FEMS Microbiology Letters 253 (2005) 231–235
www.fems-microbiology.org
The Clostridium botulinum GerAB germination protein is located
in the inner membrane of spores
François Alberto, Lucien Botella, Fréderic Carlin, Christophe Nguyen-the,
Véronique Broussolle *
INRA UMR A408 Sécurité et Qualité des Produits dÕOrigine Végétale, Institut National de la Recherche Agronomique, Domaine Saint-Paul,
Site Agroparc, 84914 Avignon Cedex 9, France
Received 19 July 2005; received in revised form 22 September 2005; accepted 26 September 2005
First published online 10 October 2005
Edited by E. Ricca
Abstract
Clostridium botulinum dormant spores germinate in presence of L-alanine via a specific receptor composed of GerAA, GerAB and
GerAC proteins. In Bacillus subtilis spores, GerAA and GerAC proteins were located in the inner membrane of the spore. We studied the location of the GerAB protein in C. botulinum spore fractions by Western-blot analysis, using an antipeptidic antibody. The
protein GerAB was in vitro translated and used to confirm the specificity of the antibodies. GerAB was not present in a coat and
spore outer membrane fraction but was present in a fraction of decoated spores containing inner membrane. These results strongly
suggest that the protein GerAB is located in the inner membrane of the spore.
2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords: Clostridium botulinum; Spore; Germination; GerAB; Membrane protein
1. Introduction
Endospores are resistant forms produced by Bacillus
and Clostridium species and allow the bacterial survival
in hostile conditions, such as nutrient depletion for Bacilli or production of fermentative organic acids during
growth of Clostridia [1,2]. While dormant, spores remain able to sense changing environmental conditions
to germinate and give a new vegetative cell [3]. Germination corresponds to a cascade of inter-related degradative events triggered by physical agents (sub-lethal
temperature, high pressure and abrasion for instance)
or by small molecules (germinants) such as amino acids,
sugars or mineral ions not metabolised by the spore [4].
*
Corresponding author. Tel.: +33 432 722518; fax: +33 432 722492.
E-mail address: [email protected] (V. Broussolle).
For instance, spores of Bacillus subtilis 168 respond to a
stimulation to L-alanine or AGFK mixture (L-asparagine, D-glucose, D-fructose, potassium ions) [5,6]. L-alanine is also a germinant for B. cereus, B. megaterium
and B. anthracis spores [7–10]. Both proteolytic and
non-proteolytic strains of Clostridium botulinum also respond to a L-alanine stimulation [11,12]. During germination, the germinant molecules are interacting with
specific receptors, then leading to the release of dipicolinic acid and ions from the spore core before hydrolysis
of the spore cortex. The germinant receptors in B. subtilis are composed of three proteins encoded by five tricistronic operons, gerA, gerB, gerK, ynd and yfk [13–15].
These genes are expressed only during sporulation, the
receptor proteins are consequently fully functional when
spore germination starts. Homologous operons were
also described in B. cereus, B. anthracis and other Bacilli
0378-1097/$22.00 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.09.037
232
F. Alberto et al. / FEMS Microbiology Letters 253 (2005) 231–235
as well as in Clostridium species [4]. C. botulinum and C.
sporogenes also contain a gerA operon encoding 3 proteins GerAA, GerAB and GerAC [16] and the sequence
of several clostridial genomes confirms the presence of
one or several copies of germinant receptors encoding
genes [17–19]. The GerA-like proteins are predicted
from their amino acid sequence to be membrane associated. While GerA proteins in B. subtilis were initially
suggested to be located in the outer membrane of dormant spores [20,21], two recent studies demonstrated a
more likely location of GerA and GerB proteins in the
inner membrane [22,23]. The aim of this work is to
investigate the location of the GerA proteins in C. botulinum and we focus our study on the transmembrane
GerAB protein.
2. Materials and methods
2.1. Bacteria and spore production
The type B strain NCTC 7273 of proteolytic C. botulinum was mainly used in the experiments. Some tests
were also performed on B. subtilis DSM 402 (DSMZ
Collection, Braunschweig, Germany) and nine proteolytic C. botulinum strains: type A NCTC 7272, type A
IFR 93/21, type A IFR 93/42, type A IFR 00/31, type
B IFR 93/25, type B IFR BL 81/21, type F IFR 93/28
(Institute of Food Research, Norwich, UK), type A
ATCC 7948 and type B ATCC 7949 (American Type
Culture Collections, Rockeville, USA). Modified Anellis
broth [24] was inoculated with 1 ml of an overnight culture of C. botulinum in TYG broth and incubated at
30 C. When high concentrations of spores were reached
(after 4–10 days) as determined by microscopic observation, spore suspensions were prepared according to
Plowman and Peck [12].
and homogenised with a bead beater (Poly Labo) in
20 bursts (30 s at 5,000g) with 30 s cooling in an ice
water bath between bursts. The final homogenate was
diluted in 500 ll of TEP buffer (50 mM Tris pH 7.4,
5 mM EDTA, 1 mM PMSF) containing 1% SDS (v/v)
and 0.15 M b-mercaptoethanol. This mixture was incubated 30 min at 70 C, centrifuged (5 min at 13,000g
and 4 C) and the supernatant kept at 20 C until subsequent use.
2.3. Preparation of spore fractions and spore coat extracts
for Western blotting
The protocol used to prepare spore fractions was
adapted from the method of Paidhungat and Setlow
[23]. Briefly, purified spores in water were centrifuged
(2 min at 9,500g and 4 C) . The pellet was resuspended
in 500 ll of decoating buffer (0.1 M NaCl, 0.1 M NaOH,
1% SDS, 0.1 M DTT) and incubated at 70 C for
30 min. This pellet was washed 10 times in 1 ml of sterile
cold distilled water after centrifugations (5 min at 3,400g
and 4 C). Treated spores were resuspended in 500 ll
TEP buffer containing 1 mg of lysozyme, 1 lg of RNAse
A, 1 lg of DNAse I and 20 lg of MgCl2 and incubated
at 37 C for 5 min then in ice for 20 min. Spores were
mixed to 100 mg of zirconium beads (Poly Labo) and
homogenised with a bead beater (Poly Labo) in 20
bursts (30 s at 5,000g) with 30 s cooling in an ice water
bath between each burst. This mixture was centrifuged
5 min at 2,400g. The supernatant was centrifuged
(180 min at 100,000g and 4 C). Finally, a soluble fraction (S100) and a pellet (P100) were obtained. This pellet
was resuspended in 50 ll of TEP buffer containing 1% of
100· Triton.
Coat proteins were extracted from about 2 OD580
units of purified spores as previously described [26].
2.4. Generation of an anti-GerAB antibody
2.2. Preparation of whole-cell and spore extracts
To prepare total protein extracts of vegetative cells,
10 ml of a bacterial culture grown on TYG broth for
16 h at 37 C, were centrifuged (15 min at 2,400g and
4 C) and the pellet was resuspended in 200 ll of Tris–
HCl buffer (0.0625 M/pH 6.8) containing 200 mg of zirconium beads (Poly Labo, France). The mixture was
homogenised with a bead beater (Poly Labo) in 2 bursts
(30 s at 5,000g) with 30 s of cooling in an ice water bath
between bursts, then centrifuged again (5 min at 2,400g).
Protein concentration of the supernatant was measured
by the Bradford method [25] using the ‘‘Bio-Safee Coomassie’’ (Bio Rad). Proteins were kept at 20 C until
subsequent experiment. The preparation of crude extracts of spores was done according to Paidhungat and
Setlow [23]. About 20 mg of spores in 200 ll of water
were mixed to 100 mg of zirconium beads (Poly Labo)
A peptide (NEKINAKANNENFREE) corresponding to the C-terminal region of GerAB [16] was synthesized, conjugated to keyhole limpet hemocyanin and the
conjugate was injected to rabbits to raise polyclonal
antibodies against GerAB (Eurogentec).
2.5. In vitro protein translation
The translational step of the GerAB protein was done
using the kit ‘‘Rapid Translation System RTS E. coli linear
template generation set, His-Tag’’ (Roche). The matrix was
done in two rounds of PCR by using two set of primers:
(i) the RTSF1/RTSR1 pair (5 0 -CGCTTAATTAAACATATGGAAAATAGCAGAAATAATGC-3 0 /5 0 -TGATGATGAGAACCCCCCCCTTATTCTTCTCTAAAATTTTCAT-3 0 ) was used to amplified the entire gerAB
open reading frame (nucleotides complementary to
F. Alberto et al. / FEMS Microbiology Letters 253 (2005) 231–235
corresponding gerAB DNA are underlying in each primer)
(ii) the RTSANCREF/RTSANCRER pair (5 0 -GATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGTCTGGTT CTCATCATCATCATCATCATAGCAGCGGCATCGAAGGCCGCGGCCGCTTAATTAAACATATGACC-3 0 /5 0 -CCGCTGGTGTGGG CAGGTCACCTATAGGCCTATATCAAGGAGGAAAGTCGTTTTTTGGGGAGTTCTGGGCAAATCTCCGGGGTTCCCCAATACGATCAATAACGAGTCGCCACCGTCGTCGGTTGAGTCGAAGGAAAGCCCGAAACAATCGTCGGCCTAGAATGG CCTAGAATCAATCAATGGCCTAGGG-3 0 ) was used to create the promoting sequence T7, a ribosome binding site, a histidine-tag upstream the gerAB sequence, and the T7
terminator downstream the gerAB sequence. The PCR
product obtained was used in a translation experiments
using the ‘‘Rapid Translation System RTS 100 E. coli
HY kit’’ (Roche), following the supplierÕs instructions.
To check the presence of the synthesised protein, 1–2 ll
of reaction was loaded on a SDS–PAGE gel and was analysed by Western-blot with the anti-gerAB antibodies.
2.6. Western-blot analysis
SDS–PAGE and Western-blot were done by
standard techniques [27]. Immunoblots were done with
enhanced chemiluminescence reagents (ECL kit,
Amersham Pharmacia Biotech) according to supplierÕs
recommendations
233
Fig. 1. Coomassie-blue stained SDS–PAGE gel (a) and Western-blots
using an anti-GerAB antibody (b) of total protein extracts of C.
botulinum NCTC 7273 vegetative cells (VC) and spores (SP) (MW,
molecular weight markers: 113, 92, 53, 35, 29 and 21 kDa).
interpreted the 45 kDa protein as the GerAB native
form. The 32 kDa band may either be a consequence
of some degradation during protein extraction, or due
to an unexpected migration of the extremely hydrophobic GerAB protein [16]. The 100 and 60 kDa bands may
correspond either to dimers of the GerAB protein, or to
its association with other proteins forming the complexes of the germinant receptors. Similar unexpected
bands were also observed in the total spore protein extract of B. subtilis after hybridisation with an anti-GerBA antibody [23]. However, we cannot fully excluded
that 32, 60 and 100 kDa polypeptides could be unspecific signals as such non-specific bands were evidenced
in B. subtilis gerBA null mutant [23].
3. Results and discussion
3.2. Specificity of GerAB antibodies
3.1. Detection of GerAB
The polyclonal anti-GerAB antibodies reacted with
proteins specific of C. botulinum spores. However, we
had to determine if the observed bands were highly specific to the GerAB protein. Despite many attempts, we
failed to obtain knock-out mutants for C. botulinum gerAB, likely because of low transformation and/or allelic
exchange efficiency in this bacteria [28]. Therefore, to
our knowledge, there is no report in the literature on a
C. botulinum gene inactivated by allelic exchange. The
specificity of antipeptidic antibodies was checked using
an in vitro translated GerAB protein. The addition of
the construction containing the gerAB gene in the reaction mixture of the in vitro translation system resulted in
the apparition of a protein of approx. 42 kDa on SDS–
PAGE (Fig. 2(a)). This 42 kDa protein hybridised
on Western-blot with the anti-GerAB antibody
(Fig. 2(b)). The anti-GerAB antibody used in this work
recognized the GerAB protein and was consequently
used to study the location of the GerAB germination
protein using C. botulinum spore extracts.
According to its amino acid sequence, the spore germination protein GerAB exhibits the feature of a fully
trans-membrane protein that could hardly be purified
from spores [16]. Polyclonal antibodies were raised
therefore against residues 363–377 of GerAB and used
in Western-blots to probe C. botulinum proteins separated by SDS–PAGE (Fig. 1(a)). Four major hybridisation bands (100, 60, 45, 32 kDa) were consistently
observed on Western-blots of the total spore protein
extract, while hybridisation bands were never observed
on Western-blots of vegetative cell protein extracts
(Fig. 1(b)). The same four bands were also observed
on total protein spore extracts from nine other C. botulinum strains; no cross-reactive band was observed on B.
subtilis total spore protein extract (data not shown).
These results strongly suggest that the GerAB protein
is highly spore specific. As the expected size of the C.
botulinum Beans GerAB protein is 42.5 kDa [16], we
234
F. Alberto et al. / FEMS Microbiology Letters 253 (2005) 231–235
Fig. 2. Coomassie-blue stained SDS–PAGE gel (a) and Western blots
using an anti-GerAB antibody (b) of in vitro translated proteins.
Translation with GerAB DNA matrix (+DNA), translation control
without GerAB DNA (DNA). Molecular weight markers: 113, 92,
53, 35 kDa (MW).
3.3. Localisation of GerAB in spores
C. botulinum spores were separated into a membrane
fraction (P100) and a soluble fraction (S100), according
to a procedure adapted from Paidhungat and Setlow
[23]. The P100 fraction corresponds to the spore membrane fraction, mainly the inner spore membrane, because the outer spore membrane is likely discarded with
the spore coats in the first centrifugation following spore
lysis. After SDS–PAGE and detection with the anti-GerAB, the 45 kDa protein detected in the P100 fraction is
likely the GerAB protein also detected in the total spore
extract but not in the S100 supernatant (Fig. 3). Furthermore, the 100, 60 and 32 kDa hybridisation bands detected in the total spore extract were also detected in
the P100 fraction. The purity of the P100 and the S100
fractions was checked by hybridization with a B. subtilis
anti-CotA [29], which cross-reacted with one 65 kDa C.
botulinum protein detected in spore coat fractions, corresponding to the expected size of C. botulinum CotA,
according to the C. botulinum Hall A genome sequence
data. The C. botulinum CotA protein was not detected
in both the P100 and S100 fractions (Fig. 4). This shows
the absence of CotA, and therefore of any coat material,
and of the outer membrane surrounding the spore coats
in both P100 and S100 fractions.
Fig. 4. Western blots using an anti-CotA antibody of total spore
extract (TS), S100 supernatant (S100), P100 pellet (P100) and coat
fractions (C). Molecular weight markers: 92, 53, 35 kDa.
All these experiments demonstrate for the first time
the location of the GerAB protein in the inner membrane of the C. botulinum spores. The B. subtilis GerAA,
GerAC, GerBA and GerBC proteins have also been
found in the spore inner membrane [22,23]. This location is in agreement with the expression of the gerA operon during sporulation under the control of the rG
factor, which regulates the formation of the spore inner
membrane in both B. subtilis and C. botulinum [16,30].
GerAB likely forms with GerAA and GerAC proteins
a functional receptor for L-alanine. The germination
triggering system in response to alanine may be the same
in both B. subtilis and C. botulinum: similar organisation
in one operon and same location of the receptors in the
inner membrane of the spore for instance. Recent studies tried to understand the interactions between components of the Ger receptors but the exact function of these
proteins are still largely unknown [31,32]. Genome
sequencing of C. botulinum HallA, currently in progress,
may allow in the future, a more comprehensive comparison of the germination systems between Bacilli and
Clostridia.
Acknowledgements
We are grateful to Dr. A.O. Henriques (Universidade
Nova de Lisboa, Portugal) for gift of the B. subtilis antiCotA antibodies. The authors want to thank Aude-Marie Deydier and Stéphanie Sassone for their enthusiastic
participation to the study. F. Alberto, Ph.D. was supported by an INRA- Région PACA fellowship.
References
Fig. 3. Western blots using an anti-GerAB antibody of total spore
extract (TS), S100 supernatant (S100) and P100 pellet (P100).
Molecular weight markers: 113, 92, 53, 35 kDa (MW).
[1] Durre, P. and Hollergschwandner, C. (2004) Initiation of endospore formation in Clostridium acetobutylicum. Anaerobe 10, 69–
74.
F. Alberto et al. / FEMS Microbiology Letters 253 (2005) 231–235
[2] Sonenshein, A.L. (2000) Control of sporulation initiation in
Bacillus subtilis. Curr. Opin. Microbiol. 3, 561–566.
[3] Paidhungat, M. and Setlow, P. (2002) In: Bacillus subtilis and its
Closest Relatives: from Genes to Cells (Sonenshein, A.L., Hoch,
J.A. and Losick, R., Eds.), pp. 537–548. ASM Press, Washington,
DC.
[4] Moir, A., Corfe, B.M. and Behravan, J. (2002) Spore germination. CMLS 59, 403–409.
[5] Moir, A., Lafferty, E. and Smith, D.A. (1979) Genetic analysis of
spore germination mutants of Bacillus subtilis168: the correlation
of phenotype with map location. J. Gen. Microbiol. 111, 165–180.
[6] Moir, A., Kemp, E.H., Robinson, C. and Corfe, B.M. (1994) The
genetic analysis of bacterial spore germination. J. Appl. Bacteriol.
Symp. Suppl. 76, 9S–16S.
[7] Senesi, S., Cercignani, G., Freer, G., Batoni, G., Barnini, S. and
Ota, F. (1991) Structural and stereospecificity requirements for
the nucleoside-triggered germination of Bacillus cereus spores. J.
Gen. Microbiol. 137, 399–404.
[8] Clements, M.O. and Moir, A. (1998) Role of the gerI operon of
Bacillus cereus 569 in the response of spores to germinants. J.
Bacteriol. 180, 6729–6735.
[9] Scott, I.R., Stewart, G.S.A.B., Koncewicz, M.A., Ellar, D.J. and
Crafts-Lighty, A. (1978) In: Spores VII (Chambliss, G. and Vary,
J.C., Eds.), pp. 95–103. ASM Press, Madison, WI.
[10] Ireland, J.A.W. and Hanna, P.C. (2002) Amino acid- and purine
ribonucleoside-induced germination of Bacillus anthracis Delta
Sterne endospores: gerS mediates responses to aromatic ring
structures. J. Bacteriol. 184, 1296–1303.
[11] Alberto, F., Broussolle, V., Mason, D.R., Carlin, F. and Peck,
M.W. (2003) Variability in spore germination response by strains
of proteolytic Clostridium botulinum types A B, and F. J. Appl.
Microbiol. 36, 1–3.
[12] Plowman, J. and Peck, M.W. (2002) Use of a novel method to
characterize the response of spores of non-proteolytic Clostridium
botulinum types B E and F to a wide range of germinants and
conditions. J. Appl. Microbiol. 92, 681–694.
[13] Zuberi, A.R., Moir, A. and Feavers, I.M. (1987) The nucleotide
sequence and gene organization of the gerA spore germination
operon of Bacillus subtilis 168. Gene 51, 1–11.
[14] Paidhungat, M., Setlow, B., Driks, A. and Setlow, P. (2000)
Characterization of spores of Bacillus subtilis which lack dipicolinic acid. J. Bacteriol. 182, 5505–5512.
[15] Paidhungat, M. and Setlow, P. (2000) Role of Ger proteins in
nutrient and nonnutrient triggering of spore germination in
Bacillus subtilis. J. Bacteriol. 182, 2513–2519.
[16] Broussolle, V., Alberto, F., Shearman, C.A., Mason, D.R.,
Botella, L., Nguyen-the, C., Peck, M.W. and Carlin, F. (2002)
Molecular and physiological characterisation of spore germination in Clostridium botulinum and Clostridium sporogenes. Anaerobe 8, 89–100.
[17] Nolling, J., Breton, G., Omelchenko, M.V., Makarova, K.S.,
Zeng, Q.D., Gibson, R., Lee, H.M., Dubois, J., Qiu, D.Y., Hitti,
J., Wolf, Y.I., Tatusov, R.L., Sabathe, F., Doucette-Stamm, L.,
Soucaille, P., Daly, M.J., Bennett, G.N., Koonin, E.V. and Smith,
D.R. (2001) Genome sequence and comparative analysis of the
solvent-producing bacterium Clostridium acetobutylicum. J. Bacteriol. 183, 4823–4838.
235
[18] Shimizu, T., Ohtani, K., Hirakawa, H., Ohshima, K., Yamashita,
A., Shiba, T., Ogasawara, N., Hattori, M., Kuhara, S. and
Hayashi, H. (2002) Complete genome sequence of Clostridium
perfringens, an anaerobic flesh-eater. Proc. Natl. Acad. Sci. USA
99, 996–1001.
[19] Bruggemann, H., Baumer, S., Fricke, W.F., Wiezer, A., Liesegang, H., Decker, I., Herzberg, C., Martinez-Arias, R., Merkl, R.,
Henne, A. and Gottschalk, G. (2003) The genome sequence of
Clostridium tetani, the causative agent of tetanus disease. Proc.
Natl. Acad. Sci. USA 100, 1316–1321.
[20] Sakae, Y., Yasuda, Y. and Tochikubo, K. (1995) Immunoelectron microscopic localization of one of the spore germination proteins, GerAB, in Bacillus subtilis spores. J.
Bacteriol. 177, 6294–6296.
[21] Yasuda, Y., Sakae, Y. and Tochikubo, K. (1996) Immunological
detection of the GerA spore germination proteins in the spore
integuments of Bacillus subtilis using scanning electron microscopy. FEMS Microbiol. Lett. 139, 235–238.
[22] Hudson, K.D., Corfe, B.M., Kemp, E.H., Feavers, I.M., Coote,
P.J. and Moir, A. (2001) Localization of GerAA and GerAC
germination proteins in the Bacillus subtilis spore. J. Bacteriol.
183, 4317–4322.
[23] Paidhungat, M. and Setlow, P. (2001) Localization of a germinant
receptor protein (GerBA) to the inner membrane of Bacillus
subtilis spores. J. Bacteriol. 183, 3982–3990.
[24] Gaze, J.E. and Brown, K.L. (1988) The heat resistance of
Clostridium botulinum 213B over the temperature range 120 to
140 C. Int. J. Food Sci. Technol. 23, 373–378.
[25] Bradford, M.M. (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein utilizing
the principle of protein-dye binding. Anal. Biochem. 72,
248–254.
[26] Henriques, A.O., Beall, B.W., Roland, K. and Moran, C.P. (1995)
Characterization CotJ, a Sigma(E)-controlled operon affecting the
polypeptide of composition of the coat of Bacillus subtilis spores.
J. Bacteriol. 177, 3394–3406.
[27] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual, second ed. Cold Spring Harbor
Laboratory, New York.
[28] Alberto, F. (2003) in: Etude physiologique et moléculaire de la
germination des spores de Clostridium botulinum, p. 130, Université de Droit, dÕEconomie et des Sciences, Marseille III.
[29] Isticato, R., Esposito, G., Zilhao, R., Nolasco, S., Cangiano, G.,
DeFelice, M., Henriques, A.O. and Ricca, E. (2004) Assembly of
multiple CotC forms into the Bacillus subtilis spore coat. J.
Bacteriol. 186, 1129–1135.
[30] Phillips, Z.E.V. and Strauch, M.A. (2002) Bacillus subtilis
sporulation and stationary phase gene expression. CMLS 59,
392–402.
[31] Cabrera-Martinez, R.M., Tovar-Rojo, F., Vepachedu, V.R. and
Setlow, P. (2003) Effects of overexpression of nutrient receptors
on germination of spores of Bacillus subtilis. J. Bacteriol. 185,
2457–2464.
[32] Igarashi, T. and Setlow, P. (2005) Interaction between individual
protein components of the GerA and GerB nutrient receptors that
trigger germination of Bacillus subtilis spores. J. Bacteriol. 187,
2513–2518.