Supporting Information Figs S1–S10 & Table S1 W D307 D207 D321 2D Stress: 0.41 D02-061 D02-089 2D Stress: 2D Stress: 0.41 Mef selected Mef 2012 20110.41 D02-062 D02-090 D80 D227 D80 D02-063 D227 D02-091 D260 D139 D83 D258 D83 D258 D83 D311 D02-064 D02-092 D110 D93 D260 D93 D260 D214 D227 D02-065 D02-093 D94 D263 D94 D263 D125 D167 D125 D307 D110D02-066 D277 D02-094 D161 D139 D311 D125D02-067 D283 D02-095 D263 D220 D161 D321 D139 D307 K D02-071 D02-096 D167 D334 D161 D311 D338 D80 D283 D207 D338 D02-098 D167D02-072 D321 D94 D214 W D207D02-075 D334 D02-099 D222 D220 K D214 D338 D258 D02-076 D02-100 D334 D222 D220 W D93 D02-101 D222D02-078 K D02-079 D02-102 D02-080 D02-103 D02-082 D02-104 Fig. S1 The non-metric multi-dimensional scaling of 24 double haploid (DH) lines (colored in grey) in the D02-083 D02-105 background of 225 DH lines (colored in blue) of wheat Triticum aestivum varieties, Westonia and Kauz, D02-084 D02-106 based on 195 simple sequence repeat (SSR) markers and two Rht1-B1 and Rht2-D1 gene markers (2011). Points that are close together represent samples that are genetically similar, while points that are far apart D02-087 D02-107 are genetically divergent. In 2012, 21 DH lines were repeated. *W, Westonia; ᴼK, Kauz. D02-088 D02-108 D277 D02-110 D02-111 D02-112 D02-114 D02-115 D02-117 D02-119 D02-121 D02-124 D04-125 D04-126 D04-127 D04-128 D04-129 D04-130 D04-132 D04-133 D04-134 D04-135 2011 2012 15 Irrigated Drought a 10 Volumetric soil water content (v/v %) a 5 Irrigated Drought 10 cm depth a b 10 cm depth a a a b b b b b 0 30 cm depth 30 cm depth 50 cm depth 50 cm depth a b 10 5 0 10 5 0 -10 0 10 20 30 Days after anthesis 40 50 -10 0 10 20 30 40 50 Days after anthesis Fig. S2 Volumetric soil water content (v/v, %) at 10, 30 and 50 cm depth, respectively, in drought experiments at Merredin field station in 2011 and 2012. The average of the days after anthesis of all lines is presented. Closed circles, irrigated conditions; open circles, drought conditions. The vertical bars represent SE. Values with the same letter are statistically not different at P = 0.05. 2012 KN per main spike TGW in main spike (g) GW in main spike (g) 2011 2 a a b b 1 40 30 20 10 60 a b a b 40 20 0 Irrigated Drought Irrigated Drought Fig. S3 The average reduction in core phenotypes. Grain weight per main spike (GW), thousand grain weight (TGW) and seed number per main spike (KN) are shown in pooled selected double haploid (DH) lines and their parental lines (wheat Triticum aestivum varieties, Westonia and Kauz) under irrigated (closed bars) and drought (open bars) conditions at Merredin field station in 2011 and 2012. The vertical bars represent SE. Values with the different letter are significantly different at P = 0.05. Rafinose 1-Kestose Maltose 6-Kestose Neo-Kestose Nystose Bifurcose Glucose Fructose Sucrose ref ref 1-KD1 1-KD2 1-KD3 1-KI1 5-KD1 5-KD2 5-KD3 5-KI1 5-KI2 5-KI3 ref 1-KI2 1-KI3 ref 5.00 10.00 15.00 20.00 5.00 25.00 10.00 15.00 20.00 25.00 ref ref 6-KD1 6-KD2 6-KD3 6-KI1 6-KI2 6-KI3 ref 2-KD1 2-KD2 2-KD3 2-KI1 2-KI2 2-KI3 ref 5.00 10.00 15.00 20.00 5.00 25.00 10.00 15.00 20.00 25.00 ref ref 7-KD1 7-KD2 3-KD1 3-KD2 3-KD3 3-KI1 3-KI2 3-KI3 ref 5.00 10.00 15.00 20.00 25.00 7-KD3 7-KI1 7-KI2 7-KI3 ref 5.00 10.00 15.00 20.00 25.00 ref 4-KD1 4-KD2 4-KD3 4-KI1 4-KI2 4-KI3 ref 5.00 10.00 15.00 20.00 25.00 Fig. S4 The accumulation and degradation of stem WSC components in wheat Triticum aestivum variety, Kauz under drought and irrigated conditions from -4-41 d post anthesis (DPA). KD1-3, Kauz in three replicates under drought; KI1-3,Kauz in three replicates under well-watered conditions. 1, -4 DPA; 2, 3 DPA; 3, 11 DPA; 4, 17 DPA; 5, 25 DPA; 6, 31 DPA; 7, 41 DPA. (a) 10.0 Westonia Sucrose concentration (% DW) 7.5 5.0 2.5 Irrigated Drought 0.0 Kauz 7.5 5.0 2.5 0.0 -10 0 10 20 30 40 50 Days after anthesis (b) 10.0 Westonia Glucose concentration (% DW) 7.5 ab a 5.0 ab ab ab Irrigated Drought 2.5 b 0.0 Fig. S5 The patterns of stem (sheath included) sucrose (a) and glucose (b) concentrations in wheat Triticum aestivum varieties, Westonia and Kauz under irrigated and drought conditions. The vertical bars represent SE. Values with the same letter are statistically not different at P = 0.05. Kauz 7.5 a 5.0 ab 2.5 b a b b 0.0 -10 0 10 20 30 Days after anthesis 40 50 Westonia RIR2=0.801 RD2=0.807 1-FEH enzyme activity (nmol Fructose min-1g-1FW) Kauz RIR2=0.872 RD2=0.950 1-FEH enzyme activity (nmol Fructose min-1g-1FW) 6-Kestose concentration (% DW) (b) 6-Kestose concentration (% DW) Bifurcose concentration (% DW) Bifurcose concentration (% DW) (a) Westonia RIR2=0.975 RD2=0.988 6-FEH enzyme activity (nmol Fructose min-1g-1FW) Kauz RIR2=0.996 RD2=0.554 6-FEH enzyme activity (nmol Fructose min-1g-1FW) Fig. S6 The correlation of stem (sheath included) bifurcose concentration and 1-FEH enzyme activities between 0-35 DPA (a) and 6-kestose concentrations and 6-FEH activities between 15-45 DPA (b) in wheat Triticum aestivum varieties, Westonia (circles) and Kauz (diamonds), respectively, under irrigated and drought conditions. M Westonia Kauz Chinese Spring ck M Westonia Kauz N6BT6A Chinese Spring Westonia ck (b) (c) M Westonia Kauz N6AT6D N6BT6A N6DT6B ck (a) 2 kb 2 kb 1 kb 1 kb 1 kb FEHw3F+FEH2151R500bp FEH2F+FEHw3R 6B4690F+6BPR 91 9 857 91 91 106 382 159 242 94 207170 FEH4690F FEH 2151R 6BPR FEH 2F 218223 FEH w3F FEH w3R 1480 1-FEH w3-6B Fig. S7 The fragments of 1-FEH w3 were amplified from wheat Triticum aestivum varieties, Westonia and Kauz with an upstream primer pair (FEH2F/FEHw3R, a), a downstream primer pair (FEHw3F/FEH2151R, b), and a 3’terminal primer pair (FEH4690F/6BPR, c). Nulli-tetra lines (N6AT6D, N6BT6A, N6DT6B) from wheat T. aestivum varieties, Chinese Spring were used for confirming the fragment location. Chinese Spring was used as a positive control and ck as a negative control. M, standard marker. DNA length bp 0 (a) 500 1340 bp 1-FEH w1-6A 1000 1500 1666 9 91 9 106 857 91 9 91 242 382 159 1.5 kb 1 kb FEH13200F+ 6AFEH630R 106 857 91 94 91 242 217 91 159 M Westonia ck Westonia ck Kauz Kauz ck (c) ck N6DT6B N6BT6A 210 223 N6AT6D CS 286 159 4000 207 168 91 94 207 170 242 (d) 1 kb 1 kb 500 bp 500 bp 6APF1+6B60R 91 94 207 165 M N6AT6D N6BT6A N6DT6B ck 1607 M 106 857 3500 6BPF2 6B60R 6APF1 218 223 1-FEH w2-6D (b) 3000 FEH 2151R 1480 1-FEH w3-6B 91 2500 6AFEH630R FEH 2F FEH13200F 214 226 2000 6APF1+6B60R Fig. S8 The promoter region amplification of 1-FEH w3. (a) 1-FEH genes isolated from bread wheat chromosomes 6A, 6B and 6D (Zhang et al., 2008). The primers used are indicated by arrows ( see also Table S1). (b) Amplification of the promoter region of 1-FEH w1 (6A) from wheat Triticum aestivum variety, Chinese Spring (CS) and nulli (N)-tetra (T) stocks of Chinese Spring (N6AT6D, N6BT6A, N6DT6B). Absence of amplification in N6AT6D indicates that the primer pair was specific for 1-FEH w1 on the 6A chromosomes. (c) Amplification of the promoter region of 1-FEH w3 on 6B using wheat Triticum aestivum L. varieties, Westonia and Kauz and (d) on the nulli-tetra lines of N6AT6D, N6BT6A and N6DT6B. The results indicate that the amplified fragment originates from chromosome 6B. ck, negative control; M, standard marker. 6B 1D 2A barc279 barc279gdm033b M8126 0.0 wsnp_Ex_rep_c67296_65839761 M5381 M1878 barc124 6.9 wsnp_Ex_c4185_7559420 M3798 M2226 gwm636 8.4 wsnp_Ex_c2218_4157473 M2692 M4015 wmc147 12.4 wsnp_CAP11_c8597_3709328 M817 wmc222 M7137 12.9 wsnp_Ex_c10257_16825240 M1307 M1895 M130 14.2 wsnp_Ex_c18616_27481826 M2328 M8181 wsnp_Ex_c15188_23387754 M1575 17.8 wsnp_Ex_c1894_3575749 M1991 cfd083 wmc407 22.5 wsnp_Ex_c14361_22341570 M2362 wmc429 M1668 38.8 wsnp_Ex_c3258_6004611 wsnp_Ex_c17990_26770800 M1888 cfd065 M2046 40.1 wsnp_Ex_c750_1474184 M2279 M3405 cfd036c M1800 42.5 gwm046 M4692 cfd019b gdm005-Jb 46.9 wsnp_Ex_c11866_19039540 gwm046 gwm357a M1321 wsnp_Ex_c17990_2677014653.9 M1544 M23 gwm359 63.9 wsnp_Ex_c5047_8963671 M2278 M4422 M5816 wsnp_Ex_c53364_56625806 72.7 wsnp_Ex_c5929_10402147 M4075 M210 wmc177 78.1 wsnp_Ex_rep_c104884_89459472 M4172 M5250 M4060 102.8 wsnp_JD_rep_c64325_41024646 M4381 cfd048 M6909 105.5 barc176 M5124 gwm642 M3682 107.3 wsnp_JD_c11273_11770307 M6306 M2320 gwm292a 110.5 wsnp_JD_c14691_14352459 barc176barc062 M472 122.5 wsnp_JD_c9434_10274598 M5782 M1845 M4622 wsnp_Ex_c4728_8444212 123.4 M5849 M2934 M1387 wsnp_JD_c23373_19987039 142.4 wsnp_Ex_rep_c67391_65971023 M6229 M4346 M1755 143.3 wsnp_RFL_Contig2744_2471775 M3991 M2453 M1594 145.6 barc278 M5943 M166 M459 146.4 wsnp_Ex_c1815_3420846 M5392 M301 M6979 165.6 wsnp_Ku_c13905_22034406 M8381 gdm111 M7165 171.2 wsnp_Ex_c46217_51790399 barc278 M8143 gdm033-J 172.6 wsnp_JD_c4343_5462565 M2283 M8101 173.0 wsnp_Ex_c3838_6981043 M6509 M6641 182.0 wsnp_Ex_c14010_21901313 wsnp_Ex_c10094_16590615 M3964 M8394 182.5 wsnp_Ex_c33246_41764093 M6050 M8473 183.9 wsnp_Ex_c31017_39858962 M3647 M2332 199.8 wsnp_Ex_c32825_41419391 M1843 M5206 200.2 wsnp_BE443745A_Ta_2_1 wsnp_Ku_rep_c104021_90610162 M1277 M5286 202.0 wsnp_JD_rep_c63957_40798083 M3428 M7727 202.5 gwm108a M3313 M1722 203.0 barc258 M7190 M3413 204.8 wsnp_Ku_c23012_32893918 M4366 M138 M7408 wsnp_Ex_c61603_61581245 205.2 wsnp_JD_c7522_8606553 M7003 M6301 205.7 wsnp_Ra_rep_c108284_91604017 M2023 gwm108a 206.1 wsnp_Ku_c10362_17156084 M5005 barc258 206.6 wsnp_Ex_c4876_8692783 M2095 M6729 207.1 gwm577 M1355 M4438 209.5 barc1073 M2944 M6172 215.8 wsnp_Ra_c34203_42948357 M4912 M8135 219.0 wsnp_Ex_c5323_9408829 gwm311-J M6387 wsnp_Ex_c1597_3045682 wsnp_Ra_c32175_41221223 222.0 wsnp_Ex_rep_c66846_65240088 M4033 wsnp_Ex_c22202_31392780 wsnp_Ex_c2441_4568016 gwm577 wsnp_Ex_c48087_53105842 barc1073 wsnp_Ra_c41581_48764320 M7879 wsnp_Ex_c15475_23757972 M4163 wsnp_Ex_c12341_19693090 M7862 M2077 gwm146 QTspikeletGH_7B 0.0 6.0 10.5 12.9 45.5 54.8 73.7 76.0 81.2 91.0 97.0 99.9 100.8 101.7 109.7 113.3 115.1 121.0 127.1 158.8 205.4 213.3 214.7 216.6 217.1 218.4 219.3 223.7 232.6 QTspikelet3_7B 0.0 wmc158 16.1 M429 24.3 M8195 28.4 M2131 28.9 M535 32.5 M905 35.2 M4956 35.7 M2237 36.6 37.5 M2950 39.8 M5397 41.6 M833 49.4 M1114 51.3 M4323 51.7 barc070 54.9 M2130 59.4 M809 61.2 61.7 M518 WMC168 62.2 64.0 M7482 68.0 cfa2049 68.5 M2832 68.9 M6613 78.1 M1877 80.0 M630 81.8 82.7 M6564 84.1 cfd035a 96.2 M1136 96.7 M7344 97.6 barc174 98.1 M5885 103.0 M8395 M1477 104.8 M5860 106.6 122.8 M6764 138.9 M486 139.3 M265 M5841 139.8 M7769 143.4 gwm631 147.8 M6159 150.8 M3232 161.4 M1761 164.9 166.7 M127 168.1 M7002 169.0 M7202 181.9 M2497 187.0 M7660 198.0 M1502 M4211 203.7 M4735 M7910 205.5 M3639 M8375 207.7 208.2 M448 208.7 M7942 210.1 M7620 210.5 M6427 215.0 M1665 221.9 M5185 228.1 M2459 M7485 M607 M1437 M3848 M5143 M2962 M4472 M6737 M6802 M2670 M3573 cfa2240 M4610 M4605 M5147 M3861 M3656 M2766 QTtgw3_1B 350 QTgwSh_1B QTppSh_6B 300 wsnp_Ex_c1962_3697351 barc054 M2442M209 wmc257c 0.0 wsnp_Ku_c5033_8989455 cfd019a M7126cnl076 WMC085 36.2 wsnp_Ku_c3056_5734773 M3857 M6878cfd061 M6551 54.5 wsnp_Ra_c9233_15459255 M6553 M8102M5709 wmc406 wsnp_Ex_c24963_34217997 56.8 cfd095 M2937M7319 M1822 wsnp_Ex_c16864_25440739 59.9 cfd076 M2174M4522 M328 wsnp_Ku_c14409_22721765 60.8 barc273 M6528M4888 wsnp_BG607523B_Ta_2_4 61.3 M1534 wsnp_Ex_c25505_34771897 62.6 M1990 M585 wmc024 M2873 wsnp_Ex_c18669_27544717 64.0 barc096 M2975M5755 M8221 wsnp_Ex_rep_c67635_66292111 M1608 M2342M7114 M3564 65.7 wsnp_JD_c5170_6293946 M724 M5428M2019 M4456 68.0 wsnp_Ex_c52615_56152839 M6092M1542 M2874 wsnp_JD_c9805_10591233 69.8 M4148M7159 M5024 70.7 wsnp_Ex_c4069_7355357 M6238wmc278 M2215 71.2 wsnp_Ex_rep_c66900_65314206 M3731gwm164 barc065 stm007tcac 71.6 wmc494 M5329gwm357c BARC187 72.1 1FEHW3 stm007tcac gwm374 M6783 73.0 wsnp_Ex_c6514_11307200 74.0 wmc494 M2092 M7011 wsnp_Ex_c10959_17801482 M4527M4244 M2872 M1315 74.5 wsnp_BE424100D_Ta_1_1 M1412M3815 M8362 75.4 wsnp_Ku_c8391_14261321 M80 M1308 M2179 wsnp_Ku_c53270_57959459 76.3 M7322M2958 gwm582 79.0 wsnp_CAP11_rep_c4122_1949294 M7154M720 M2502 wsnp_Ku_c4427_8029592 81.7 wsnp_Ex_c7911_13433794 82.2 M842 M1999 M2401 wsnp_Ku_c8394_14267750 83.1 M7066M4042 M4095 wsnp_Ku_c927_1905095 M4748M3836 M6121 84.0 wsnp_Ex_rep_c67783_66469848 M7323M8385 M8420 86.4 wsnp_Ex_c34842_43092205 M7349M1085 M7567 89.8 wsnp_Ex_c2936_5416717 M5454M1462 M8367 94.0 wsnp_Ra_c25691_35261662 M3500M236 M2557 95.8 wsnp_Ex_rep_c68915_67808523 M3229M8558 M295 98.1 wsnp_Ex_c3804_6917368 wsnp_Ra_c2694_5122122 101.3 M7791M462 M8534 cfd027-J M5572M8580 gwm131c 106.2 wsnp_Ex_c20019_29052512 107.1 M3627M234 M6476 wsnp_Ex_c13352_21044607 M7802M143 M8261 107.6 wsnp_Ex_c10120_16626785 cfd027-J M7845 M5830 M463 108.1 wsnp_BE490384D_Ta_1_2 M2500M5856 M7520 wsnp_Ex_c9779_16145653 110.3 M1764M1614 M50 111.2 wsnp_BE426620D_Ta_2_2 M8244 M1285M6055 wsnp_Ex_c11127_18033163 112.6 M6075 M230 cfa2129a wsnp_BE445431D_Ta_2_1 113.5 wsnp_RFL_Contig1168_230552 M5240 M4962M8072 117.1 wsnp_CAP11_rep_c4170_1971400 M5811 M7062 M96 118.5 wsnp_Ku_c16572_25480808118.9 M5948 M1440M6625 wsnp_Ex_c5172_9167324 M10 M176 M7418 wsnp_Ex_c2598_4832869 121.2 M897 M8228M6755 122.6 wsnp_Ku_c7002_12116034 M6918 M853 M7273 wsnp_CD453605B_Ta_2_1 123.5 M6830 M6601M689 wsnp_Ku_c5160_9203385 125.7 M8344 M4108M8073 wsnp_Ex_c19525_28494827 126.6 wsnp_BE490763B_Ta_2_1 128.4 barc061 M3015M363 wsnp_JD_c6872_7985864 129.4 cfa2129b M7257M7096 wsnp_Ex_rep_c102281_87481676 wsnp_BE490604A_Ta_2_1 M439 M7303 M1254 131.4 wsnp_Ex_c19476_28434084 M6664 M7140M8504 132.8 wsnp_BE496826A_Ta_2_2 M1204 M2431M1098 wsnp_Ku_c39334_47795350148.6 M4619 M242 M6182 169.3 wsnp_Ex_c2100_3937914 M4602 M6155M4118 169.7 wsnp_CAP11_c2142_1128735 M6117 M5060 M233 M6656 174.2 wsnp_JD_c1119_1642176 wsnp_CAP7_c1339_673581 174.6 M4478 M2421M3773 wsnp_Ex_c45713_51429315 178.4 M5991 M272 M5442 wmc105 M2551 M7006M3982 185.6 gwm311b M226 M2779 M2566 187.0 cnl064 M3278 M705 M7478 188.8 wsnp_Ku_c34036_43438136 M5868 M5781M8262 wsnp_BE403421A_Ta_2_1 225.4 M5129 M1033M3252 wsnp_Ex_c7193_12354542 227.2 M5110 M3947M7668 wsnp_Ex_c2936_5415651 233.1 wsnp_CAP7_c399_215824 240.4 M2191 M7963 wmc105 wsnp_Ex_c29008_38081173 242.2 M3965 M7872 gwm311b wsnp_Ex_c17435_26144201 243.1 M8177 cnl064M1590 wsnp_Ex_c39304_46635517 244.0 M4864 M6937M4162 wsnp_BF483640B_Ta_2_2 M6901 barc213 M28 wsnp_Ex_c17561_26284693 244.9 M3572 245.8 M4634M2659 wsnp_Ex_c5334_9427824 M5564 M3228M530 wsnp_Ex_c10630_17338703 246.3 barc080 gwm140 M1086M8096 wsnp_Ex_c9948_16379630 248.6 M3206M1081 M2219cfd027 M3677M6624 M506 M7570 M2228M7144 M4170M5534 M1366 QTtgw3_6B QTgw3_1B 250 QTheightSh_6B 200 QTtgw3_6D 150 QTppSh_6B 100 7B 7B 7A 6D 1B 6B 1A QTknGH_1A QTtgw3_6B 50 0.0 0.0 14.1 1.8 15.9 58.8 19.5 89.6 64.7 95.1 68.3 111.7 73.7 74.6 112.6 80.0 115.4 82.7 119.6 86.7 120.5 87.6 127.8 90.8 128.7 99.4 130.5 111.8 132.7 124.8 133.7 134.5 190.3 137.5 191.7 140.8 198.2 141.3 199.5 143.1 200.0 145.8 200.4 149.0 209.6 149.5 211.9 150.4 227.2 229.0 150.8 231.2 151.3 233.5 152.6 234.8 154.0 235.3 154.9 236.6 157.6 237.0 158.1 237.5 158.5 237.9 238.4 159.4 241.1 159.9 246.4 164.4 246.9 165.3 247.3 165.8 248.7 168.4 251.4 169.3 252.3 172.5 253.2 255.4 180.5 259.4 186.8 261.7 193.6 262.1 198.1 266.6 198.6 268.4 199.0 269.3 202.6 270.7 203.5 271.6 208.0 272.0 273.8 208.4 275.2 208.9 275.7 209.8 277.1 221.8 278.0 226.3 279.4 228.1 280.3 232.6 281.2 233.0 282.5 282.9 233.5 283.4 234.4 285.7 234.8 291.0 237.1 297.9 238.0 299.7 239.3 301.0 239.8 306.4 240.3 312.3 336.4 241.2 349.2 241.6 352.4 243.0 356.4 243.9 378.5 246.2 381.3 249.4 382.7 257.1 383.2 261.2 384.5 272.8 274.6 280.5 283.6 288.7 289.1 QTheightSh_6B 0 Fig. S9 The QTL location of height, thousand grain weight (TGW) and peduncle proportion detected on 6B in the genetic linkage map of the 225 DH population of wheat Triticum aestivum varieties, Westonia/Kauz. Mapped markers are indicated on the right and their corresponding genetic distances (cM) are indicated on the left. Quantitative trait loci (QTL) confidence interval with an F-value over the threshold is by vertical bar. M5310 M2897 M2696 M4008 M7922 M2029 M1611 gwm146 (a) (b) Westonia Irrigated Drought 4 120 Westonia Irrigated Drought ab a 90 a ab 60 ab 2 b 30 b c 0 a Kauz 0 Kauz 90 4 a a a 60 b b 2 30 b bc 0 6-FEH activity (nmol Fructose min-1g-1FW) 6-Kestose concentration (% DW) 6 0 -10 0 10 20 30 Days after anthesis 40 50 -10 0 10 20 30 40 50 Days after anthesis Fig. S10 Evolution of stem (sheath included) 6-kestose concentrations (a) and 6-FEH activities (b) in wheat Triticum aestivum varieties, Westonia and Kauz under irrigated and drought conditions. The vertical bars represent SE. Values with the same letter are statistically not different at P = 0.05. Table S1 Primers used for the amplification of wheat genomic DNA sequences and for qRTPCR Forward primer sequences Reverse primer FEH13200F ATAGATACATCCATACTCGCG FEH6A630R GAAACAGTAACCAATCTGATCGC 6APF1 CGAAACAAGCATGCGCCAAT 6B60R TTGGCTCATGGAGTCATGGGTC 6BPF2 CTCCGCATCTCACCACAGATC 2Fa CGGATCTACAGTCTCCAGA FEHw3Rb GCCTGATTTTGATCTATGTCAC FEHw3Fb CCGCGTTAGTGCGGGACA FEH2151Ra CAAGTAACTGAGATGGGAAG FEHw1Fb CCGCGTTAGTGCGGGATA FEHw1Rb CACCAGTGTATATGATGAC FEHw2Fb CCGCGTTAGTACGGGATA FEHw2Rb GCCTGATGTTGATCTATGTCG 6B4690F GGACATTCAGCAGGAAAG 6BPR GTACCCTAGTCACCCTCGAATCA GAPDHLb CGAAGCCAGCAACCTATGAT GAPDHRb CAAAGTGGTCGTTCAGAGCA sequences a FEH2F and FEH2151R are 5’upstream of the initiating methionine and downstream of the transcription stop site, respectively. bPrimers that were used for qRT-PCR. References Zhang J, Huang S, Fosu-Nyarko J, Dell B, McNeil M, Waters I, Moolhuijzen P, Conocono E, Appels R. 2008. The genome structure of the 1-FEH genes in wheat (Triticum aestivum L.): new markers to track stem carbohydrates and grain filling QTLs in breeding. Molecular Breeding 22(3): 339-351.
© Copyright 2026 Paperzz