing TB medium before
overnight induction at 25 C. Cells were harvested and resuspended in 20 mM Tris–HCl pH 8, 1 mg ml1 DNaseI and
PMSF, followed by lysis by cell disruption (Constant Systems)
at 172 MPa pressure and centrifugation at 14 000 rev min1
for 20 min (45 Ti rotor, Beckman). The outer membrane
fraction was prepared by centrifugation of the supernatant at
100 000g for 2 h (45 Ti rotor; Beckman) followed by resuspension of the pellet in 20 mM Tris–HCl pH 8, 0.5% sarcosine
(Thermo Fisher), stirring at room temperature for 30 min, a
second spin at 100 000g for 1.5–2 h and resuspension of the
pellet for overnight extraction at 4 C with 20 mM Tris–HCl
pH 8, 200 mM NaCl, 1% N,N-dimethyldodecylamine N-oxide
(LDAO; Sigma). FapF106–430 was then purified from the outer
membrane fraction by nickel-affinity chromatography. The
column was washed with 30 ml 20 mM Tris–HCl pH 8.0,
894
Rouse et al.
Pseudomonas outer membrane protein FapF
2.3. Data collection and processing
Crystals were mounted in a MicroLoop (MiTeGen) and
immediately flash-cooled in liquid nitrogen. Diffraction data
from a single native crystal were collected on beamline I03 of
the Diamond Light Source (DLS), England. The data were
processed with XDS (Kabsch, 2010) and scaled using SCALA
(Evans, 2006) within the xia2 package (Winter et al., 2013).
Data-collection statistics are shown in Table 3. The content
of the unit cell was analyzed using the Matthews coefficient
(Matthews, 1968). Molecular-replacement (MR) attempts
were carried out using complete structures and polyalanine
models with and without loop truncations of available -barrel
Acta Cryst. (2016). F72, 892–896
research communications
crystal structures in the Protein Data Bank (http://
www.rscb.org) as well as using idealized models of 8–16stranded -barrels using C traces of various tilt angles
generated using in-house scripts. MR attempts were
performed using MOLREP (Vagin & Teplyakov, 2010) and
Phaser (McCoy et al., 2007). High-resolution data were used
between 2.5 and 6 Å.
3. Results and discussion
To date, no structural information is available for any of the
components of the fap operon. Refolding attempts using fulllength and N-terminally truncated FapF yielded microcrystals
that could not be further optimized for crystallography despite
Table 3
Data collection and processing.
Values in parentheses are for the outer shell.
Diffraction source
Wavelength (Å)
Temperature (K)
Detector
Crystal-to-detector distance (mm)
Rotation range per image ( )
Total rotation range ( )
Exposure time per image (s)
Space group
a, b, c (Å)
, , ( )
Resolution range (Å)
Total No. of reflections
No. of unique reflections
Completeness (%)
Multiplicity
hI/(I)i
Rmerge†
Overall B factor from Wilson plot (Å2)
I04, DLS
0.97980
100
PILATUS 6M
496.43 (from the image header)
0.2
180
0.1
C121
143.39, 124.56, 80.37
90.00, 96.32, 90.00
50.49–2.36 (2.42–2.36)
192836 (12153)
57290 (4212)
99.4 (95.3–99.0)
3.4 (2.9)
9.4 (1.2)
0.077 (0.492)
44.86
P P
P P
† Rmerge =
hkl
i jIi ðhklÞ hIðhklÞij=
hkl
i Ii ðhklÞ, where hI(hkl)i is the mean
intensity of the observations Ii(hkl) of reflection hkl.
Figure 2
Representative native crystals of FapF106–430. Crystals formed over 5–7 d
in the reservoir condition 100 mM sodium citrate, 20–30%(w/v) PEG 400,
100 mM NaCl. Purified FapF106–430 in 20 mM Tris–HCl pH 8.0, 150 mM
NaCl, 0.5% C8E4 was concentrated to 10 mg ml1. Scale bar 500 mm.
exhaustive attempts. We therefore isolated and purified the
FapF106–430 construct from the physiologically relevant
environment of the outer membrane (Fig. 1) and subsequently
obtained suitably sized crystals (Fig. 2).
After the screening of various detergents for both extraction efficiency and appearance in gel-filtration profiles, we
found that the crucial step in obtaining reproducible crystals
was to reduce the concentration of LDAO in buffers to zero
during nickel purification and gradually replace it with C8E4.
Mixtures of LDAO and C8E4 have proven to be successful in
several recent membrane-protein crystallography studies (see,
Figure 3
Diffraction images from a FapF106–430 crystal. (a) Representative diffraction image indicating resolution rings. (b) Enlarged image indicating the final
data-processing resolution limit at 2.5 Å. Images were generated in iMosflm (Battye et al., 2011).
Acta Cryst. (2016). F72, 892–896
Rouse et al.
Pseudomonas outer membrane protein FapF
895
research communications
for example, Goyal et al., 2014; van den Berg et al., 2015).
Under these purification conditions crystals grew readily to up
to 200 mm3 over the course of 5–7 d.
Diffraction data were collected to 2.36 Å resolution (Fig. 3)
and indexed in space group C121. Data were finally scaled at
2.5 Å resolution. Analysis of the crystal content indicated that
there are three to five molecules in the asymmetric unit, with
a Matthews coefficient in the range 3.5–2.1 Å3 Da1 and a
corresponding solvent content in the range 65–41%; however,
self-rotation analysis indicated threefold symmetry. This,
combined with the fact that membrane-protein crystals tend to
have a higher solvent content than their soluble counterparts
owing to the presence of detergent species, leads us to believe
that it is almost certainly a trimer that is present with 65%
solvent content. SFCHECK (Vaguine et al., 1999) suggests that
twinning is not present (hE 4i/hI 2i = 2.35). Data-collection and
processing statistics are listed in Table 3.
Molecular-replacement attempts were made using idealized
model barrels and 12-stranded and 14-stranded -barrel
structures as search models: TodX (PDB entry 3bs0; Hearn et
al., 2008), FadL (PDB entry 1t16; van den Berg et al., 2004),
NanC (PDB entry 2wir; Wirth et al., 2009), TolC (PDB entry
1ek9; Koronakis et al., 2000), NalP (PDB entry 1uyn; Oomen et
al., 2004) and COG4313 (PDB entry 4rl8; van den Berg et al.,
2015). No solutions were found, which was not unexpected as
the sequence identities between FapF and all template models
available were below 20%. We are currently preparing selenomethionine-substituted and heavy-atom derivatives in order
to obtain accurate phases using anomalous dispersion techniques.
Our work involving the extensive optimization of extraction
and purification protocols demonstrated that a reduction in
LDAO during the early nickel-affinity purification steps was
essential to obtain well diffracting crystals. It appears that gel
filtration into C8E4 alone is not sufficient to remove the
comparatively ‘sticky’ detergent LDAO (Newstead et al.,
2008). Presumably, the zwitterionic nature of LDAO is more
disruptive to protein packing interactions within crystals than
the milder, uncharged C8E4 (le Maire et al., 2000). LDAO and
C8E4 make up the majority of detergents used for outer
membrane protein crystal structures. We suggest that extraction by LDAO, followed by buffer exchange into C8E4 as the
sole detergent for downstream crystallization, is a worthwhile
combination together with limited proteolysis when considering -barrel membrane-protein preparations for crystal
trials.
Acknowledgements
This work was supported by a Wellcome Trust Investigator
award to SJM (WT100280MA). SAH is supported by a
Medical Research Council Career Development Award
896
Rouse et al.
Pseudomonas outer membrane protein FapF
(G1100332). We are grateful to the staff at Diamond Light
Source beamline I03 for their help with data collection.
References
Battye, T. G. G., Kontogiannis, L., Johnson, O., Powell, H. R. & Leslie,
A. G. W. (2011). Acta Cryst. D67, 271–281.
Berg, B. van den, Bhamidimarri, S. P. & Winterhalter, M. (2015). Sci.
Rep. 5, 11927.
Berg, B. van den, Black, P. N., Clemons, W. M. Jr & Rapoport, T. A.
(2004). Science, 304, 1506–1509.
Bryson, K., McGuffin, L. J., Marsden, R. L., Ward, J. J., Sodhi, J. S. &
Jones, D. T. (2005). Nucleic Acids Res. 33, W36–W38.
Cao, B., Zhao, Y., Kou, Y., Ni, D., Zhang, X. C. & Huang, Y. (2014).
Proc. Natl Acad. Sci. USA, 111, E5439–E5444.
Carpenter, E. P., Beis, K., Cameron, A. D. & Iwata, S. (2008). Curr.
Opin. Struct. Biol. 18, 581–586.
Dueholm, M. S., Petersen, S. V., Sonderkaer, M., Larsen, P.,
Christiansen, G., Hein, K. L., Enghild, J. J., Nielsen, J. L., Nielsen,
K. L., Nielsen, P. H. & Otzen, D. E. (2010). Mol. Microbiol. 77,
1009–1020.
Evans, P. (2006). Acta Cryst. D62, 72–82.
Goyal, P., Krasteva, P. V., Van Gerven, N., Gubellini, F., Van den
Broeck, I., Troupiotis-Tsaı̈laki, A., Jonckheere, W., PéhauArnaudet, G., Pinkner, J. S., Chapman, M. R., Hultgren, S. J.,
Howorka, S., Fronzes, R. & Remaut, H. (2014). Nature (London),
516, 250–253.
Goyal, P., Van Gerven, N., Jonckheere, W. & Remaut, H. (2013). Acta
Cryst. F69, 1349–1353.
Hearn, E. M., Patel, D. R. & van den Berg, B. (2008). Proc. Natl Acad.
Sci. USA, 105, 8601–8606.
Kabsch, W. (2010). Acta Cryst. D66, 125–132.
Koronakis, V., Sharff, A., Koronakis, E., Luisi, B. & Hughes, C. (2000).
Nature (London), 405, 914–919.
Maire, M. le, Champeil, P. & Møller, J. V. (2000). Biochim. Biophys.
Acta, 1508, 86–111.
Matthews, B. W. (1968). J. Mol. Biol. 33, 491–497.
McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D.,
Storoni, L. C. & Read, R. J. (2007). J. Appl. Cryst. 40, 658–674.
Newstead, S., Hobbs, J., Jordan, D., Carpenter, E. P. & Iwata, S.
(2008). Mol. Membr. Biol. 25, 631–638.
Oomen, C. J., van Ulsen, P., Van Gelder, P., Feijen, M., Tommassen, J.
& Gros, P. (2004). EMBO J. 23, 1257–1266.
Shu, Q., Krezel, A. M., Cusumano, Z. T., Pinkner, J. S., Klein, R.,
Hultgren, S. J. & Frieden, C. (2016). Proc. Natl Acad. Sci. USA, 113,
7130–7135.
Taylor, J. D., Zhou, Y., Salgado, P. S., Patwardhan, A., McGuffie, M.,
Pape, T., Grabe, G., Ashman, E., Constable, S. C., Simpson, P. J.,
Lee, W.-C., Cota, E., Chapman, M. R. & Matthews, S. J. (2011).
Structure, 19, 1307–1316.
Tian, P., Boomsma, W., Wang, Y., Otzen, D. E., Jensen, M. H. &
Lindorff-Larsen, K. (2015). J. Am. Chem. Soc. 137, 22–25.
Vagin, A. & Teplyakov, A. (2010). Acta Cryst. D66, 22–25.
Vaguine, A. A., Richelle, J. & Wodak, S. J. (1999). Acta Cryst. D55,
191–205.
Winter, G., Lobley, C. M. C. & Prince, S. M. (2013). Acta Cryst. D69,
1260–1273.
Wirth, C., Condemine, G., Boiteux, C., Bernèche, S., Schirmer, T. &
Peneff, C. M. (2009). J. Mol. Biol. 394, 718–731.
Acta Cryst. (2016). F72, 892–896