International Conference on Biological, Civil and Environmental Engineering (BCEE-2015) Feb. 3-4, 2015 Bali (Indonesia)
Improvement the Production of Maize (Zea
Mays L.) Crop by Using Particle Bombardment
Manal M. Abdel-Rhman
Maize is one of the largest and most important cereal crops
produced in the world. In 2012, the total production of maize
was 872 million metric tons. It is the leading source of
livestock feed and bio- energy crop for ethanol
production.Maize is also very important for food production
,therefore, a successful highly efficient maize transformation
protocol is a prerequisite to develop a commercial genetically
modified (GM) maize product conferring herbicide and/ or
insect resistance, drought tolerance or high carbohydrate
content to increase the yield of maize for food and biofuel
production (Je et al., 2014) .
The use of the term biotechnology has become widespread
recently but, in its most restricted sense, it refers to the
molecular techniques used to modify the genetic composition
of a host plant, i.e. genetic engineering. In its broadest sense,
biotechnology can be described as the use of living organisms
or biological processes to produce substances or processes
useful to mankind and, in this sense; it is far from new (Zhong
et al. 1995).
Biotechnology can also be inserted into the industry and
directly affect the economy of a sector. An outstanding
example of this is that biotechnology may be applied to
dramatically decrease costs in corn ethanol production and
improve energy input requirements. There are numerous
opportunities to improve important characteristics of the corn
plant to decrease the cost of ethanol production Kemble et al.,
(2006).
Many biotechnological tools were used to transferring
DNA and have received special attention, leading to several
strategies such as biolistic or Agrobacterium tumefaciens.
Particle bombardment and Agrobacterium mediated
transformation are two popular methods currently used for
producing transgenic cereals (Shouh et al., 2004), the
application of Agrobacterium mediated transformation to
monocotyledonous species, including rice and maize, has been
recently reported..
Anthranilate synthase (AS) catalyzes the conversion of
chorismate into anthranilate, the first reaction leading from the
common aromatic amino acid (shikimic acid) pathway towards
the biosynthesis of Trp in both microorganisms and plants, and
is feedba ck inhibited by the end product, Trp.
Tryptophan (Trp) is an essential amino acid for animal
growth, and cereal crops such as wheat, maize and rice
exhibits relatively low content of Trp in seed proteins. In
higher plants, the Trp biosynthetic pathway provides an amino
acid for protein synthesis as well as precursors for secondary
metabolites such as the phytohormone indole-3-acetic acid and
Abstract—Maize is one of the world’s three most widely
cultivated crops. Biotechnology is expected to play an increasingly
important role in maize genetic improvement to meet this expanding
demand. The plasmid C2ASA2-NOS-ASB 16.6kb which has
feedback-insensitive anthranilate synthase gene α subunit AS gene
from tobacco. Also has As β subunit gene in order to enhance
holoenzyme formation to make the transformation more efficient.
Gus and NPTII genes use as selectable marker under 35s promoter.
Nine transgenic lines expressed ASA2 gene gene. The results of this
study pointed to develop a reproducible and efficient method for
inserting genes into nuclear genome of many important plant species
using the naturally occurring feedback-insensitive anthranilate
synthase gene ASA2 from tobacco.
Keywords—Production Maize (Zea Mays L.), Crop, Particle
Bombardment.
I. INTRODUCTION
IZE (Zea mays L.) is an important crop for human
consumption, particularly in developing countries,
where this cereal can represent up to 65% of the total
calories and 53% of the protein intake (Bressani 1991).
Although the protein content of maize is relatively high (9%
on average), its quality is poor due to an imbalance in three
essential amino acids, in which the contents of tryptophan and
lysine are low, whereas that of leucine is high. This amino acid
balance ratio is not enough to satisfy the FAO requirements for
human nutrition, especially for children.
Maize (also known as corn) is a domesticated cereal grain
that has been grown as food and animal feed for tens of
thousands of years. It is currently the most widely grown crop
in the world, and is used not only for food/feed but also to
produce ethanol, industrial starches and oils. Maize is now at
the beginning of a new agricultural revolution, where the
grains are used as factories to synthesize high-value molecules
(Shaista et al. 2011).
Maize is one of the most important crops around the world
because of its importance as food and feed in man life; thus,
breeding technology in this crop has been the subject of
intense efforts high-value products from transgenic maize
using in several biotechnology approaches applied mainly in
order to incorporate desiderable traits on several maize lines
(Valdez-Ortize et al. 2007).
M
Manal M. Abdel-Rhman, Plant pathology (Genetics branch), faculty of
agriculture,
Damanhour
University,
Egypt.
Email
id:
[email protected], [email protected].
http://dx.doi.org/10.15242/IICBE.C0215060
74
International Conference on Biological, Civil and Environmental Engineering (BCEE-2015) Feb. 3-4, 2015 Bali (Indonesia)
phytoalexins as reported by Normanly, et al. (1995),
Radwanski and Last (1995) and Tsuji et al. (1993).
proline, 2 mg/l 2,4-D, 0.1 mg/l Casein hydrolysate, 10 ml N6
vitamins,20 g/l Poly Ethylene Glycol (PEG) and 8g/l Agar.
The media was adjusted to pH 5.8.Silver nitrate 25 µM was
added after autoclaving. Twenty embryos were placed in each
Petri dish. Cultures were incubated in the dark at 28 ºC.
Percentage of immature embryos forming primary callus was
recorded two weeks after culture. The developing callus was
sub-cultured after 21 days into the callus maintenance medium
as for callus induction medium.Two types of calluses were
grown (embryogenic, non-embryogenic) .
II. MATERIALS AND METHODS
A. Plant materials
Two inbred lines maize (Zea mays L.) namely, SD7 and
SD34(California Univeristy) were used in the current
study. Ears were harvested between 16 and 20 days after
pollination. Size of immature embryos was 1-4 mm. The ears
were surface sterilized for 5 min in 70% ethanol and then for
20 min in Clorox 10%. This was followed by three times rinse
in sterile distilled water.Immature embryos were aseptically
isolated by cutting the tips of the kernels with a scalpel without
touching the embryo.
B. Initiation medium
The embryos were placed on medium N6 (Chu et al.,
1975). Supplemented with N6 salts, 3 % sucrose, 2.76 g
C. Plasmid Structure
The plasmid used in this work, pC2ASA2-NOS-ASB 16.6
kb (MTA, Illinois University), (fig, 1) contains a selectable
marker (ASA2 α & β) the coding region of kanamycin, gusA,
under control of the cauliflower mosaic virus (CAMV). ANOS
polyA (nopaline synthase) terminator sequence.
Fig 1. Schematic drawing of the plasmid C2ASA2-NOS-ASB.The plasmid 16.6 kb consists of ASA2,ASB, CaMV35S : cauliflower mosaic
virus 35 S promoter and 3’NOS : the polyadenylation signal of nopaline synthase.
Different treatments were designed to test the pressure of the
accelerating helium pulse 1100 psi single shout).Selection of
putative transformed callus began 10 days after bombardment
when the callus were cultured every 21 days on N6S selection
medium which was similar to callus initiation medium but
without proline and casein hydrolysate, filter sterilized silver
nitrate (5μM) was added after autoclaving, 6- Methyl-DLtryptophan (6MT) 100 µM was added also.
D. Maize transformation and regeneration
Friable callus was used for particle bombardment. Callus
was transferred to osmoticum medium (N6 medium + 36.4 g/L
sorbitol and 36.4 g/L mannitol) for 4 hours prior to
bombardment.
The gold particles (Bio-Rad) (1μg) was used to precipitate
DNA onto the microparticles 1μL plasmid DNA (stock 1μg
μL-1). Then, 220μL(stock 2.5 M) and 50μL spermidine (stock
0.1M) were added and homogenized. The mixture was kept on
ice for 5 min and vortexed for 5 min, micro centrifuged at
6B
E. Selection and regeneration of transformants
After bombardment, explants were kept in dark at 28 ◦C
for7-10 days then transferred to selection medium with
inhibitor 6- methyl D-L-tryptophan with concentration 100
µM.After three cycles of selection, transformed calluses were
transferred for regeneration medium
The surviving callus was transferred to regeneration medium
MS medium (Murashige and Skoog 1962) supplemented
with 1ml/L (1000X) MS vitamin stock, 100mg/Lmyo-inositol,
60 g/Sucrose, 3g/L gelrite, pH5.8, after autoclaving 100
7B
5000 rpm for 1 min, rinsed carefully with 250 μl of ethanol
and suspended in 40 μL 100% ethanol.
10 μl of the DNA –coated particles were pipetted onto each
macrocarrier (washed in absolute EtOH, dried before
uses).Bombardments were performed on Petri dishes
containing friable callus clump in the middle.
http://dx.doi.org/10.15242/IICBE.C0215060
75
International Conference on Biological, Civil and Environmental Engineering (BCEE-2015) Feb. 3-4, 2015 Bali (Indonesia)
agarose gel and visualized with ethidium bromide stain under
UV light
mg/mL of 6MT was added. The calluses were incubated for 2
weeks at 25oC in the dark.
After 2 weeks, transformed green calluses were transferred
to the light on Regeneration medium (II) which is the same for
MSI except MSII supplemented with 30 g/L sucrose.
III. RESULTS AND DISCUSSIONS
Results showed that inbred line SD34 is more efficient than
inbred line SD7 in callus regeneration and response for subculture. The higher alive calluses were (155 and 44) in SD34
and SD7 hybrids, in respect. The number of dead calluses in
variety SD7 was (25) compared with variety SD34 was (7) as
shown in Figure( 2 ,3,4 and 5). The main conclusions from
these results that variety SD34 could be used for
transformation more efficiency SD7 based on their callus
morphological characteristics.
PCR analysis was conducted on all of the plants
regenerated from immature embryo transformation. It was
observed 815 bp band of ASA2gene (Fig. 4) and 790 bp of
ASB gene (Fig.4).
Cho et al., (2004) showed that, the tobacco- feedback –
insensitive ASA2 gene can be inserted into legume hairy roots
(A. sinicus and soybean) and be expressed to produce
feedback-insensitive AS activity that leads to increased free
Trp levels and resistance to the Trp analog 5MT. The Trp
analog 5MT and 6MT inhibit AS enzyme activity and plant
growth. Over expression of the ASA2 gene results in
resistance to 5MT in E.coli (Song et al., 1998) and transgenic
A. sinicus (Cho et al., 2000).
The expression of ASA2 in plant tissues leads to increased
levels of free Trp, which could be desirable since Trp. Is an
essential amino acid required in the diets of humans and nonruminant animals.
F. PCR analysis
For the molecular characterization of the transgenic plants
generated, total genomic DNA was isolated from leaf tissue of
primary leaves using a CTAB protocol described by (Doyle
and Doyle 1990) and submitted to PCR and southern blot
analysis.
For the presence of ASB, the primers 5’
TGTCCAAGATCCCATGACGATTCC3’and5’CAGAAATC
CACAGAACCGGGAGAT 3’, which amplify 800 bp were
used.
For
the
ASA2
(α),
the
primers
5’TCTGTACACTTCAAATGGGTCAGC3’and5’CTAAAAG
CGGGAACTTGATTCCGC3’ which amplify 815 bp were
used.
Each 20 μl amplification reactions mixture consisted of
100ng of template DNA,2 μl of Taq buffer 10X, 0.5 μl of
dNTPS 10 mM, 1 μl of each primer, and 0.3 μl of Taq
polymerase. The reactions were carried out using a thermal
conditions: 1cycle at 94oc for 5 min, 35 cycles at 94ocfor
45s,annealing at 54.6ocfor 45s ,72ocfor 60s and a final
extension at 72oc for 7 min for GUS, 1cycle at 94oc for 5 min,
35cycles at 94ocfor 30s,annealing at 57ocfor 45s ,72ocfor 60s
and a final extension at 72oc for 7 min for ASA2, and1cycle at
94oc for 5 min, 30cycles at 94ocfor 45s,annealing at 55ocfor
30s ,72ocfor45s and a final extension at 72oc for 7 min. The
amplified products were separated by electrophoresis on 1%
1
http://dx.doi.org/10.15242/IICBE.C0215060
2
76
International Conference on Biological, Civil and Environmental Engineering (BCEE-2015) Feb. 3-4, 2015 Bali (Indonesia)
4
3
5
6
Fig. 2 The different growth stages for embryo cultured on N6E on variety SD7 as follow: (1) planting of immature embryo; (2) embryo growth
and forming; (3);Alive and dead callus (4) callus induction and (5) sub-culture of callus
(6) calluses on selection medium
2
1
http://dx.doi.org/10.15242/IICBE.C0215060
77
International Conference on Biological, Civil and Environmental Engineering (BCEE-2015) Feb. 3-4, 2015 Bali (Indonesia)
4
3
5
6
Fig. 3 The different growth stages for embryo cultured on N6E on variety SD34 as follow: (1) planting of immature embryo; (2) embryo
growth and forming; (3);Alive and dead callus (4) callus induction and (5) sub-culture of callus (6) calluses on selection medium
Fig. 4 Different selection for alive and dead calluses number
on variety SD34 using N6E medium.
Fig 5 Different selection for alive and dead calluses number on
variety SD7 using N6E medium.
Somatic embryogenesis is the process by which somatic
cells, under induction conditions, generate embryogenic cells,
which go through a series of morphological and biochemical
changes that result in the formation of a somatic embryo.
These characteristics have designated somatic embryogenesis
into a model system for the study of morphological,
physiological, molecular and biochemical events occurring
during the onset and development of embryogenesis in higher
plants.
http://dx.doi.org/10.15242/IICBE.C0215060
78
International Conference on Biological, Civil and Environmental Engineering (BCEE-2015) Feb. 3-4, 2015 Bali (Indonesia)
Every 21 days for six times we calculated the dead and alive
callus as shown in Figure (4 and 5). Almost 50% after three
selection of the callus were dead in SD7 and on the other hand
in SD34 were nearly 90% of the calluswere alive. The number
of alive callus was higher than in SD34 compared with SD7.
(Abdel-Rahman and Widholm 2009) found that 6MT
100µM was the best concentration used for selection
compared with 75 and 125 µM. The use of feedbackinsensitive AS α-subunit genes as selectable markers with
5MT as the selective agent has been reported in maize
(Anderson et al., 1997) and rice (Tozawa et al., 2001)
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
Fig. 6 PCR analysis of regenerated plants. Agarose electrophoresis
gels of PCR amplification products for ASA2 gene in SD7 and SD34
in respect.
[17]
ACKNOWLEDGMENT
[18]
This study was supported by a material transfer agreement
received from Dr. Jack M. Widholm, Crop science,
department, University of Illinois at Urbana-Champaign
(UIUC), USA . and a agreement between Illinois University
and Damanhour University.
SUMMARY
Maize is the third crop of maize grain crops grown in the world after
wheat, rice, over the past few decades, the annual production of corn is
similar to wheat and rice. Millions of people rely on corn as a food source and
is an important source of protein. By giving the crop to produce the basic
amino acid amino acid tryptophan by genetic transformation by introducing a
gene essential for the synthesis of the amino acid to the genetic makeup of
corn plant will get the new strain with high nutritional value economically
useful. This study aims to examine the applicability of corn varieties
cultivated for the production of embryonic callus and the ability to form new
plants, producing a genetic transformation using molecular biology, which
includes introducing a plasmid to the embryonic callus by using Particle
bombardment gene thrower device contains a plasmid gene Anthranilate
synthase responsible for feedback for the synthesis of the amino acid
tryptophan, which is one of the important amino acids used by cells to form
defensive compounds of plant as well as auxins, Nicotinic acid. And take
advantage of this gene in the production of plants containing the desired gene,
which increases the nutritional value of crop and production of new corn
strain contains a useful genetic characteristics are not present in the genome
of this plant.
REFERENCES
[1]
[2]
[3]
[4]
[5]
[6]
Abdel-Rahamn M.M. and Widholm M.J (2009) Transformation of two
plasmids into maize callus using particle bombardment. Agriculture
Science and Enviromental Alexandria University Damanhour branch
v.8,(2) 31-47.
Anderson PC, Chomet PS, Griffor MC and Kriz AL (1997) Anthranilate
synthase gene and its use thereof. World Intellectual Property
Organization, 97/26336.
Bressani, R. (1991) Protein quality of high-lysine maize for humans.
Cereal Foods
Chu CC, Wang CC, Sun CS, Hsu C, Yin KC, Chu CY and Bi F (1975)
Establishment of efficient medium for another culture of rice through
comparative experiments on the nitrogen source. Sci. Sinica. 18:659668.
Cho HJ, Brotherton JE, Song H-S and Widholm JM (2000) Increasing
tryptophan synthesis in a forage legume Astragalus sinicus by
expressing the tobacco feedback-insensitive anthranilate synthase
(ASA2)
gene.
Plant
Physiol
123:1069–1076.
http://dx.doi.org/10.1104/pp.123.3.1069
Cho H-J, Brotherton JE and Widholm JM (2004) Use of the tobacco
feedback- insensitive anthranilate synthase gene (ASA2) as a selectable
http://dx.doi.org/10.15242/IICBE.C0215060
marker for legume hairy root transformation. Plant Cell Reports 23:104113. http://dx.doi.org/10.1007/s00299-004-0789-8
Doyle J.J. and Doyle J.L., (1990) Isolation of plant DNA from fresh
tissue. Focus 12:13-15.
Je M., Wu E., Kwan J., Yu M., Banh J., Linn W., Anand A., Li Z.,
Teronde S., James C., Todd J., and Zhao Z. (2014) Agrobacterium –
mediated high frequency transformation a fan elitecommercial maize
(Zea mays L. ) inbred lines Plant Cell Report 33: 1767-1777.
http://dx.doi.org/10.1007/s00299-014-1656-x
Kemble R (2006) Plant-produced enzymes for improved animal
nutritionand bioethanol processing. Agric. Biotechnol. Inter. Conf.
MelbourneAustralia World 36:806–811
Murashige T and Skoog F (1962). A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Plant Physiol. 15: 473-479.
http://dx.doi.org/10.1111/j.1399-3054.1962.tb08052.x
Normanly J., J.P. Slovin, J.D. Cohen, (1995) Rethinking auxin
biosynthesis andmetabolism, Plant Physiol. 107 323–329.
Radwanski ER and Last RL (1995) Tryptophan biosynthesis and
metabolism: biochemical and molecular genetics. Plant Cell 7:921–934.
http://dx.doi.org/10.2307/3870047
Shaista K, Memon AN, Ghanghro AB, Ibtessam T. 2011. Fractionation
and characterization of seed storage proteins from different wheat
varieties cultivated in Sindh on SDS-PAGE Electrophoresis. Pakistan
Journal
of
Nutrition
10:139-142.
http://dx.doi.org/10.3923/pjn.2011.139.142
Shou H., Frame B.R., Whitham S.A., and Wang K. (2004). Assessment
of transgenic maize events produced by particle bombardment or
Agrobacterium-mediated transformation. Mol Breeding, 13: 201–208.
http://dx.doi.org/10.1023/B:MOLB.0000018767.64586.53
Song H-S, Brotherton JE, Gonzales RA, Widholm JM (1998)Tissue
culture-specific expression of a naturally occurring tobacco feedbackinsensitive anthranilate synthase. Plant Physiol117:533–543.
http://dx.doi.org/10.1104/pp.117.2.533
Tsuji J., M. Zook, S.C. Somerville, R.L(1993). Last, Hammerschmidt,
Evidencethat tryptophan is not a direct biosynthetic intermediate of
camalexin inArabidopsis thaliana, Physiol. Mol. Plant Pathol. 43 221–
229. http://dx.doi.org/10.1006/pmpp.1993.1052
Valdez-Ortize A., Medina-Godoy S., Valverde M.E., and Paredes-Lopez
O. A (2007). Transgenic tropical maize line generated by the direct
transformation of the embryo-scutellum by A. tumefaciens. Plant cell,
tissue
and
organ
culture,
91:
201-214.
http://dx.doi.org/10.1007/s11240-007-9286-4
X.H. Zhang, J.E. Brotherton, J.M. Widholm, A.R. Portis, Targeting a
nuclear anthranilate synthase a-subunit gene to the tobacco plastid
genome results in enhanced tryptophan biosynthesis. Return of a gene to
its pre-endosymbiotic origin, Plant Physiol. 127 (2001) 131–141.
http://dx.doi.org/10.1104/pp.127.1.131
79