Environ. Sci. Technol. 2006, 40, 1532-1539
Community Structure, Abundance,
and in Situ Activity of Nitrifying
Bacteria in River Sediments as
Determined by the Combined Use of
Molecular Techniques and
Microelectrodes
YOSHIYUKI NAKAMURA,†
HISASHI SATOH,‡
TOMONORI KINDAICHI,§ AND
S A T O S H I O K A B E * ,†
Department of Urban and Environmental Engineering,
Graduate School of Engineering, Hokkaido University,
North-13, West-8, Sapporo 060-8628, Japan, Department of
Environmental and Civil Engineering, Hachinohe Institute of
Technology Hachinohe, Aomori 031-8501, Japan, and
Department of Social and Environmental Engineering,
Graduate School of Engineering Hiroshima University, 1-4-1
Kagamiyama, Higashihiroshiama 739-8527, Japan
The community structure, spatial distributions, and in situ
activity of ammonia-oxidizing bacteria (AOB) representing
the Betaproteobacteria and nitrite-oxidizing bacteria
(NOB) representing the genus Nitrospira in three different
river sediments with different pollution sources and
levels along the Niida River, Hachinohe, Japan, were
investigated by the combined use of 16S rRNA genecloning analysis, real-time quantitative polymerase chain
reaction (RTQ-PCR) assays, and microelectrodes. The goal
of this research was to evaluate the contribution of
nitrifying activity in the sediment to the overall nitrogen
elimination rate in this river. The 16S rRNA gene-cloning
analysis revealed that the community structures of AOB and
Nitrospira-like NOB are present in three sediments. On
the basis of the results of 16S rRNA gene-cloning analysis,
the RTQ-PCR assay using a TaqMan probe was developed
and optimized for the quantification of the Nitrospiralike NOB. In the sediments, AOB specific 16S rRNA genes
were detected in the range of 106 to 107 copies/cm3 and
evenly distributed over the sampled sediment depth (0-5
mm), whereas the Nitrospira-like NOB 16S rRNA gene
copy numbers per cm3 were 1- 2 orders of magnitude higher
than the AOB copy numbers. Under light conditions,
intensive oxygenic photosynthesis occurred in the surface
and increased the maximal O2 concentration and O2
penetration depth in all sediments. This concomitantly
stimulated nitrifying bacteria present in diurnally anoxic
deeper zones and expanded nitrification zones, which
consequently increased the total NH4+ consumption rate
in the sediment (i.e., total NH4+ flux into the sediment). The
results suggested that the in situ nitrifying activity was
* Corresponding author tel.: +81-(0)11-706-6266; fax.: +81-(0)11-706-6266; e-mail: [email protected].
† Hokkaido University.
‡ Hachinohe Institute of Technology.
§ Hiroshima University.
1532
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 5, 2006
restricted mainly to the surface 2 mm of the sediment
and linked with photosynthetic activity, which obviously
plays an important role in nitrogen elimination in this river.
Introduction
The water quality deterioration of the Niida River flowing
through Hachinohe City, Japan mainly results from the
discharge of treated and untreated domestic and industrial
wastewater (point sources) and urban and agricultural runoff
(nonpoint sources). In addition, the downstream portion of
this river is located in a tidal area (i.e., estuary), where various
physical and chemical factors significantly fluctuate and
nutrient retention occurs due to tides. This further accelerates
the water quality deterioration. With respect to water quality
conservation and management, it is indispensable to understand and quantify the river self-purification capacity,
especially the elimination rate of nitrogen in this river. It is
expected that such dynamic changes in water quality along
the river significantly affect the diversity, abundance, and in
situ activity of ammonia-oxidizing bacteria (AOB) and nitriteoxidizing bacteria (NOB) in the river sediments, which
consequently determine the elimination rate of nitrogen (i.e.,
river self-purification capacity). However, information combining abundance with fine-scale distribution of nitrifying
bacteria with in situ nitrification activity in freshwater
sediments is scarce.
Some studies on the diversity and ecophysiology of AOB
in river sediments have been performed (1-5), but NOB has
been widely neglected. The diversity of AOB in the river
sediments has been investigated by a 16S rRNA gene-based
approach (5, 6). To quantitatively understand the nitrifying
activity in the river sediments, in situ NH4+ consumption
(1-3) and NO3- production (2, 3) rates in the river sediments
were measured by using microelectrodes and combined with
the abundance of AOB that was determined by fluorescence
in situ hybridization (FISH) techniques (2, 3). FISH is,
however, time consuming and difficult to use in sediments
due to the high background fluorescence. More recently, a
real-time quantitative polymerase chain reaction (RTQ-PCR)
assay was developed and applied to quantify AOB belonging
to the Betaproteobacteria in arable soils (7) and AOB and
Nitrospira-like NOB in activated sludge (8). The RTQ-PCR is
based on continuous monitoring of fluorescence intensity
throughout the PCR reaction. Therefore, this assay is a fast,
reliable, sensitive, and convenient method to enumerate a
low abundance of bacteria such as AOB and NOB in river
sediments.
The final goal of this research was to quantitatively
determine the contribution of the river sediment to the overall
nitrogen elimination rate in the Niida River. To achieve this
goal, we investigated the community structure, fine-scale
spatial distribution, and in situ activity of AOB representing
the Betaproteobacteria and NOB representing the genus
Nitrospira in sediments collected at three locations with
different pollution levels and sources along the Niida River
by the combined use of 16S rRNA gene-cloning analysis,
RTQ-PCR assay, and microelectrodes. The RTQ-PCR assay
using a TaqMan probe was developed and optimized for the
quantification of the Nitrospira-like NOB. In addition, the
effect of light on NH4+ consumption rates in the sediment
was investigated to understand the link between photosynthesis and nitrifying activity in the sediment. The genus
Nitrospira was chosen as a target NOB group in this study
since the Niida River downstream was greatly affected by the
10.1021/es051834q CCC: $33.50
 2006 American Chemical Society
Published on Web 01/25/2006
discharge of the treated and untreated domestic and
industrial wastewaters.
Materials and Methods
Sampling. River water and sediment samples were collected
at three different locations (point 1, point 2, and point 3)
along the Niida River, Hachinohe City, Japan. Point 1 (P1),
point 2 (P2), and point 3 (P3) were located approximately
8.0, 7.9, and 1.5 km from the river mouth, respectively (4).
River water samples were collected from August 2000 to
December 2002. The location P2 received effluent from a
wastewater treatment plant (WWTP) and agricultural runoff,
whereas P1 was apparently not influenced by any possible
point source. Sediment core samples were collected using
4 cm diameter Plexiglass tubes. The sediment and river water
(5 L) samples were immediately transferred to the laboratory
and were analyzed within 12 h.
DNA Extraction and PCR Amplification. Sediment core
samples were collected directly from an approximately 5 mm
depth of the sediment surface at two different positions of
each sampling site. DNA was extracted from each sediment
core sample (ca. 0.2 cm3) using a Fast DNA spin kit (Bio 101,
Qbiogene Inc., Carlsbad, CA) as described in the manufacturer’s instructions. To reduce the possible bias caused by
PCR amplification, the 16S rRNA gene was amplified in
triplicate tubes and then combined for the next cloning step.
The 16S rRNA gene fragments from the extracted total DNA
were amplified with Taq DNA polymerase (TaKaRa Bio Inc.,
Ohtsu, Japan) by using the AOB specific primer set CTO189fA/
B, CTO189fC, and CTO654r (10) as well as the Nitrospira-like
NOB specific primer set of NTSPAf (as shown in the following
section) and universal 1492r. The PCR condition used for
AOB was described previously by Hermansson and Lindgren
(7). The PCR condition used for Nitrospira-like NOB was as
follows: 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 60 °C
for 30 s, and 72 °C for 1 min. The final extension was carried
out for 5 min at 72 °C. PCR products were electrophoresed
on a 1% (wt/vol) agarose gel.
Cloning and Sequencing of the 16S rRNA Gene and
Phylogenetic Analysis. PCR products were ligated into a pCRXL-TOPO vector and transformed into ONE SHOT Escherichia
coli cells following the manufacturer’s instructions (TOPO
XL PCR cloning; Invitrogen). Partial sequencing of the 16S
rRNA gene inserts (about 400 bases for the AOB and
Nitrospira-like NOB) was performed using an automatic
sequencer (ABI Prism 3100 Avant Genetic Analyzer; Applied
Biosystems) with a BigDye terminator Ready Reaction kit
(Applied Biosystems). All sequences were checked for
chimeric artifacts by the CHECK_CHIMERA program in the
Ribosomal Database Project (11) and compared with similar
sequences of the reference organisms by a BLAST search
(12). Sequence data were aligned with the CLUSTAL W
package (13). Clones with more than 97% sequence similarity
were grouped into the same operational taxonomic unit
(OTU), and their sequences were used for phylogenetic
analysis. Phylogenetic trees were constructed using the
neighbor-joining method (14). Tree topology was also tested
using the maximum-parsimony method. Bootstrap resampling analysis for 100 replicates was performed to estimate
the confidence of the tree topologies.
Quantification of AOB and Nitrospira-Like NOB by RTQPCR. RTQ-PCR assays were performed to quantify AOB and
NOB specific 16S rRNA genes. The RTQ-PCR assay for AOB
was performed as described by Hermansson and Lindgren
(7) in a total volume of 25 µL with Universal PCR Master Mix
(PE Applied Biosystems), 7.5 pmol of a 2:1 ratio of primers
CTO 189fA/B and CTO189fC, 7.5 pmol of the reverse primer
RT1r, 3 pmol of TaqMan probe TMP1, and either 0.1 pg of
sample DNA or 10 to 108 copies per well of the standard
vector plasmid carrying ca. 1500 bp of Nitrosomonas europaea
16S rRNA gene. Since no amplifications of the dominant
Nitrospira spp. in our sediment samples were observed using
the previously reported primers specific for Nitrospira-like
NOB (9), the new primer sets (NTSPAf (5′-CGCAACCCCTGCTTTCAGT-3′) and NTSPAr (5′-CGTTATCCTGGGCAGTCCTT-3′) and TaqMan probe (NTSPATaq (5′-VIC and 3′TAMRA; CTACCGGGTCATGCCGAGCACT)) specific for the
Nitrospira-like NOB 16S rRNA genes were newly designed in
this study using the ARB software package and the Primer
Express software package provided by Applied Biosystems
(Foster city, CA). The RTQ-PCR assay for Nitrospira-like NOB
was performed in a total volume of 25 µL with Universal PCR
Master Mix (PE Applied Biosystems), 7.5 pmol of forward
primer NTSPAf and the reverse primer NTSPAr, 3 pmol of
TaqMan probe NTSPATaq, and either 0.1 ng of sample DNA
or 10 to 107 copies per well of the standard vector plasmid
carrying ca. 400 bp of 16S rRNA gene of Uncultured bacterium
A-4 (AF033559) related clone (P2-N20) obtained in this study.
All RTQ-PCR were performed in MicroAmp Optical 96-well
reaction plates with an optical cap (PE Applied Biosystems).
The template DNA in the reaction mixtures was amplified
and monitored with an ABI prism 7000 Sequence Detection
System (PE Applied Biosystems). The cycling regime was as
follows: hold for 2 min at 50 °C; hold for 10 min at 95 °C;
and 40 cycles for 15 s at 95 °C and 1 min at 60 °C. The detection
limits for AOB and Nitrospira-like NOB in this study were 2.7
× 10 and 1.6 × 102 copies per well, respectively, which
correspond to 6.7 × 104 and 4.0 × 104 copies/cm3 when the
sediment sample volume and DNA extraction step are taken
into account.
Microelectrode Measurements. Steady-state concentration profiles of O2, NH4+, and pH in the sediments were
measured in the laboratory using microelectrodes as described by Nakamura et al. (4). Clark-type microelectrodes
for O2 with a tip diameter of approximately 15 µm and a 90%
response time of shorter than 0.5 s were prepared and
calibrated as described by Revsbech (15). The LIX-type
microelectrodes for NH4+ and pH (16) were constructed,
calibrated, and used according to the protocol described by
Okabe et al. (16). The sediment samples were positioned in
a flow cell reactor for microelectrode measurements (4). Five
liters of the river water sampled at each sampling point was
fed to the reactor at an average liquid velocity of 2 cm/s for
the measurements of O2 concentration profiles. When NH4+
and pH concentration profiles were measured, a synthetic
medium was used to avoid interference with the LIX
microelectrodes. The synthetic medium consisted of NH4Cl
(50 µM), NaNO2 (40 µM), NaNO3 (100 µM), NaHPO4 (3000
µM), MgCl2‚6H2O (84 µM), CaCl2 (200 µM), and EDTA (270
µM). To analyze the P3-sediment, Na2SO4 (2000 µM) was
added to the synthetic medium to mimic the water quality
at P3. The pH was adjusted to about 7.5. The sediment was
incubated in the medium at 20 °C for more than 30 min
before measurements to ensure that steady-state profiles
were obtained. The details of microelectrode measurements
are described elsewhere (4). When O2 concentrations were
measured during light conditions, the sediment was illuminated at 1900 µmol photons/m2/s using a halogen lamp.
Calculation of Ammonia-Consumption Rate. Net volumetric NH4+ consumption rates (C(NH4+); µmol/cm3/h) in
the sediments were calculated from the average steady-state
concentration profiles using Fick’s second law of diffusion.
The details of this method were described previously by
Lorenzen et al. (1). The effective diffusion coefficient for NH4+
in the sediment (Ds) was calculated from the free solution
molecular diffusion coefficient (D0) for NH4+ and the sediment
porosity (Φ) according to Ullman and Aller (17). The D0 used
for the calculation was 1.23 × 10-5 cm2/s for NH4+ at 20 °C
(18).
VOL. 40, NO. 5, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
1533
TABLE 1. Summary of Physical and Chemical Parameters of
River Water and Sediments and Effective Diffusion
Coefficients of the Sediments at Points 1, 2, and 3 in the
Niida River, Hachinohe, Japana
parameters
point 1
point 2
point 3
NH4+ (µM)
NO2- (µM)
NO3- (µM)
SO42- (µM)
DOC (mg/L)
COD (mg/L)
BOD (mg/L)
DO (mg/L)
temperature (°C)
pH
salinity (%)
Overlaying water
3(4
115 ( 93
2(4
23 ( 51
110 ( 30
150 ( 50
136 ( 42
188 ( 65
4.9 ( 4.1
7.9 ( 5.9
2.1 ( 0.8
5.2 ( 2.9
3.0 ( 1.2
3.7 ( 2.2
10.1 ( 2.2
9.9 ( 1.9
12.3 ( 6.4
14.5 ( 7.0
7.5 ( 0.6
7.7 ( 0.3
0(0
0(0
35 ( 29
4 ( 16
166 ( 320
3151 ( 3182
9.9 ( 7.1
16.3 ( 8.0
4.4 ( 2.0
6.5 ( 1.7
16.3 ( 5.1
7.2 ( 0.4
0.23 ( 0.24
ignition loss
porosity
Ds; NH4+
Sediment
3.4 ( 0.5
2.5 ( 0.2
62.6 ( 6.3
50.8 ( 0.0
0.8
0.6
4.7 ( 0.4
59.6 ( 6.2
0.7
a
Values indicate averages ( standard deviations.
Analytical Methods. Chemical oxygen demand (CODMn),
biochemical oxygen demand (BOD), and dissolved organic
carbon (DOC) were analyzed according to standard methods
(19). The NH4+ and NO2- concentrations were colorimetrically
determined (19). The NO3- and SO42- concentrations were
determined using an ion chromatograph (HIC-6A; Shimadzu)
equipped with a Shim-pack IC-AI column. The samples for
NH4+, NO2-, NO3-, and SO42- were filtered through 0.2 µm
membrane filters before the analysis. Porosity and ignition
loss of the sediment was analyzed according to the protocol
described by Nakamura (4). Light intensity above the water
surface was measured by a quantum meter (Fujiwara
Scientific company, Japan). The O2 concentration and pH in
the surface water were directly determined using an O2 and
a pH electrode, respectively.
Nucleotide Sequence Accession Numbers. The GenBank/
EMBL/DDBJ accession numbers for the 16S rRNA gene
sequences of 24 clones used for the phylogenetic analysis
are AB239535 to AB239558.
Results and Discussion
Physical and Chemical Parameters of River Water. Physical
and chemical parameters (average values ( standard deviations) of river water and ignition losses of the sediments at
point 1, point 2, and point 3 are shown in Table 1. Inorganic
nitrogen compounds (NH4+, NO2-, and NO3-), DOC, COD,
and BOD concentrations at P2 were higher than those at P1.
This is because P2 received the effluent from a WWTP and
agricultural runoff. High SO42- concentration and salinity at
P3 can be explained by the fact that P3 was located in a tidal
area. The highest organic carbon (DOC and COD) concentrations at P3 were attributed to the discharges from the
factories of processed marine products located around the
river mouth and nutrient retention due to tides. Average
values of porosity and Ds for NH4+ in the P2 sediment were
lower than those in the P1 and P3 sediments (Table 1).
Community Structures of AOB. Two 16S rRNA gene clone
libraries were constructed from the sediment samples taken
from P2 and P3 to determine AOB community structures.
No chimeric sequence was observed in both clone libraries.
Fifty-three clones were randomly selected from each clone
library, and the partial sequences of approximately 400 bp
were analyzed. In total, the clones were grouped into 12 OTUs,
and their representative sequences were used for phylogenetic analysis (Figure 1). According to Purkhold et al. (20),
we classified AOB of the Betaproteobacteria into seven stable
1534
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 5, 2006
lineages (Nitrosomonas oligotropha, Nitrosomonas marina,
Nitrosomonas cryotoleransa, Nitrosomonas europaea/Nitrosococcus mobilis, Nitrosomonas communis, Nitrosomonas
sp. Nm143, and Nitrosospira briensis). The distributions of
the 53 clones obtained from both P2- and P3-sediments are
shown in Table 2. The most frequently detected clones (21
out of 53, detection frequency of 40%) in the P2-sediment
were closely related to Nitrosococcus mobilis (AJ298728) with
98-99% sequence similarity. The second frequently detected
clones (18 out of 53, detection frequency of 34%) were
affiliated with the Nitrosomonas oligotropha lineage. Nitrosococcus mobilis was originally isolated from brackish water
(22) and has been frequently detected in freshwater aquarium
systems (23) and in wastewater treatment plants (24). The
sampling point 2 (P2) was just located at the discharge site
of the municipal WWTP effluent, and the NH4+ concentration
was therefore relatively high. Thus, the AOB community
structure could be influenced by the wastewater effluent and
NH4+ concentration.
In the P3-sediment (located in a tidal area with a salinity
of approximately 0.2%), the most frequently detected clones
(18 out of 53, detection frequency of 34%) were affiliated
with the Nitrosomonas sp. Nm143 lineage, which consists of
estuarine (with a salinity of approximately 1.0%) and marine
isolates (20). The second frequently detected clones (9 out
of 53, detection frequency of 17%) were affiliated with the
N. marina lineage. Therefore, it is likely that the overlaying
water quality such as NH4+ concentration (or load) and
salinity are important selective factors for the dominant AOB
communities in these river sediments. This result is in good
agreement with the previous findings (5, 6).
An electrophoretic band was not observed from PCR
amplification using the same primer set in the P-1 sediment,
although PCR amplification was carried out under a variety
of PCR conditions (e.g., cycle numbers and template concentrations). This is probably because the absolute or relative
abundance of AOB was very low in the P1-sediment. In
addition, since the CTO654r primer has three mismatches
to several members of the N. communis cluster (25), all AOB
of the Betaproteobacteria could not be covered. Thus, the
presence of other AOB cannot be excluded in all three
sediments, especially in the P1-sediment. None of the
previously developed primers and FISH probes intended to
target all AOB of the Betaproteobacteria presently showed
both 100% specificity and 100% sensitivity (25). For comprehensive analysis of AOB community structure, phylogenetic analysis should be performed with multiple primer sets
(AOB-specific 16S rRNA and/or amoA-targeting primers) and
simultaneously combined with FISH analysis with multiple
probes.
Community Structures of Nitrospira-like NOB. Three
16S rRNA gene clone libraries were constructed from the
sediment samples taken from P1, P2, and P3 using the newly
designed Nitrospira-like NOB specific primer NTSPAf and
universal primer 1492r. No chimeric sequence was obtained.
Partial sequences of approximately 400 bp were analyzed
from 44, 48, and 47 clones randomly selected from the P1,
P2, and P3 clone libraries, respectively. The phylogenetic
analysis of the Nitrospira-like NOB community revealed that
the genus Nitrospira consisted of at least three lineages (N.
moscoviensis, N. marina, and Candidatus N. defluvii) as
previously reported by Daims et al. (21) (Figure 2). The
distributions of all clones obtained from the P1-, P2-, and
P3-sediments are shown in Table 3.
The majority of clones (17 out of 44; detection frequency
of 39%) obtained from the P1-sediment, a less polluted site,
were affiliated with the Nitrospira moscoviensis lineage. N.
moscoviensis was originally isolated from the corroded iron
pipe of a heating system (26, whereas clone sequences
belonging to the Candidatus N. defluvii and N. moscoviensis
FIGURE 1. Phylogenetic trees for AOB, showing the positions of the clones obtained from three different sediments. The tree was generated
by using about 400 bp of the 16S rRNA gene and the neighbor-joining method. Scale bar ) 5% sequence divergence. Parsimony bootstrap
values of 70 or greater are presented at the nodes (from 100 replicates). The first and second numbers indicate the sampling point and
the clone designation numbers. The numbers in a bracket are OTU clone numbers and total analyzed clone numbers. For example, P2-A40
(13/53) is ammonia-oxidizing bacteria clone number 40 detected from Point 2, and this OTU includes 13 clones out of 53 clones analyzed.
The N. marina sequence (X82559) served as the outgroup for rooting the tree.
lineages were both detected from the P2-sediment (a
wastewater effluent discharge site). This Candidatus N.
defluvii lineage consists of the uncultured bacterium clones
retrieved from a lab-scale nitrifying fluidized bed reactor fed
with synthetic media (27) and from real wastewater treatment
plants treating high strength animal wastes and domestic
wastewater (24).
In this study, the genus Nitrospira was chosen and
analyzed as a representative of NOB population in the
sediments because Nitrospira-like 16S rRNA gene sequences,
but not Nitrobacter, have been retrieved from the same
sediment before due to probably the discharge of the treated
and untreated domestic and industrial wastewaters, in which
the genus Nitrospira was a dominant NOB population. In
addition, Nitrospira was also reported as key NOB in
freshwater systems by other researchers (3, 21, 28). However,
the genus Nitrobacter was present in the same order of
magnitude as AOB in river water (6). Therefore, the presence
of other NOB, such as Nitrobacter spp. belonging to the class
Alphaproteobacteria, Nitrospina spp. belonging to the class
Deltaproteobacteria, and Nitrococcus spp. belonging to the
class Gammaproteobacteria, cannot be excluded. Since the
coverage of Nitrospira-like NOB clone libraries is low, we
could not draw a clear conclusion about the correlation
between the environment factors (i.e., water quality) and
the dominant clone sequences of Nitrospira-like NOB in the
sediments. Further studies on identification and enumeration
of these other NOB species are needed to fully understand
the NOB community in the sediment.
Vertical Distributions of AOB and Nitrospira-like NOB
in the Sediments. Average total DAPI counts in the surface
(0-5 mm) of the P1-, P2-, and P3-sediments were 5.0 ( 0.8
× 1010, 4.3 ( 1.4 × 1010, and 11.8 ( 1.5 × 1010 cells/cm3,
respectively. The vertical distributions of AOB and Nitrospiralike NOB in the P1-, P2-, and P3-sediments were quantified
by RTQ-PCR assay (Figure 3). The AOB specific 16S rRNA
gene copy numbers in the P2- and the P3-sediments were
in the range of 106 to 107 copies/cm3 and remained relatively
unchanged along the depth. The AOB specific 16S rRNA gene
copy number in the P1-sediment was below the detection
limit (6.7 × 104 copies/cm3) (Figure 3A), which is in agreement
with the result of 16S rRNA gene-cloning analysis. The
Nitrospira-like NOB 16S rRNA gene copy numbers were the
highest (1.0-1.7 × 109 copies/cm3) in the P2-sediment (Figure
3B), where the higher inorganic nitrogen (NH4+ and NO2-)
concentrations were detected (Table 1). The Nitrospira-like
VOL. 40, NO. 5, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
1535
TABLE 2. Detection Frequency and Phylogenetic Relatives of the AOB Clones Analyzed at Three Different Points
lineage
number of clones
nearest species or clones
Total
N. oligotropha lineage
uncultured Nitrosomonas sp. 26Ft (AF527015)
uncultured bacterium clone AZP2-2 (AY186220)
uncultured Nitrosomonas sp. 21Fb (AF527014)
unidentified Betaproteobacterium Vm4 (AJ003756)
N. marina lineage
uncultured bacterium clone AZP2-8 (AY186222)
uncultured Nitrosomonas 50Ft (AF527002)
N. mobilis lineage
uncultured ammonia-oxidizing bacteria clone SP6 (AF510864)
N. europaea ATCC 19718 (BX321856)
Nitrosomonas sp. Nm143 lineage
uncultured ammonia-oxidizing bacterium clone B8s180r (AB212150)
Other Nitrosomonas lineage
unidentified bacterium clone Neu2P3-86 (AJ518355)
unidentified Betaproteobacterium Dr17 (AJ003780)
other Betaproteobacteria
P1
P2
P3
ND
53
53
13
1
4
2
98-100
99
97
98-99
9
98
98-100
1
99-100
99-100
18
98-99
2
1
20
100
98
1
21
1
12
similarity (%)
FIGURE 2. Phylogenetic trees for Nitrospira-like NOB, showing the positions of the clones obtained from three different sediments. The
tree was generated by using about 400 bp of the 16S rRNA gene and the neighbor-joining method. Scale bar ) 5% sequence divergence.
Parsimony bootstrap values of 70 or greater are presented at the nodes (from 100 replicates). The first and second numbers indicate the
sampling point and the clone designation number. The numbers in a bracket are OTU clone numbers and total analyzed clone numbers.
For example, P2-N34 (1/48) is nitrite-oxidizing bacteria clone number 34 detected from Point 2, and this OTU includes 1 clone out of 48
clones analyzed. The N. oligotropha sequence (AJ298736) served as the outgroup for rooting the tree.
NOB 16S rRNA gene copy numbers in the P3-sediment were
detected in the range of 106 to 107 copies/cm3 with highest
copy numbers of 4.7 × 107 copies/cm3 at the outermost
surface (Figure 3C).
It is difficult to directly convert 16S rRNA operon copy
numbers to cell numbers because the 16S rRNA operon
numbers per genome of most AOB and NOB, except N.
europaea, are not presently known and AOB and NOB have
different 16S rRNA operon copy numbers from species to
species (29). If we now assume that AOB have one 16S rRNA
1536
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 5, 2006
copy on average, since N. europaea NBRC 14298 carries one
16S rRNA copy (29), the AOB cell density was in the range
from 106 to 107 cells/cm3 in the P2- and P3-sediments. This
range was comparable to the FISH counts previously reported
in the literature (2, 3). On the other hand, the abundance of
NOB were 1-2 orders of magnitude higher than those of
AOB, if we assumed that Nitrospira sp. has also one 16S
rRNA operon copy number per genome (8, 30). This range
is in agreement with the general observation that the number
of NOB was 3-30 times higher than that of AOB in sediments
TABLE 3. Detection Frequency and Phylogenetic Relatives of the Nitrospira-like NOB Clones Analyzed at Three Different Points
lineage
number of clones
nearest species or clones
P1
P2
P3
Total
N. moscoviensis lineage
uncultured bacterium clone CCU23 (AY221079)
uncultured Nitrospira clone 1013-28-CG50 (AY532585)
Nitrospira sp. strain GC86 (Y14644)
Candidatus Nitrospira defluvii lineage
uncultured bacterium A-4 (AF033559)
Other Nitrospira lineage
uncultured bacterium clone T26-15 (AF332301)
uncultured bacterium Q3-6C17 (AY048892)
uncultured bacterium GKS2-218 (AJ290043)
other bacteria
44
48
47
10
6
1
1
1
7
1
7
1
1
31
97-100
97-99
97-99
96-99
1
26
similarity (%)
1
44
97-99
92
90
FIGURE 3. Mean values ( standard deviations for 16S rRNA gene copy numbers of AOB in the class of Betaproteobacteria and Nitrospiralike NOB in the P1-sediment (A), P2-sediment (B), and P3-sediment (C) using RTQ-PCR (n ) 3).
(31), nitrifying aggregates (32), and biofilms (6). However,
the comparisons should be treated with caution since the
different enumeration methods (e.g., sample preparation,
DNA extraction, and quantification) and different systems
were used in the previous studies.
The vertical distributions of AOB and Nitrospira-like NOB
were relatively unchanged along depth in all sediments. This
is probably because the river current, the discharge of
wastewater effluent, and tides induced resuspension, mixing,
and redeposition of sediment particles, resulting in the even
distributions of AOB and Nitrospira-like NOB in the surface
(0-5 mm) of the sediments. In addition, since the PCR-based
assay was used to quantify the abundances of AOB and
Nitrospira-like NOB in this study, DNA of both live and dead/
inactive cells could be amplified and detected, whereas only
nitrifiers that maintain a relatively high ribosome content
(i.e., relatively active cells) are detectable with FISH. This
could be one of the reasons why the decrease in the AOB and
NOB cell numbers with depth was found in the literature (3).
For the RTQ-PCR assay, we used the newly designed
Nitrospira-like NOB specific NTSPAf and NTSPAr primers in
addition to TaqMan probe (NTSPATaq). This combination
of PCR primer and TaqMan probe has at least four mismatches with nontarget bacteria sequences, respectively. The
specificity of this primer and probe combination was further
empirically evaluated by RTQ-PCR using plasmid DNAs
containing target and nontarget 16S rRNA genes obtained
from the P1-, P2-, and P3-sediments (Table 2). The RTQ-PCR
analysis for target clones including the clones belonging to
the N. moscoviensis lineage and the N. marina lineage resulted
in the detection of 105 to 106 target copies per PCR. On the
other hand, no significant amplification was observed for
nontarget 16S rRNA genes (data not shown). The same
evaluation was also performed for the primer sets of
CTO189fA/ B, CTO189fC, and RT1r for AOB, and no ampli-
fication was detected for nontarget AOB 16S rRNA genes.
However, the possibility of underestimating AOB specific
16S rRNA gene copy numbers cannot be excluded since
several members of AOB of the Betaproteobacteria, especially
the N. oligotropha cluster, have several mismatches with the
CTO189fA/B and CTO189fC primers (25). Hence, for a sample
where the AOB belonging to the N. oligotropha cluster are
abundant, the number of AOB would be underestimated.
This would be the case in the P1-sediment and also influence
the results in the P2- and P3-sediments.
Concentration Profiles in the Sediment. Steady-state
concentration profiles of O2, NH4+, and pH and spatial distributions of net volumetric NH4+ consumption rate, C(NH4+),
in the P1-, P2-, and P3-sediments under dark conditions are
shown in Figure 4A-C. Oxygen penetrated 1.0 mm into the
P1-sediment (Figure 4A), and the NH4+ consumption was
restricted to the permanently oxic surface zone (0- 1.0 mm)
with the highest NH4+ consumption rate of 0.3 µmol/cm3/h.
In the P2-sediment, O2 penetrated 2.3 mm into the sediment.
The NH4+ concentration decreased in this oxic zone but
gradually increased below 1.0 mm due to the mineralization
of organic matter (Figure 4B). The net volumetric NH4+
consumption rate was, therefore, high especially in the upper
0.4 mm with the maximum value of 1.4 µmol/cm3/h at a
depth of 0.2 mm. In the P3-sediment, no significant NH4+
consumption was found mainly due to the simultaneous
NH4+ production by mineralization (Figure 4C).
In situ NH4+ oxidation activity was restricted mainly to
the surface 2 mm of the sediment. However, the river current
and tides can periodically disturb the sediment surface in
the field. Therefore, the exclusion of the surface disturbance
effect in our microelectrode measurements may have biased
the obtained rates and made it difficult to link the in situ
nitrifying activity with the vertical distribution of AOB and
Nitrospira-like NOB in the sediment.
VOL. 40, NO. 5, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
1537
NH4+ consumption zones in all sediments. The depthintegrated C(NH4+) (i.e., total NH4+ flux), therefore, increased
by 170% (0.010 to 0.017 µmol/cm2/h) in the P1-sediment,
118% (0.044 to 0.052 µmol/cm2/h) in the P2-sediment, and
266% (0.003 to 0.008 µmol/cm2/h) in the P3-sediment,
respectively, as compared with those under the dark conditions. Since the NH4+ concentration profiles measured with
microelectrodes are the net profiles, it is difficult to evaluate
the exact contribution of microbial nitrification to the overall
NH4+ consumption because NH4+ assimilation by photosynthesis and NH4+ production by mineralization cannot be
exactly estimated.
In summary, this is the first evidence that the in situ
abundance and distribution of nitrifying bacteria in freshwater sediments under dark and light conditions were
determined with sufficiently high spatial resolution and
combined with fine-scale in situ activity profiles. The results
suggested that the in situ nitrifying activity was restricted
mainly to the surface 2 mm of the sediment and linked with
photosynthetic activity, which obviously plays an important
role in nitrogen elimination in this river. However, further
studies combining phylogenetic analysis of 16S rRNA genes
with multiple PCR primers and FISH analysis are needed to
fully understand the community structures of AOB and NOB
populations in the sediment.
Acknowledgments
This work was partially supported by a grant-in-aid (13650593)
for developmental scientific research from the Ministry of
Education, Science and Culture of Japan. Y.N. is supported
by a research fellowship from the Japan Society for the
Promotion of Science.
Literature Cited
FIGURE 4. Steady-state concentration profiles of O2, NH4+ and pH,
and NH4+ consumption rates in the P1-sediment (A and D), P2sediment (B and E), and P3-sediment (C and F) under the dark (AC) and light (D-F) conditions. Zero on the horizontal axis corresponds
to the sediment surface.
Cell-Specific NH4+ Oxidation Rate. If we assume that
AOB have one 16S rRNA copy, the cell-specific NH4+ oxidation
rates in the surface 0- 1.0 mm sediment can be calculated
from C(NH4+) and AOB cell density in the permanently oxic
zones of the sediment under the dark condition to be 34.6
and 0.5 fmol/cell/h at the P2- and P3-sediments, respectively.
These cell-specific NH4+ oxidation rates in the P2- and P3sediments are about at the upper and lower ends of rates
found in the literature (1.3- 8 fmol/cell/h (3) and 1-30 fmol/
cell/h (9), respectively). The cell-specific NH4+ oxidation rate
in the P3-sediment was lower than those in other sediments.
This is probably because the AOB might be outcompeted for
O2 by heterotrophic bacteria due to high organic carbon
concentrations (4, 33). In addition, these AOB cell-specific
NH4+ oxidation rates could be underestimated due to the
simultaneous NH4+ production by mineralization.
Effect of Photosynthesis. After the microelectrode measurements under dark conditions, steady-state concentration
profiles were also measured under light conditions to evaluate
the effect of light on NH4+ removal efficiency in freshwater
sediments (Figure 4D-F). Under light conditions, the O2
concentrations and pH significantly increased in the sediment
surfaces due to activation of oxygenic photosynthesis,
resulting in the increase in the maximal O2 concentration
(up to 270 µM) and O2 penetration depth in all sediments.
This stimulated nitrifying bacteria (AOB and NOB) present
in the diurnally anoxic deeper zone, where high abundances
of both AOB and Nitrospira-like NOB were present (Figure
3). This consequently increased C(NH4+) and expanded the
1538
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 5, 2006
(1) Lorenzen, J.; Larsen, L. H.; Kjr, T.; Revsbech, N. P. Biosensor
determination of the microscale distribution of nitrate, nitrate
assimilation, nitrification, and denitrification in a diatominhabited freshwater sediment. Appl. Environ. Microbiol. 1998,
64, 3264-3269.
(2) Altmann, D.; Stief, P.; Amann, R.; de Beer, D. Nitrification in
freshwater sediments as influenced by insect larvae: quantification by microsensor and fluorescence in situ hybridization.
Microbial Ecol. 2004, 48, 145-153.
(3) Altmann, D.; Stief, P.; Amann, R.; de Beer, D.; Schramm, A. In
situ distribution and activity of nitrifying bacteria in freshwater
sediment. Environ. Microbiol. 2003, 5, 798-803.
(4) Nakamura, Y.; Satoh, H.; Okabe, S.; Watanabe, Y. Photosynthesis
in sediments determined at high spatial resolution by the use
of microelectrodes. Water Res. 2004, 38, 2439-2447.
(5) Cébron, A.; Coci, M.; Garnier, J.; Laanbroek, H. J. Denaturing
gradient gel electrophoretic analysis of ammonia-oxidizing
bacterial community structure in the lower Seine River: impact
of Paris wastewater effluents. Appl. Environ. Microbiol. 2004,
70, 6726-6737.
(6) Cébron, A.; Berthe, T.; Garnier, J. Nitrification and nitrifying
bacteria in the lower Seine River and estuary (France). Appl.
Environ. Microbiol. 2003, 69, 7091-7100.
(7) Hermansson, A.; Lindgren, P. E. Quantification of ammoniaoxidizing bacteria in arable soil by real-time PCR. Appl. Environ.
Microbiol. 2001, 67, 972-976.
(8) Harms, G.; Layton, A. C.; Dionisi, H. M.; Gregory, I. R.; Garrett,
V. M.; Hawkins, S. A.; Robinson, K. G.; Sayler, G. S. Real-Time
PCR quantification of nitrifying bacteria in a municipal wastewater treatment plant. Environ. Sci. Technol. 2003, 37, 343351.
(9) Dionisi, H. M.; Harms, G.; Layton, A. C.; Gregory, I. R.; Parker,
J.; Hawkins, S. A.; Robinson, K. G.; Sayler, G. S. Power analysis
for real-time PCR quantification of genes in activated sludge
and analysis of the variability introduced by DNA extraction.
Appl. Environ. Microbiol. 2003, 69, 6597-6604.
(10) Kowalchuk, G. A.; Stephen, J. R.; De Boer, W.; Prosser, J. I.;
Embley, T. M.; Woldendorp, J. W. Analysis of ammonia-oxidizing
bacteria of the β subdivision of the class Proteobacteria in coastal
sand dunes by denaturing gradient gel electrophoresis and
sequencing of PCR-amplified 16S ribosomal DNA fragments.
Appl. Environ. Microbiol. 1997, 63, 1489-1497.
(11) Maidak, B. L.; Olsen, G. L.; Larsen, N.; Overbeek, R.; McCaughey,
M. J.; Woese, C. R. The RDP (Ribosomal Database Project).
Nucleic Acids Res. 1997, 25, 109-110.
(12) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J.
Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403410.
(13) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties, and weight matrix choice. Nucleic Acids Res. 1994,
22, 4673-4680.
(14) Saito, N.; Nei, M. The neighbor-joining method: a new method
for constructing phylogenetic trees. Mol. Biol. Evol. 1987, 4,
406-425.
(15) Revsbech, N. P. An oxygen microelectrode with a guard cathode.
Limnol. Oceanogr. 1989, 34, 474-478.
(16) Okabe, S.; Satoh, H.; Watanabe, Y. In situ analysis of nitrifying
biofilms as determined by in situ hybridization and the use of
microelectrodes. Appl. Environ. Microbiol. 1999, 65, 3182-3191.
(17) Ullman, W. J.; Aller, R. C. Diffusion coefficients in nearshore
marine sediments. Limnol. Oceanogr. 1982, 27, 552-556.
(18) Andrussow, L. D. Landolt-Bornstein zahlenwerte und functionen,
Vol. II/5a; Borchers, H., Hauser, H., Hellwege, K. H., Schafer, K.,
Schmidt, E., Eds.; Springer: Berlin, 1969.
(19) Apha, A. W. Standard methods for the examination of water and
wastewater, 20th ed.; American Public Health Association,
Washington, DC, 1998.
(20) Purkhold, U.; Wagner, M.; Timmermann, G.; Röser, A. P.; Koops,
H. P. 16S rRNA and amoA-based phylogeny of 12 novel
betaproteobacterial ammonia-oxidizing isolates: extension of
the dataset and proposal of a new lineage within the nitrosomonads. Int. J. Syst. Evol. Microbiol. 2003, 53, 1485-1494.
(21) Daims, H.; Nielsen, J. L.; Nielsen, P. H.; Schleifer, K.; Wagner,
M. In Situ characterization of Nitrospira-like nitrite-oxidizing
bacteria active in wastewater treatment plants. Appl. Environ.
Microbiol. 2001, 67, 5273-5284.
(22) Koops, H.-P.; Harms, H.; Wehrman, H. Isolation of a moderate
halophilic ammonia-oxidizing bacterium, Nitrosococcus mobilis
nov. sp. Arch. Microbiol. 1976, 107, 277-282.
(23) Burrell, C. P.; Phalen, C. M.; Hovanec, T. A. Identification of
bacteria responsible for ammonia oxidation in freshwater
aquaria. Appl. Environ. Microbiol. 2001, 67, 5791-5800.
(24) Juretschko, S.; Timmermann, G.; Schmid, M.; Schleifer, K. H.;
Röser, A. P.; Koops, H. P.; Wagner, M. Combined molecular and
conventional analyses of nitrifying bacterium diversity in
activated sludge: Nitrosococcus mobilis and Nitrospira-like
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
bacteria as dominant populations. Appl. Environ. Microbiol.
1998, 64, 3042-3051.
Purkhold, U.; Pommerening-Roser, A.; Juretschko, S.; Schmid,
M. C.; Koops, H.-P.; Wagner, M. Phylogeny of all recognized
species of ammonia oxidizers based on comparative 16S rRNA
and amoA sequence analysis: Implications for molecular
diversity surveys. Appl. Environ. Microbiol. 2000, 66, 53685382.
Ehrich, S.; Behrens, D.; Lebedeva, E.; Ludwing, W.; Bock, E. A
new obligately chemolithotrophic, nitrite-oxidizing bacterium,
Nitrospira moscoviensis sp. nov. and its phylogenetic relationship. Arch. Microbiol. 1995, 164, 16-23.
Schramm, A.; de Beer, D.; Wagner, M.; Amann, R. Identification
and activities in situ of Nitrosospira and Nitrospira spp. as
dominant populations in a nitrifying fluidized bed reactor. Appl.
Environ. Microbiol. 1998, 64, 3480-3485.
Hovanec, T. A.; Taylor, L. T.; Blakis, A.; Delong, E. F. Nitrospiralike bacteria associated with nitrite oxidation in freshwater
aquaria. Appl. Environ. Microbiol. 1998, 64, 258-264.
Klappenbach, J. A.; Saxman, P. R.; Cole, J. R.; Schmidt, T. M.
rrndb: the ribosomal RNA operon copy number database.
Nucleic Acids Res. 2001, 29, 181-184.
Dionisi, H. M.; Layton, A. C.; Harms, G.; Gregory, I. R.; Robinson,
K. G.; Sayler, G. S. Quantification of Nitrosomonas oligotrophalike ammonia-oxidizing bacteria and Nitrospira spp. from fullscale wastewater treatment plants by competitive PCR. Appl.
Environ. Microbiol. 2002, 68, 245-253.
Smorczewski, W. T.; Schmidt, E. L. Numbers, activities, and
diversity of autotrophic ammonia-oxidizing bacteria in a
freshwater, eutrophic lake sediment. Can. J. Microbiol. 1991,
37, 828-833.
Schramm, A.; de Beer, D.; van den Heuvel, J. C.; Ottengraf, S.;
Amann, R. Microscale distribution of populations and activities
of Nitrosospira and Nitrospira spp. along a macroscale gradient
in a nitrifying bioreactor: quantification by in situ hybridization
and the use of microsensors. Appl. Environ. Microbiol. 1999,
65, 3690-3696.
Okabe, S.; Hirata, K.; Ozawa, Y.; Watanabe, Y. Spatial microbial
distributions of nitrifiers and heterotrophs in mixed-population
biofilms. Biotechnol. Bioeng. 1996, 50, 24-35.
Received for review September 16, 2005. Revised manuscript
received December 17, 2005. Accepted December 20, 2005.
ES051834Q
VOL. 40, NO. 5, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
1539