Transgenic Arabidopsis and tobacco plants overexpressing an

Plant Mol Biol (2007) 64:621–632
DOI 10.1007/s11103-007-9181-8
Transgenic Arabidopsis and tobacco plants overexpressing
an aquaporin respond differently to various abiotic stresses
Ji Young Jang Æ Seong Hee Lee Æ Ji Ye Rhee Æ
Gap Chae Chung Æ Sung Ju Ahn Æ Hunseung Kang
Received: 26 January 2007 / Accepted: 3 May 2007 / Published online: 24 May 2007
Springer Science+Business Media B.V. 2007
Abstract Despite the high isoform multiplicity of aquaporins in plants, with 35 homologues including 13 plasma
membrane intrinsic proteins (PIPs) in Arabidosis thaliana,
the individual and integrated functions of aquaporins under
various physiological conditions remain unclear. To better
understand aquaporin functions in plants under various
stress conditions, we examined transgenic Arabidopsis and
tobacco plants that constitutively overexpress Arabidopsis
PIP1;4 or PIP2;5 under various abiotic stress conditions.
No significant differences in growth rates and water
transport were found between the transgenic and wild-type
plants when grown under favorable growth conditions. The
transgenic plants overexpressing PIP1;4 or PIP2;5 displayed a rapid water loss under dehydration stress, which
resulted in retarded germination and seedling growth under
drought stress. In contrast, the transgenic plants overexpressing PIP1;4 or PIP2;5 showed enhanced water flow and
facilitated germination under cold stress. The expression of
several PIPs was noticeably affected by the overexpression
of PIP1;4 or PIP2;5 in Arabidopsis under dehydration
stress, suggesting that the expression of one aquaporin
isoform influences the expression levels of other aquaporins under stress conditions. Taken together, our results
Electronic supplementary material The online version of this
article (doi:10.1007/s11103-007-9181-8) contains supplementary
material, which is available to authorized users.
J. Y. Jang S. H. Lee J. Y. Rhee G. C. Chung S. J. Ahn H. Kang (&)
Department of Plant Biotechnology, Agricultural Plant Stress
Research Center and Biotechnology Research Institute, College
of Agriculture and Life Sciences, Chonnam National University,
300 Yongbong-dong, Buk-gu, Gwangju 500-757, Korea
e-mail: [email protected]
demonstrate that overexpression of an aquaporin affects the
expression of endogenous aquaporin genes and thereby
impacts on seed germination, seedling growth, and stress
responses of the plants under various stress conditions.
Keywords Abiotic stress Aquaporin Arabidopsis
thaliana Tobacco Transgenic plants Water channel
Abbreviations
PIP Plasma membrane intrinsic protein
Introduction
Water uptake and flow across cellular membranes is
important not only for plant growth under favorable conditions but also for ability of a plant to tolerate adverse
environmental conditions (Bohnert et al.1995; Steudle and
Peterson 1998; Blumwald 2000). Plants possess large
families of aquaporins that are divided into four different
subfamilies based on subcellular localization and sequence
similarity: plasma membrane intrinsic proteins (PIPs),
tonoplast intrinsic proteins (TIPs), NOD26-like MIPs or
NOD26-like intrinsic proteins (NIPs), and small basic
intrinsic proteins (SIPs) (Jauh et al. 1999; Quigley et al.
2001; Tyerman et al. 2002). The genome of Arabidopsis
encodes 35 aquaporin genes that include 13 PIPs, 10 TIPs,
9 NIPs, and 3 SIPs (Johanson et al. 2001; Quigley et al.
2001). The structural and biochemical properties of aquaporins have been studied in detail (Johansson et al. 2000;
Chaumont et al. 2001; Murata et al. 2000), and the subcellular localization, water transport activity, and regulation of plant aquaporins have been described previously
123
622
(Kaldenhoff et al. 1998; Martre et al. 2002; Maurel et al.
2002; Siefritz et al. 2002; Tyerman et al. 2002).
The importance of aquaporins in the responses of plants
to environmental stresses has been implicated by the
observation that the expression of aquaporin isoforms is
differently modulated by various environmental stresses,
including high salinity, drought, and cold, in various plant
species (Mariaux et al. 1998; Smart et al. 2001; Suga et al.
2002; Sakr et al. 2003; Jang et al. 2004; Alexandersson
et al. 2005; Boursiac et al. 2005; Sakurai et al. 2005; Zhu
et al. 2005). During the last several years, attempts to
understand the roles of aquaporins in response to environmental stresses have prompted the analysis of transgenic plants and loss-of-function mutant lines (Reviewed
by Hachez et al. 2006). Reduction of the expression of
PIP1 and PIP2 aquaporins in Arabidopsis and NtAQP1
aquaporin in tobacco by means of an antisense construct
resulted in alterations in root hydraulic conductivity,
resistance to water stress, or recovery from water deficit
(Martre et al. 2002; Siefritz et al. 2002). Aharon et al.
(2003) overexpressed PIP1;2 in tobacco plants and found
that, under favorable growth conditions, the transgenic
tobacco plants displayed increased growth rates, transpiration rates, stomatal density, and photosynthetic efficiency, whereas PIP1;2 overexpression had a negative
effect under drought stress. It has been shown that overexpression of a barley aquaporin raised salt sensitivity in
transgenic rice plants (Katsuhara et al. 2003), and the
contribution of a single aquaporin gene to root water uptake has also been demonstrated (Javot et al. 2003). More
recently, the role of lily PIP1 in osmotic water permeability
of leaf cells was demonstrated (Ding et al. 2004). Lian
et al. (2004) showed that transgenic rice plants overexpressing aquaporin RWC3 were more tolerant to drought
stress compared with non-transformed control plants, and
overexpression of BnPIP1 in transgenic tobacco plants
resulted in an increased tolerance to water stress (Yu et al.
2005). Despite the increasing number of reports demonstrating the roles of aquaporins in plant response to environmental stresses, the function of each individual
aquaporin isoform and the integrated function of aquaporins in response to various environmental stresses remain
poorly understood.
In the previous report, we showed that PIP aquaporin
isoforms are expressed at different levels in both the aerial
parts and the roots of Arabidopsis plants; these isoforms
are regulated differently by various abiotic stresses,
including drought, salt, or cold stress (Jang et al. 2004). To
understand the stress responses of transgenic plants overexpressing an aquaporin, we overexpresed the Arabidopsis
PIP1 or PIP2 in Arabidopsis and tobacco plants, and observed growth performance and stress tolerance of the
transgenic plants under drought, salt, or cold stress. Among
123
Plant Mol Biol (2007) 64:621–632
the 13 PIP genes, we investigated PIP1;4 and PIP2;5 as
representative PIP1-type and PIP2-type aquaporins,
respectively. PIP2;5 was chosen because it is the PIP that is
up regulated in the roots and aerial parts of Arabidopsis by
both drought and cold stresses (Jang et al. 2004). PIP1;4
was chosen because it is not down regulated by drought
stress and is slightly up regulated in the roots by cold stress
compared with other PIP1-type aquaporins (Jang et al.
2004). Because PIP1;4 and PIP2;5 are expressed at low
levels in both the aerial parts and the roots of Arabidopsis
plants (Jang et al. 2004), it is also of interest to examine
whether the overexpression of PIP1;4 or PIP2;5 influences
the expression of other endogenous PIP members in Arabidopsis under stress conditions. In this report, we demonstrate that the transgenic plants respond differently to
changing environmental conditions, and the observed
phenotypes are closely correlated with the ability of aquaporins to transport water in the transgenic plants,
emphasizing the importance of aquaporin-mediated water
transport in plant responses to environmental stresses.
Materials and methods
Plant materials and growth conditions
Arabidopsis thaliana ecotype Columbia was grown on
half-strength Murashige and Skoog (1962) (MS) medium at
23 ± 2C under a long day condition (16-h-light/8-h-dark
cycle). Tobacco (Nicotiana tabacum cv. Xanthi) was grown
either on half-strength solid MS medium or hydroponically
in the nutrient solution (Cooper 1975) under a long day
condition. For the experiments in pots, the seeds were sown
on a 2:1:1 mixture of vermiculite, peat moss, and perlite.
The pots were placed in the dark for 3 days at 4C and
were then transferred to normal growth conditions. The
plants were watered once per week. For cell pressure probe
measurement, tobacco seeds were germinated for 2 to
3 days at 22C on filter paper soaked with tap water. After
germination, seedlings were transferred to 1/5-strength
Cooper medium and grown at 23 ± 2C under 12-h-light/
12-h-dark cycle at a light intensity of 300 lE m–2 s–1.
Oxygen was supplied by continuous aeration of the nutrient
solution. To avoid excessive depletion of any particular
ion, the entire solution was replaced frequently.
Germination and seedling growth assays under stress
conditions
Seeds from individual plants grown in identical environmental conditions were harvested on the same day and used
for germination and seedling growth assays. Germination
assays were carried out on three replicates of 20–30 seeds.
Plant Mol Biol (2007) 64:621–632
Seeds were sown on MS medium supplemented with 1.5%
sucrose, and the plates were placed at 4C for 3 days in the
dark and then transferred to normal growth conditions. To
determine the effect of salt or dehydration on germination,
the medium was supplemented with various concentrations
of NaCl ranging from 75 to 150 mM or with concentrations of mannitol ranging from 100 to 400 mM, respectively. To determine the effect of cold on germination, the
seeds on MS plates were placed in an incubator maintained
at 10C under white light. A seed was regarded as germinated when the radicle protruded through the seed coat.
To determine the effect of salt or dehydration on seedling
growth, the 3-day-old seedlings germinated in normal
medium were transferred to the medium supplemented
with various concentrations of NaCl or mannitol, respectively, and the seedling growth was monitored for 14 days.
To test the effect of cold stress on seedling growth, the
seeds were allowed to germinate at normal growth conditions and were then transferred to an incubator maintained
at 10C. The plates were placed vertically in a growth
chamber and the length of roots was measured under these
stress conditions.
Vector construction and plant transformation
The coding regions of PIP1;4 and PIP2;5 cDNA were
prepared by PCR and ligated into the pGEM T-easy vector
(Promega, Madison, WI, USA). The vector was digested
with XbaI and BamHI, and the resulting DNA was then
subcloned into the pBI121 vector linearized by double
digestion with the same restriction enzymes. All DNA
manipulations were performed according to the standard
procedures (Sambrook et al. 1989), and PIP-coding regions
and the junction sequences were confirmed by DNA
sequencing. Transformation of Arabidopsis was performed
according to the vacuum infiltration method (Bechtold and
Pelletier 1998) using Agrobacterium tumefaciens GV3101.
Tobacco transformation was done according to the leaf disc
method (Gallois and Marinho 1995) using A. tumefaciens
GV3101. Seeds were harvested and plated on kanamycin
(50 lg/ml for Arabidopsis and 100 lg/ml for tobacco) and
carbenicillin (250 lg/ml for Arabidopsis and 500 lg/ml for
tobacco) selection medium to identify transgenic plants.
After further selection of transgenic lines with a segregation ratio of 3:1, T3 or T4 homozygous lines were used for
the phenotypic investigation.
RNA extraction, reverse-transcription PCR, and realtime RT-PCR
623
by spectrophotometric measurements, and 5 lg of total
RNA was separated on 1.2% formaldehyde agarose gel to
check the concentrations and to monitor the integrity of
samples. A half to one microgram of total RNA was used in
an RT-PCR system (Qiagen) together with gene-specific
primers; PIP1;4 (forward, 5¢ TCTAGAATGGAAGGCA
AAGAAGAAGATG 3¢; reverse, 5¢ GGATCCCTAACTC
TTGCTCTTGAAAGG 3¢), PIP2;5 (forward, 5¢ GGGATC
CCAATGACGAAGGAAGTGG 3¢; reverse, 5¢ CTCGA
GTTAAACGTGAGGCTGGCTC 3¢), Arabidopsis actin
(forward, 5¢ CAGCAGAGCGGGAAATTGTAAGAG 3¢;
reverse, 5¢ TTCCTTTCAGGTGGTGCAACGAC 3¢),
tobacco actin (forward, 5¢ TGGACTCTGGTGATGGTGTC
3¢; reverse, 5¢ CCTCCAATCCAAACACTGTA 3¢). The
real-time quantification of RNA targets was performed in
the Rotor-Gene 2000 real-time thermal cycling system
(Corbett Research, Sydney, Australia) using the QuantiTect
SYBR Green RT-PCR kit (Qiagen) as described (Kim et al.
2003). The gene-specific primers for 13 PIP-type aquaporins
are as previously described (Jang et al. 2004), and the
primers for 12 H+-ATPases are listed in Supplemental Table
S1. After normalization of the RNA content using actin gene
expression pattern in each sample, the expression levels of
each gene in wild type and transgenic plants under stress
conditions were calculated by comparing their expression
levels under non-stressed control plants.
Western blot analysis
Total proteins were extracted by incubating the plant
materials in the detergent solution containing 0.1% (w/v)
Triton X-100 and 1% (w/v) SDS, and were separated by
SDS-12% PAGE. The gels were subsequently used for
Western blotting where the proteins in the gel were transferred to a polyvinylidene difluoride membrane. The
membrane was incubated with the buffer containing the
anti-PAQs, the antibody of which was raised against the
synthetic peptide (KDYNEPPPAPLFEPGELSSWS) containing a conserved sequence among PIP-type aquaporins
in the N-terminal parts and reacts with most PIP-type
aquaporin isoforms (Ohshima et al. 2001). After three cycles of washing with TBS-T buffer or PBS-milk, the
membrane was incubated for 1 h with anti-IgG antiserum
conjugated to horseradish peroxidase (Sigma-Aldrich, St.
Louis, MO, USA). After a further three cycles of washing
with the same buffer, the proteins on the membrane were
detected by the enhanced chemiluminescence system
(ECL, Amersham Biosciences, Uppsala, Sweden).
Cell pressure probe measurements
Total RNA was extracted from the frozen samples using
the Plant RNeasy extraction kit (Qiagen, Valencia, CA,
USA). The concentration of RNA was accurately quantified
Cell pressure probe measurements were essentially performed as described previously (Lee et al. 2005a). The
123
624
Tw1/2 was used as a direct measure of changes in Lp, as
the elastic modulus of the cells did not change significantly between 10 and 22C (Lee et al. 2005b). An oilfilled glass capillary tube with a tip diameter ranging
from 6 to 8 lm was attached to the probe. Excised tobacco roots were fixed on a metal sledge, and the
nutrient solution was poured along the roots during the
experiments. Measurements were made on the second to
third layer of cortical cells at a distance of about 30–
50 mm from the root apex. Hydrostatic pressure relaxations were induced by rapidly moving the meniscus
using the micrometer screw of the probe and keeping it
at the new position until a steady pressure was again
attained. Pressure versus time curve was recorded from
which Tw1/2 was evaluated. When turgor pressure was
stable, 3 to 4 hydrostatic pressure relaxations were induced to measure Tw1/2 before exposing the cells to
different conditions such as high salt (50 mM NaCl),
dehydration (100 mM mannitol), HgCl2 (50 and
100 lM), or cold stress (10C).
Measurements of sap flow, photosynthesis, stomatal
conductance, transpiration, and chlorophyll
fluorescence
A heat-balance sap-flow gauge (Dynamax, Houston, TX,
USA) was used to measure sap flow through the main
stems of approximately 40-day-old tobacco plants. A
10 mm stem-gauge was attached to the stem just above
the cotyledons. Gauge signals, recorded with a data logger
(Campbell Scientific, Logan, UT, USA), were collected
every 1 min and averaged over 15 min. The entire
experiment was repeated three times. Photosynthesis was
measured with a portable photosynthesis measuring system (LI-6400, LI-COR, Lincoln, NE, USA). The chamber
was clamped over the first fully expanded leaf by
enclosing the leaf in a transparent cuvette that was held
horizontally. The stomatal resistance and transpiration
rate were measured with an LI-1600 steady state porometer as previously described (Shulze et al. 1982).
Chlorophyll fluorescence was measured by an OSI-FL
chlorophyll fluorescence measurement system (Opti- Sciences, Inc., Hudson, NH, USA) as previously described
(Öquist and Wass 1988).
Statistical analysis
Plant Mol Biol (2007) 64:621–632
Results
Overexpression of PIP1;4 or PIP2;5 does not enhance
plant vigor and water transport under favorable growth
conditions
To examine the responses of transgenic plants overexpressing a single aquaporin isoform under various stress
conditions, we generated transgenic Arabidopsis and tobacco plants constitutively overexpressing PIP1;4 or
PIP2;5 under control of the cauliflower mosaic virus 35S
promoter (35S::PIP1;4 or 35S::PIP2;5 plants). Transgenic
Arabidopsis and tobacco plants were used for phenotype
comparison, and transgenic tobacco plants were employed
for the measurements of cell pressure probe, sap flow,
stomatal conductance, and transpiration. The expression of
PIP1;4 and PIP2;5 in T3 transgenic plants was confirmed
by RT-PCR analysis (Fig. 1). We further conformed the
overexpression of PIP1;4 and PIP2;4 by protein gel blot
analysis using an anti-PAQs antibody that was prepared to
detect most PIP-type aquaporins (Ohshima et al. 2001). It
was evident that the expression of PIP1;4 and PIP2;5 is
much higher in transgenic plants than in wild-type plants
(Fig. 1). The intensity of the bands corresponding to PIP2;5
was weaker than that of PIP1;4, which may result from the
fact that the anti-AQP antibody used in this study was
raised against the synthetic peptide of the conserved region
of PIP1-type aquaporins and therefore reacts more strongly
(A)
WT
PIP1;4
T-1 T-2 T-3
WT T-1
PIP2;5
T-2 T-3
PIP
Actin
WT
1;4-1
1;4-2
2;5-1
2;5-2
PIP
(B)
PIP1;4
WT T-1 T-2 T-3
PIP2;5
WT T-1 T-2 T-3
PIP
Actin
WT
1;4-1
1;4-2
2;5-1
2;5-2
PIP
Data were square root-transformed prior to analysis, and
differences in Tw1/2, stomatal resistance, transpiration, and
gene expression levels between the wild-type and transgenic plants were compared by t-test (P £ 0.05; SigmaPlot software; Systat Software, Inc.).
123
Fig. 1 Confirmation of the transgenic lines. RT- PCR and Western
analyses of the expression of PIP1;4 or PIP2;5 in the wild-type plants
and independent transgenic lines (T-1, T-2, and T-3) in (A) twoweek-old whole Arabidopsis plants grown in MS medium and (B)
two-week-old tobacco plants grown in MS medium
Plant Mol Biol (2007) 64:621–632
625
with PIP1;4 than PIP2;5. The expression levels of PIP1;4
and PIP2;5 were quite similar in both the roots and aerial
parts of transgenic plants as determined by RT-PCR and
protein gel blot analysis (data not shown). Three representative plants were subsequently selected for further
analysis. The expression of PIP1;4 or PIP2;5 in the transgenic tobacco plants was also assessed by the measurement
of their respective water transport activities using a cell
pressure probe. In all of the plants tested, the half-time of
water exchange (Tw1/2) observed upon hydrostatic pressure
relaxation was in the range of 1 to 2 s (Tables 1 and 2).
The Tw1/2 was used as a direct measure of changes in Lp, as
the cell elastic modulus did not change significantly
depending on stress conditions (Lee et al. 2005b). The
water transport activity of PIP1;4 and PIP2;5 that contain
four cysteine residues at the positions of 83, 105, 141 and
146, and 74, 96, 132 and 137, respectively, should be
inhibited by HgCl2 treatment. The half-time of water exchange (Tw1/2) in the wild-type tobacco plants markedly
increased upon the addition of 50 lM HgCl2, whereas
Tw1/2 in the transgenic plants expressing PIP1;4 or PIP2;5
remained constant at the same HgCl2 concentration. A
much higher concentration of HgCl2 (100 lM) was required to block the water transport in the transgenic plants
(Table 1), which indicates that larger numbers of aquaporin
are present in the transgenic plants compared with the wildtype plants.
To assess the effect of PIP1;4 or PIP2;5 overexpression
on plant growth at favorable growth conditions, we analyzed seed germination and seedling growth of the wildtype and transgenic plants under normal growth conditions.
No differences in germination and seedling growth were
observed among the wild-type and overexpression lines
(Fig. 2). Photosynthesis, chlorophyll fluorescence, stomatal
resistance, and transpiration were not changed in the
transgenic plants compared with the wild-type plants
under normal growth conditions (data not shown).
These observations demonstrate that overexpression of
PIP1;4 or PIP2;5 does not contribute to the enhancement of
plant vigor and water transport under favorable growth
conditions.
Overexpression of PIP1;4 or PIP2;5 causes a rapid
water loss under drought stress
We then investigated the effect of overexpression of PIP1;4
or PIP2;5 on germination and growth of Arabidopsis and
tobacco plants under osmotic stress conditions. When
the seeds of wild-type and 35S::PIP1;4 or 35S::PIP2;5
Arabidopsis plants were germinated in the presence of
Table 1 Effect of HgCl2 on the water permeability of cortical cells in the wild-type and transgenic tobacco plants
Half-time of water exchange (Tw1/2) (s)
Plant
Control
50 lM HgCl2
100 lM HgCl2
Wild type
1.4 ± 0.4a
5.2 ± 0.4b
6.0 ± 1.3b
PIP1;4-1
1.3 ± 0.5a
2.1 ± 0.4a
5.1 ± 1.9b
PIP1;4-3
1.4 ± 0.6a
1.9 ± 0.4a
4.9 ± 1.7b
PIP2;5-1
1.1 ± 0.3a
1.5 ± 0.6a
6.2 ± 1.3b
PIP2;5-3
1.2 ± 0.2a
1.5 ± 0.5a
5.2 ± 1.1b
Different concentrations of HgCl2 were added to the circulating medium after performing control measurements for 20 min, and the water
exchange was measured for an additional 30 min. Values are means ± SD (n = 6), and the different letters in each low and column indicate
statistically significant differences (P £ 0.05)
Table 2 Effect of dehydration stress on hydrostatic and osmotic hydraulic conductivity of cortical cells, stomatal resistance, and transpiration in
the wild-type and transgenic tobacco plants
Plant
Hydrostatic Lp (Tw1/2)a (s)
Osmotic Lp (Tw1/2)a (s)
Stomatal resistance(cm s–1)
Transpiration(lg cm–2 s–1)
Wild type
1.9 ± 0.6a
226.8 ± 39.1b
1.77 ± 0.50d
5.37 ± 1.40f
PIP1;4-1
1.5 ± 0.4a
119.8 ± 16.0c
2.66 ± 1.52e
4.60 ± 1.71f
PIP1;4-3
1.4 ± 0.4a
121.8 ± 17.0c
2.70 ± 1.54e
4.65 ± 1.75f
PIP2;5-1
PIP2;5-3
1.7 ± 0.6a
1.6 ± 0.5a
80.8 ± 19.9c
81.9 ± 20.8c
2.87 ± 1.55e
2.85 ± 1.54e
3.66 ± 1.83g
3.71 ± 1.79g
Hydrostatic and osmotic hydraulic conductivity of cortical cells were measured in the medium containing 100 mM mannitol for dehydration
stress. Stomatal resistance and transpiration rates were measured in the plants subjected to dehydration stress at 200 mM mannitol for 1 day
a
The half-time of water exchange was used as a direct measure of changes in Lp. Values are means ± SD (n = 7), and the different letters in
each column indicate statistically significant differences (P £ 0.05)
123
626
Plant Mol Biol (2007) 64:621–632
(A)
(A)
100
80
Col-0
1;4-1
1;4-2
2;5-1
2;5-2
60
40
20
0
0
1
2
3
4
WT
PIP1;4
Col-0
1;4-1
1;4-2
2;5-1
2;5-2
100
80
60
40
20
0
0
1
2
(B)
WT
0.4
5.5
0.9
5
PIP1;4
6
7
PIP2;5
PIP2;5
Col-0
PIP1;4
5.8
3
4
Days
5
Days
(B)
120
Germination (% )
Germination (% )
120
5.9
PIP2;5
0.5
(C)
40
(D)
Survival rate (% )
(C)
3%
63
8%
16
6%
120
100
Col-0
1:4-1
1;4-2
2;5-1
2;5-2
80
60
40
20
0
0
2
4
6
8
10
Days
Fig. 2 Growth of the wild-type and transgenic plants under normal
growth conditions. (A) Germinations of the wild-type (Col-0) and
transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2) Arabidopsis plants were
measured on MS medium, and the (B) the wild-type and transgenic
Arabidopsis seedlings were photographed 21 days after germination.
Root lengths (cm) are means ± SD obtained from three independent
experiments (n = 20–25). (C) The wild-type and transgenic Arabidopsis plants were photographed 14 days after germination on soil, and
(D) the wild-type and transgenic tobacco seedlings were photographed 4 weeks after germination on soil
200 mM mannitol, approximately 60% of wild-type seeds
germinated at day 3, while only 45–55% of the transgenic
seeds germinated at day 3. Nearly 90% of wild-type seeds
germinated by day 6, but germination rates of the transgenic lines were approximately 75–85% at day 6 (Fig. 3A).
This retardation of germination in 35S::PIP1;4 or
35S::PIP2;5 lines was more severe at a higher mannitol
concentration, in that ~25% and 70% of wild-type seeds
123
Fig. 3 Drought sensitivity of the transgenic plants expressing either
PIP1;4 or PIP2;5. (A) Germinations of the wild-type (Col-0) and
transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2) Arabidopsis plants were
measured on MS medium supplemented with 200 mM mannitol. (B)
Phenotypes and survival rates of 4-week-old tobacco (top) and 2week-old Arabidopsis plants (bottom) subjected to drought stress for
2 weeks. The numbers below photograph represent survival rates (%)
of the plants. (C) Survival rates of Arabidopsis plants were examined
on MS medium supplemented with 400 mM mannitol. Values are
means ± SE obtained from five independent experiments (n = 20–25)
germinated at days 3 and 6, respectively, while only 10–
20% and 45–60% of the transgenic seeds germinated at
days 3 and 6, respectively, in the presence of 300 mM
mannitol (data not shown). Similar patterns of retarded
germination were also observed for the transgenic tobacco
plants compared with wild-type plants under dehydration
stress (data not shown). To further confirm the effect of
PIP1;4 or PIP2;5 overexpression on the growth performance of Arabidopsis and tobacco plants under drought
Plant Mol Biol (2007) 64:621–632
that overexpression of PIP1;4 or PIP2;5 does not alter plant
response to salt stress. The effect of PIP1;4 or PIP2;5
overexpression on water transport under osmotic stress was
also investigated by sap flow measurements. When osmotic
stress was imposed to the roots by the addition of 200 mM
mannitol to the medium, sap flow in the transgenic plants
decreased much faster and to a lower level than that observed in the wild-type plant (Fig. 4A). It was apparent that
sap flow in the 35S::PIP2;5 plant decreased much faster
than that in the 35S::PIP1;4 plant under osmotic stress.
Overexpression of PIP1;4 or PIP2;5 contributes to
enhanced water flow under cold stress
Because cold stress greatly increased the expression of
PIP2;5 (Jang et al. 2004), it was expected that PIP2;5
could contribute to the enhancement of plant growth and
water transport under cold stress. We tested this hypothesis
by comparing germination, seedling growth, and water
transport of cortical cells of the transgenic plants with those
of wild-type plants under cold stress. At normal growth
temperature (23C), germination of the wild-type and
transgenic Arabidopsis plants was initiated at day 1 and
completed at day 2 with no noticeable difference (data not
shown). However, when the seeds were incubated at a low
temperature (10C), the 35S::PIP1;4 and 35S::PIP2;5
plants germinated earlier than wild-type plants; the wild-
(A) 20
Sap flow (g/h)
Wild type
15
200 mM mannitol
1;4-1
2;5-1
10
5
0
(B) 20
Sap flow (g/h)
stress, water was withheld from 2-week-old Arabidopsis
and 6-week-old tobacco plants, and the phenotypes of the
plants were monitored for several days. It was evident that
the transgenic plants that overexpressed PIP1;4 or PIP2;5
wilted much faster and survived less than the non-transformed plants (Fig. 3B). The transgenic Arabidopsis and
tobacco plants started wilting as soon as day 10 and day 20,
respectively, after the termination of irrigation, at which
time the non-transformed control plants still showed a
nearly normal phenotype. It took 15 days without irrigation
for the wild-type Arabidopsis and 25 days for the control
tobacco plants to start to visibly wilt. It was apparent that
35S::PIP1;4 and 35S::PIP2;5 Arabidopsis plants showed
lower survival rates than the non-transformed plants in the
medium supplemented with 400 mM mannitol (Fig. 3C).
Although the difference was not significant, stomatal
resistance in the transgenic tobacco plants is slightly higher
than that in wild-type plants, whereas transpiration in the
transgenic tobacco plants is slightly lower than that observed in wild-type plants under dehydration stress (Table 2). No significant changes in photosynthesis and
chlorophyll fluorescence were observed between the wildtype and transgenic plants (data not shown). These observations reveal that overexpression of PIP1;4 or PIP2;5 had
a negative effect on water status in the transgenic plants,
which resulted in retarded germination and growth of
Arabidopsis and tobacco plants under drought stress.
Since it is apparent that overexpression of PIP1;4 or
PIP2;5 in Arabidopsis and tobacco plants caused faster
wilting of the plants under drought stress, we next investigated, by employing the cell pressure probe, whether
these changes in phenotype are directly related to the water
transport activities of aquaporins under dehydration stress
conditions. This experiment was conducted only on the
transgenic tobacco plants due to the technical feasibility of
the measurements. When osmotic stress was applied to the
roots by the addition of 100 mM mannitol to the medium,
the Tw1/2 of cortical cells in the wild-type plants increased
up to ~226 s, whereas those in the 35S::PIP2;5 and
35S::PIP1;4 transgenic lines increased to ~80 s and ~120 s
(Table 2), respectively, which indicates that cortical cells
in the 35S::PIP2;5 and 35S::PIP1;4 plants lost water much
faster than those in the wild-type plant under an osmotic
stress condition. The differences in the Tw1/2 of cortical
cells were specifically caused by dehydration stress; when
high salinity stress was applied to the roots by the addition
of 50 mM NaCl to the medium, the Tw1/2 of cortical cells
in the wild-type, 35S::PIP2;5, and 35S::PIP1;4 plants increased to ~44 to 55 s with no significant differences (data
not shown). This result, together with the observation that
overexpression of PIP1;4 or PIP2;5 had no impact on
germination and seedling growth of Arabidopsis and tobacco plants under salt stress (data not shown), indicate
627
22 οC
10 οC
Wild type
1;4-1
15
2;5-1
10
5
0
9:00
10:00
11:00
12:00
13:00
14:00
Time
Fig. 4 Effect of dehydration or cold stress on sap flow of the wildtype and transgenic tobacco plants. Sap flows were measured on the
40-day-old wild-type and transgenic (1;4-1 and 2;5-1) tobacco plants
subjected to (A) 200 mM mannitol and (B) 10C treatments
123
628
Plant Mol Biol (2007) 64:621–632
type seeds had not germinated on day 3, while approximately 5% and 13% of 35S::PIP1;4 and 35S::PIP2;5 plants
germinated on day 3, respectively. All of the transgenic
plants had germinated by day 5, whereas ~80% of wildtype plants had germinated by the same day (Fig. 5A).
Although PIP1;4- or PIP2;5-overexpressing plants displayed earlier germination under cold stress, no significant
difference in seedling growth was observed between the
wild-type and transgenic Arabidopsis plants under cold
stress (Fig. 5B). Similar patterns of earlier germination and
no differences in seedling growth were also observed for
the transgenic tobacco plants compared with wild-type
plants under cold stress (data not shown). It was apparent
that overexpression of PIP1;4 or PIP2;5 affects seed germination of Arabidopsis and tobacco plants under cold
stress, but does not contribute to seedling growth of the
Germination (% )
(A) 120
Col-0
1;4-1
1;4-2
2;5-1
2;5-2
100
80
60
40
20
0
0
1
2
3
4
5
6
Days
(B)
PIP1;4
Col-0
PIP2;5
Effect of PIP1;4 or PIP2;5 overexpression on the
transcript levels of endogenous PIP genes in
Arabidopsis plants under stress conditions
Root length (cm)
2
Col-0
1;4-1
1;4-2
2;5-1
2;5-2
1.5
1
0.5
0
0
3
6
9
Days
Fig. 5 Cold sensitivity of the transgenic plants expressing either
PIP1;4 or PIP2;5. (A) Germinations of the wild-type (Col-0) and
transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2) Arabidopsis plants were
measured following incubation at 10C. (B) Root length was
measured at the indicated days, and a representative photograph of
the seedlings incubated in a vertical orientation was taken at 7th day
after transfer to the 10C condition. Values are means ± SE obtained
from five independent experiments (n = 20–25)
123
plants under cold stress. No significant differences in stomatal resistance and transpiration were observed between
the wild-type and transgenic tobacco plants upon cold
stress treatment (Table 3).
Cell pressure probe measurements were conducted on
the transgenic tobacco plants under cold stress. Exposure of
the roots to cold stress (10C) drastically inhibited the
water permeability of cortical cells in the wild-type tobacco
plants, as revealed by the increase of Tw1/2 from ~1.4 s to
~8.0 s. In contrast, cortical cells in 35S::PIP1;4 and
35S::PIP2;5 transgenic plants had showed only a marginal
increase of Tw1/2 when subjected to the same cold stress
treatment (Table 3). The decreased water permeability of
the cells of the wild-type plants observed under cold stress
was recovered to the original value when the temperature
was increased back to 22C (data not shown). These results
suggest that the water permeability of cortical cells in the
wild-type plants was decreased by cold stress, whereas
cortical cells in 35S::PIP1;4 and 35S::PIP2;5 transgenic
plants still maintained high levels of water permeability
under cold stress. To better understand the effect of PIP1;4
or PIP2;5 overexpression on water transport under cold
stress, water transport through stems in the wild-type and
transgenic tobacco plants was investigated by sap flow
measurements under cold stress. As shown in Fig. 4B, the
amount of water transport at normal growth temperature at
a light intensity of 150 lE m–2 s–1 was similar between the
wild-type and transgenic plants. However, when the temperature of the growth medium was lowered to 10C, sap
flow in the wild-type plants decreased much faster and to a
lower level than those in the transgenic plants. It was
evident that the transgenic tobacco plants overexpressing
either PIP1;4 or PIP2;5 maintained much higher water
transport ability than the wild-type plants under cold stress.
It is likely that constitutive overexpression of a specific
aquaporin in a given plant may disturb the natural
expression patterns of endogenous aquaporin genes, which,
in turn, influences the different responses of transgenic
plants to various abiotic stresses. We therefore examined
whether the transcript levels of 13 PIP genes are modulated
by the overexpression of PIP1;4 or PIP2;5 in the transgenic
Arabidopsis plants under normal and stress conditions. As
shown in Fig. 6, the expression of PIPs was altered in
different manners by the overexpression of PIP1;4 or
PIP2;5 in Arabidopsis plants under different stress conditions. Transcript levels of the 13 PIPs were not noticeably
varied in the transgenic plants grown in normal MS medium; the expression of the PIPs in the transgenic plants was
Plant Mol Biol (2007) 64:621–632
629
Table 3 Effect of cold stress on water permeability, stomatal resistance, and transpiration in the wild-type and transgenic tobacco plants
(Tw1/2) (s)
Stomatal resistance (cm s–1)
Transpiration (lg cm–2 s–1)
Temperature (C)
Plant
22
Wild type
1.4 ± 0.4a
1.83 ± 0.52d
4.83 ± 1.60g
PIP1;4-1
1.0 ± 0.3a
1.65 ± 0.59d
4.90 ± 1.68g
PIP1;4-3
1.4 ± 0.3a
1.70 ± 0.65d
5.47 ± 2.64g
PIP2;5-1
1.1 ± 0.3a
1.23 ± 0.12d
6.32 ± 0.62g
PIP2;5-3
1.2 ± 0.4a
1.60 ± 0.46d
5.65 ± 1.86g
Wild type
8.0 ± 1.0b
2.69 ± 0.76df
3.34 ± 1.08gh
PIP1;4-1
2.0 ± 0.5a
1.74 ± 0.62d
5.23 ± 1.53g
PIP1;4-3
2.9 ± 0.7b
1.81 ± 0.77d
5.82 ± 1.40g
PIP2;5-1
1.8 ± 0.5a
1.49 ± 0.56d
6.53 ± 1.50g
PIP2;5-3
2.3 ± 0.8b
1.55 ± 0.18d
6.36 ± 0.69g
10
w
Half-times of water exchange (T 1/2), stomatal resistance, and transpiration were measured at 22C, and the temperature of the bath solution was
then gradually lowered to 10C over the course of approximately 30 min. Values are means ± SD (n = 6), and the different letters in each column
indicate statistically significant differences (P £ 0.05)
Expression (fold control)
(A)
3
Col-0
2
*
**
1;4-1
1;4-2
2;5-1
2;5-2
**
*
* * **
*
1
0
11
12
13
14
15
21
22
23
24
25
26
27
28
actin
28
actin
Expression (fold control)
(B)
3
Col-0
1;4-1
1;4-2
2;5-1
**** **
2
11
12
13
14
** ****
*
*
**
*
15
21
22
2;5-1
2;5-2
1
0
2;5-2
23
24
25
26
****
27
Expression (fold control)
(C)
3
Col-0
2
** **
1;4-1
1;4-2
* **
**
*
**
1
0
* **
*
** * *
***
**
*
11
12
13
14
15
21
22
23
24
25
26
27
28
actin
Fig. 6 Effect of PIP1;4 or PIP2;5 overexpression on the transcript
levels of 13 PIP genes in Arabidopsis plants under stress conditions.
The wild-type (Col-0) and transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2)
Arabidopsis plants were grown in MS medium for 7 days followed by
(A) 12-h of further incubation in MS medium, (B) 12-h of further
incubation at 4C, and (C) 12-h of further incubation in MS medium
supplemented with 200 mM mannitol. The expression of 13 PIP
genes was measured by quantitative real-time RT-PCR, and the plots
represent the relative expressions (fold) of each gene in the transgenic
plants compared with the expression in wild-type plants. The 11, 12,
13, etc, in x-axis represent PIP1;1, PIP1;2, PIP1;3, etc, respectively.
Values are means ± SE obtained from three independent experiments.
Asterisks above the columns indicate values that are statistically
different from control Col-0 values (P £ 0.05)
not varied more than 1.5-fold compared to the wild-type
plants (Fig. 6A). Because the nucleotide sequences of the
primers used in real-time RT-PCR analysis correspond to
the 3-UTR of PIP1;4 and PIP2;5 as described previously
(Jang et al. 2004), the expression levels of PIP1;4 and
PIP2;5 seem to be similar in the wild-type and overex-
123
630
pression transgenic plants. However, overexpression of
PIP1;4 and PIP2;5 in the transgenic plants was evident
(Fig. 1). When the transgenic plants were subjected to cold
stress at 4C for 12 h, transcript levels of several PIP genes
were marginally influenced in that the expression of
PIP1;4, PIP2;5, PIP2;6, and PIP2;7 in the 35S::PIP1;4
lines and PIP1;4, PIP1;5, PIP2;6, and PIP2;7 in the
35S::PIP2;5 lines increased slightly upon cold stress
treatment, whereas PIP2;2 was down regulated in the
transgenic plants compared with wild-type plants
(Fig. 6B). However, it was evident that transcript levels of
several PIP genes showed a much larger variation in the
transgenic Arabidopsis plants when subjected to osmotic
stress at 200 mM mannitol for 12 h. Expression of PIP1;5
and PIP2;8 increased, whereas transcript levels of PIP2;3
and PIP2;6 decreased in the transgenic plants compared
with wild-type plants under osmotic stress (Fig. 6C).
Similar patterns of PIP expression were observed when the
Arabidopsis plants were subjected to cold stress at 4C for
24 h or osmotic stress at 200 mM mannitol for 24 h (data
not shown). No significant changes were observed in the
transcript level of Actin (Fig. 6), thereby indicating that our
experimental conditions and real-time RT-PCR analysis
were valid, and had allowed us to adequately monitor the
changes in transcript levels in the samples.
Discussion
Despite the rapidly expanding field of literature on the
isolation, sequence determination, and regulation of aquaporins by environmental stimuli in various plant species,
reports demonstrating the functions of individual aquaporin
isoforms in plants under stress conditions are severely
limited. In the present study, we demonstrated that the
transgenic Arabidopsis and tobacco plants overexpressing
an aquaporin respond differently to various stress conditions. It was apparent that constitutive overexpression of
PIP1;4 or PIP2;5 delays seed germination and seedling
growth, and hampers sap flow under osmotic stress, while it
facilitates seed germination, sap flow, and water transport
under cold stress. Some controversial findings on the roles
of aquaporins under stress conditions were obtained using
transgenic Arabidopsis or tobacco plants expressing different types of aquaporins. Siefritz et al. (2002) demonstrated a beneficial effect of aquaporin on plants under
water stress. In contrast, Aharon et al. (2003) showed a
negative role of aquaporin during drought stress and a
positive effect of aquaporin on plant growth under favorable growth conditions. We showed here that overexpression of PIP1;4 or PIP2;5 had a negative effect on plant
growth under drought stress, but had no effect on plant
growth under favorable growth conditions (Figs. 2 and 3).
123
Plant Mol Biol (2007) 64:621–632
The observed drought-sensitive phenotypes of the
35S::PIP1;4 and 35S::PIP2;5 plants were closely correlated
with the water transport ability of aquaporins in plants
under stress conditions. We showed here that, under
dehydration stress, transgenic plants overexpressing PIP1;4
or PIP2;5 transferred less water, as deduced from their
lower transpiration, higher stomatal resistance, and lower
sap flow (Fig. 4A and Table 2). This reduced water status
during drought stress is closely related with the shorter
osmotic Lp of cortical cells, as indicated by shorter Tw1/2,
which suggests that the roots of the transgenic plants lost
water much faster than those of the wild-type plants under
dehydration stress. The relationship between the deleterious effect of PIP1;4 or PIP2;5 overexpression on plants
under drought stress and the natural function of this protein
is not simple, because the expression of PIP1;4 and PIP2;5
was stimulated by drought stress (Jang et al. 2004). It is
possible that the Arabidopsis PIP1;4 and PIP2;5 genes have
spatial and temporal patterns of expression and that their
induced expressions under drought stress are important,
specifically in the cells and developmental stages in which
they are expressed naturally. Since transgenic 35S::PIP1;4
and 35S::PIP2;5 plants express PIP1;4 and PIP2;5 constitutively, irrespective of their natural regulation, it is likely
that enhanced water transport via the plasma membranes of
cells may be deleterious under water stress. This result
appears to support the previous proposition that a general
increase in water transport in most plant tissues and cells is
harmful under drought stress (Aharon et al. 2003). However, it is noteworthy that overexpression of PIP1;4 or
PIP2;5 modulated the transcript levels of several other PIP
isoforms in the transgenic plants under osmotic stress
(Fig. 6C). The expressions of PIP1;5 and PIP2;8 that were
down regulated in Arabidopsis plants under dehydration
stress (Jang et al. 2004) increased in the transgenic plants
compared with wild-type plants under dehydration stress,
and the transcript levels of PIP2;3 and PIP2;6 that were
down regulated in Arabidopsis plants under dehydration
stress (Jang et al. 2004) decreased in the transgenic plants
compared with wild-type plants under dehydration stress.
The complex expression pattern of different aquaporins in
plants under water stress implies that maintenance of a
reasonable water status under drought stress requires both
increased water transport via aquaporins in some cells and
tissues and reduced water transport via aquaporins in other
cells and tissues as suggested by Comparot et al. (2000). In
addition to the interactive role of PIP1;4 and PIP2;5 in
modulating the expression of other PIP-type aquaporins in
Arabidopsis plants under dehydration stress, it is also
possible that overexpression of PIP1;4 or PIP2;5 influences
other transport activities in plasma membrane of cells,
which regulates aquaporin activity under stress conditions.
Cytosolic pH regulates gating of aquaporins (Tournaire-Roux
Plant Mol Biol (2007) 64:621–632
et al. 2003), and it is likely that H+-ATPases (AHA) play
roles in regulating cytosolic pH under stress conditions. In
our analysis, it was noted that, among the 12 AHAs in
Arabidopsis, the expression of AHA1, AHA3, AHA10, and
AHA11 was noticeably modulated by PIP1;4 or PIP2;5 in
Arabidopsis plants under dehydration stress but not under
cold stress (Supplemental Fig. S1). It is, therefore, proposed that the expression of a single aquaporin isoform
such as PIP1;4 and PIP2;5 influences the transcript levels
of other PIP-type aquaporins and H+-ATPases, and this
integrated regulation results in altered water status in
transgenic plants under dehydration stress.
The observed cold-resistant phenotypes of the
35S::PIP1;4 and 35S::PIP2;5 plants were also closely
correlated with the water transport ability of aquaporins in
plants under stress conditions. It was evident that, under
cold stress, the transgenic plants overexpressing PIP1;4 or
PIP2;5 transported more water, as deduced from shorter
Tw1/2 of cortical cells and higher sap flow (Table 3 and
Fig. 4B). It is believed that water fluidity decreases at low
temperatures, which results in lower water transport across
aquaporins. Therefore, it is likely that overexpression of
aquaporins helps the cells or tissues transport more water
under cold stress, which supports the previous notion that
aquaporins are needed for water flow during cold stress
(Sakr et al. 2003). Our observation that overexpression of
PIP2;5, the expression of which is highly stimulated in the
roots and aerial parts of Arabidopsis plants under cold
stress (Jang et al. 2004), had a positive effect on seed
germination and water transport under cold stress suggests
an important role of aquaporin in the water statuses of
plants in a low temperature condition. Overexpression of
PIP1;4, the expression of which is slightly up regulated in
the roots and down regulated in the aerial parts, also had a
positive effect, although not as significant as PIP2;5, on
water transport of tobacco plants under cold stress (Table 3
and Fig. 4B). Since we applied cold stress to the roots of
tobacco plants during sap flow and cell pressure probe
measurements, this result seems to correlate with the
expression pattern of PIP1;4, which shows slight up-regulation in the roots of Arabidopsis plants under cold stress.
However, it would be premature to come to a definitive
conclusion regarding the effect of PIP1;4 or PIP2;5 overexpression on cold stress because overexpression of PIP1;4
or PIP2;5 affected only germination and not seedling
growth of Arabidopsis and tobacco plants under cold stress.
It was noted that sap flow in the wild-type plants decreased
to a much lower level than that observed in the transgenic
tobacco plants during the early stage of cold treatment
(Fig. 4B), and sap flow in the wild-type plants was
recovered to higher level when the plants were maintained
for 24 h at low temperature (data not shown). These results
led us to propose that overexpression of an aquaporin
631
facilitates water transport and contributes to the maintenance of a proper water status during the early stage of cold
stress. It is not clear at this stage whether every aquaporin
isoform plays a similar role in water transport during cold
stress. Further analyses on other aquaporins such as PIP1;1,
PIP1;2, PIP1;5, PIP2;2, PIP2;3, and PIP2;4, the expression
of which was highly down regulated by cold stress (Jang
et al. 2004), are needed to completely understand the roles
and involvement of aquaporins in the plant response to cold
stress.
In conclusion, the present work provided novel information to increase our knowledge about the responses of
transgenic plants overexpressing an aquaporin to different
abiotic stress conditions. The observed drought-sensitive
and cold-resistant phenotypes of the transgenic plants are
closely correlated with the water transport ability of aquaporins in plants under stress conditions. Although it is
premature to conclude that these responses of transgenic
plants to different stress conditions are directed specifically
by PIP1;4 or PIP2;5, the present results emphasize the
importance of aquaporin-mediated water transport in response to environmental stresses, and provide a basis to
better understanding of the integrated functions of aquaporins under various physiological conditions.
Acknowledgements We thank Dr. M. Maeshima for anti-PAQs
antibody. This work was supported by the SRC program of MOST/
KOSEF (R11-2001-092-04002-0) to the Agricultural Plant Stress
Research Center of Chonnam National University.
References
Aharon R, Shahak Y, Wininger S, Bendov R, Kapulnik Y, Galili G
(2003) Overexpression of a plasma membrane aquaporin in
transgenic tobacco improves plant vigor under favorable growth
conditions but not under drought or salt stress. Plant Cell
15:439–447
Alexandersson E, Fraysse L, Sjövall-Larsen S, Gustavsson S, Fellert
M, Karlsson M, Johanson U, Kjellbom P (2005) Whole gene
family expression and drought stress regulation of aquaporins.
Plant Mol Biol 59:469–484
Bechtold N, Pelletier G (1998) In planta Agrobacterium-mediated
transformation of adult Arabidopsis thaliana plants by vacuum
infiltration. Methods Mol Biol 82:259–266
Blumwald E (2000) Sodium transport and salt tolerance in plants.
Curr Opin Cell Biol 12:431–434
Bohnert HJ, Nelson DE, Jensen RG (1995) Adaptation to environmental stress. Plant Cell 7:1099–1111
Boursiac Y, Chen S, Luu DT, Sorieul M, van den Dries N, Maurel C
(2005) Early effects of salinity on water transport in Arabidopsis
roots. Molecular and cellular features of aquaporin expression.
Plant Physiol 139:790–805
Chaumont F, Barrieu F, Wojcik E, Chrispeels MJ, Jung R (2001)
Aquaporins constitutes a large and highly divergent protein
family in maize. Plant Physiol 125:1206–1215
Comparot S, Morilon R, Badot PM (2000) Water permeability and
revolving movement in Phaseolus vulgaris L. Plant Cell Physiol
41:114–118
123
632
Cooper AJ (1975) Crop production in recirculating nutrient solution.
Sci Hort 3:251–258
Ding X, Iwasaki I, Kitagawa Y (2004) Overexpression of a lily PIP1
gene in tobacco increased the osmotic water permeability of leaf
cells. Plant Cell Environ 27:177–186
Gallois P, Marinho P (1995) Leaf disk transformation using
Agrobacterium tumefaciens-expression of heterologous genes
in tobacco. Methods Mol Biol 49:39–48
Hachez C, Zelazny E, Chaumont F (2006) Modulating the expression
of aquaporin genes in planta: a key to understand their
physiological functions? Biochim Biophys Acta 1758:1142–
1156
Jang JY, Kim DG, Kim YO, Kim JS, Kang H (2004) An expression
analysis of a gene family encoding plasma membrane aquaporins
in response to abiotic stresses in Arabidopsis thaliana. Plant Mol
Biol 54:713–725
Jauh GY, Thomas EP, Rogers JC (1999) Tonoplast intrinsic protein
isoforms as markers for vacuolar functions. Plant Cell 11:1867–
1882
Javot H, Lauvergeat V, Santoni V, Martin-Laurent F, Güçlü J, Vinh J,
Heyes J, Franck KI, Schäffner AR, Bouchez D, Maurel C (2003)
Role of a single aquaporin isoform in root water uptake. Plant
Cell 15:509–522
Johanson U, Karlsson M, Johansson I, Gustavsson S, Sjövall S,
Fraysse L, Weig AR, Kjellbom P (2001) The complete set of
genes encoding major intrinsic proteins in Arabidopsis provides
a framework for a new nomenclature for major intrinsic proteins
in plants. Plant Physiol 126:1358–1369
Johansson I, Karlsson M, Johanson U, Larsson C, Kjellbom P (2000)
The role of aquaporins in cellular and whole plant water balance.
Biochim Biophys Acta 1465:324–342
Kaldenhoff R, Grote K, Zhu J-J, Zimmermann U (1998) Significance
of plasmalemma aquaporins for water transport in Arabidopsis
thaliana. Plant J 14:121–128
Katsuhara M, Koshio K, Shibasaka M, Hayashi Y, Hayakawa T,
Kasamo K (2003) Over-expression of a barley aquaporin
increased the shoot/root ratio and raised salt sensitivity in
transgenic rice plants. Plant Cell Physiol 44:1378–1383
Kim JS, Kim YO, Ryu HJ, Kwak YS, Lee JY, Kang H (2003)
Isolation of stress-related genes of rubber particles and latex in
fig tree (Ficus carica) and their expressions by abiotic stress or
plant hormone treatments. Plant Cell Physiol 44:412–419
Lee SH, Chung GC, Steudle E (2005a) Gating of aquaporins by low
temperature in roots of chilling-sensitive cucumber and -tolerant
figleaf gourd. J Exp Bot 56:985–995
Lee SH, Chung GC, Steudle E (2005b) Low temperature and
mechanical stress differently gate aquaporins of root cortical
cells of chilling-sensitive cucumber and -resistant figleaf gourd.
Plant Cell Environ 28:1191–1202
Lian HL, Yu X, Ye Q, Ding X, Kitagawa Y, Kwak SS, Su WA, Tang
ZC (2004) The role of aquaporin RWC3 in drought avoidance in
rice. Plant Cell Physiol 45:481–489
Mariaux JB, Bockel C, Salamini F, Bartels D (1998) Desiccation- and
abscisic acid-responsive genes encoding major intrinsic proteins
(MIPs) from the resurrection plant Craterostigma plantagineum.
Plant Mol Biol 38:1089–1099
Martre P, Morillon R, Barrieu F, North GB, Nobel PS, Chrispeels MJ
(2002) Plasma membrane aquaporins play a significant role
during recovery from water deficit. Plant Physiol 130:2101–2110
123
Plant Mol Biol (2007) 64:621–632
Maurel C, Javot H, Lauvergeat V, Gerbeau P, Tournaire C, Santoni V,
Heyes J (2002) Molecular physiology of aquaporins in plants. Int
Rev Cytol 215:105–148
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue culture. Physiol Plant 15:473–497
Murata K, Mitsuoka K, Hirai T, Walz T, Agre P, Heymann JB, Engel
A, Fujiyoshi Y (2000) Structural determinants of water permeation through aquaporin-1. Nature 407:599–605
Ohshima Y, Iwasaki I, Suga S, Murakami M, Inoue K, Maeshima M
(2001) Low aquaporin content and low osmotic water permeability of the plasma and vacuolar membranes of a CAM plants
Graptopetalum paraguayense: Comparison with radish. Plant
Cell Physiol 42:1119–1129
Öquist G, Wass R (1988) A portable, microprocessor operated
instrument for measuring chlorophyll fluorescence kinetic in
stress philology. Physiol Plant 73:211–217
Quigley F, Rosenberg JM, Shachar-Hill Y, Bohnert HJ (2001) From
genome to function: the Arabidopsis aquaporins. Genome Biol
3:1–17
Sakr S, Alves G, Morillon R, Maurel K, Decourteix M, Guilliot A,
Fleurat-Lessard P, Julien J-L, Chrispeels MJ (2003) Plasma
membrane aquaporins are involved in winter embolism recovery
in walnut tree. Plant Physiol 133:630–641
Sakurai J, Ishikawa F, Yamaguchi T, Uemura M, Maeshima M (2005)
Identification of 33 rice aquaporin genes and analysis of their
expression and function. Plant Cell Physiol 46:1568–1577
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. A
laboratory manual. 2nd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor
Shulze ED, Hall AE, Landge OL, Walz H (1982) A portable steady
state porometer for measuring the carbon dioxide and water
vapour exchanges of leaves under natural conditions. Oecologia
53:141–145
Siefritz F, Tyree MT, Lovisolo C, Schubert A, Kaldenhoff R (2002)
PIP1 plasma membrane aquaporins in tobacco: from cellular
effects to function in plants. Plant Cell 14:869–876
Smart LB, Moskal WA, Cameron KD, Bennett AB (2001) MIP genes
are down-regulated under drought stress in Nicotiana glauca.
Plant Cell Physiol 42:686–693
Steudle E, Peterson CA (1998) How does water get through roots?. J
Ex Bo 49:775–788
Suga S, Komatsu S, Maeshima M (2002) Aquaporin isoforms
responsive to salt and water stresses and phytohormones in
radish seedlings. Plant Cell Physiol 43:1229–1237
Tournaire-Roux C, Sutka M, Javot H, Gout E, Gerbeau P, Luu D-T,
Bligny R, Maurel C (2003) Cytosolic pH regulates root water
transport during anoxic stress through gating of aquaporins.
Nature 425:393–397
Tyerman SD, Niemietz CM, Bramley H (2002) Plant aquaporins:
multifunctional water and solute channels with expanding roles.
Plant Cell Environ 25:173–194
Yu Q, Hu Y, Li J, Wu Q, Lin Z (2005) Sense and antisense expression
of plasma membrane aquaporin BnPIP1 from Brassica napus in
tobacco and its effects on plant drought resistance. Plant Sci
169:647–656
Zhu C, Schraut D, Hartung W, Schäffner AR (2005) Differential
responses of maize MIP genes to salt stress and ABA. J Exp Bot
56:2971–2981