Transient Receptor Potential Vanilloid 4 –Mediated
Disruption of the Alveolar Septal Barrier
A Novel Mechanism of Acute Lung Injury
Diego F. Alvarez, Judy A. King, David Weber, Emile Addison, Wolfgang Liedtke, Mary I. Townsley
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Abstract—Disruption of the alveolar septal barrier leads to acute lung injury, patchy alveolar flooding, and hypoxemia.
Although calcium entry into endothelial cells is critical for loss of barrier integrity, the cation channels involved in this
process have not been identified. We hypothesized that activation of the vanilloid transient receptor potential channel
TRPV4 disrupts the alveolar septal barrier. Expression of TRPV4 was confirmed via immunohistochemistry in the
alveolar septal wall in human, rat, and mouse lung. In isolated rat lung, the TRPV4 activators 4␣-phorbol-12,13didecanoate and 5,6- or 14,15-epoxyeicosatrienoic acid, as well as thapsigargin, a known activator of calcium entry via
store-operated channels, all increased lung endothelial permeability as assessed by measurement of the filtration
coefficient, in a dose- and calcium-entry dependent manner. The TRPV antagonist ruthenium red blocked the
permeability response to the TRPV4 agonists, but not to thapsigargin. Light and electron microscopy of rat and mouse
lung revealed that TRPV4 agonists preferentially produced blebs or breaks in the endothelial and epithelial layers of the
alveolar septal wall, whereas thapsigargin disrupted interendothelial junctions in extraalveolar vessels. The permeability
response to 4␣-phorbol-12,13-didecanoate was absent in TRPV4⫺/⫺ mice, whereas the response to thapsigargin
remained unchanged. Collectively, these findings implicate TRPV4 in disruption of the alveolar septal barrier and
suggest its participation in the pathogenesis of acute lung injury. (Circ Res. 2006;99:988-995.)
Key Words: permeability 䡲 TRP channels 䡲 TRPV4 䡲 acute lung injury
operated Ca2⫹ channels in lung endothelium.16 –18 In the
isolated rat lung, the permeability response to thrombininduced store depletion was attenuated in TRPC4⫺/⫺ mice.18
Furthermore, loss of the permeability response to
thapsigargin-induced store depletion in rat lung after heart
failure was associated with downregulation of TRPC1 and
TRPC4, channels which are normally expressed in extraalveolar endothelium.19 Retention of the permeability response
to 14,15-epoxyeicosatrienoic acid (14,15-EET), a P450 epoxygenase-derived arachidonic acid metabolite, in this heart
failure model was intriguing because the permeability responses to both thapsigargin-induced store depletion and to
14,15-EET are dependent on Ca2⫹ entry. This striking observation drives home the point that EETs must target Ca2⫹ entry
pathways in lung endothelium distinct from store-operated
channels.
We propose that Ca2⫹ entry via TRPV4, a member of the
vanilloid subfamily of TRP channels,13,20 –24 contributes critically to regulation of endothelial permeability and barrier
integrity in the lung. This hypothesis is based on several
observations: 5,6-EET and 8,9-EET have been linked to
activation of TRPV4 and subsequent Ca2⫹ entry in aortic
A
cute lung injury and its more severe form the adult
respiratory distress syndrome are characterized by disruption of the alveolar septal barrier, leading to patchy
alveolar flooding and hypoxemia.1 Effective clinical treatments are limited and mortality remains high.2,3 Such endothelial barrier disruption is often dependent on entry of Ca2⫹
from the extracellular space.4,5 For example, in the intact rat
lung, thapsigargin-induced store depletion and Ca2⫹ entry via
store-operated channels increase endothelial permeability.6,7
Store depletion targets extraalveolar vessel endothelium,
although the septal microvasculature appears to be spared.7,8
Although endothelial cells derived from extraalveolar pulmonary arteries and septal microvessels are phenotypically
distinct9,10 and both could potentially be targeted in acute
lung injury, disruption of the septal barrier is more likely to
promote alveolar flooding and impair gas exchange than
disruption in extraalveolar vessels. Importantly, Ca2⫹ entry
pathways involved in regulation of barrier integrity in the
alveolar septal compartment have not been elucidated.
The consensus of data suggests that TRPC1 and TRPC4,
members of the canonical subfamily of transient receptor
potential (TRP) channels,11–15 comprise subunits of store-
Original received May 17, 2006; revision received August 16, 2006; accepted September 14, 2006.
From the Departments of Physiology (D.F.A., D.W., E.A., M.I.T.), Pharmacology (J.A.K.), and Pathology (J.A.K.) and Center for Lung Biology
(D.F.A., J.A.K., M.I.T.), University of South Alabama, Mobile; and Departments of Medicine, Neurology, and Neurobiology (W.L.), Duke University,
Durham, NC.
Correspondence to Mary I. Townsley, PhD, Department of Physiology, Center for Lung Biology, MSB 3074, 307 University Blvd, University of South
Alabama, Mobile, AL 36688. E-mail [email protected]
© 2006 American Heart Association, Inc.
Circulation Research is available at http://circres.ahajournals.org
DOI: 10.1161/01.RES.0000247065.11756.19
988
Alvarez et al
TRPV4-Mediated Alveolar Septal Barrier Disruption
endothelial cells,25,26 5,6-EET and 14,15-EET increase endothelial permeability in rat and canine lung,6,27 and the permeability response to 14,15-EET, at least, is dependent on entry
of extracellular Ca2⫹.6 In the current study, we tested the
hypothesis that Ca2⫹ entry via TRPV4 regulates lung endothelial permeability and barrier integrity. Furthermore, we
tested whether Ca2⫹ entry via TRPV4 and that occurring
through store-operated channels evoke barrier disruption in
spatially distinct compartments of the pulmonary vasculature.
989
Protocols
Protocols were approved by our Institutional Animal Care and Use
Committee, conforming to the NIH Guide for the Care and Use of
Laboratory Animals. Adult male CD rats (n⫽139, Charles River) or
8- to 10-week-old TRPV4 wild-type mice (TRPV4⫹/⫹) and null
littermates (TRPV4⫺/⫺)28 of either sex (n⫽39) were anesthetized
with sodium pentobarbital (50 mg/kg body weight IP). Lungs were
isolated for ex vivo perfusion as previously described.6
In rat lungs perfused with physiological [Ca2⫹], Kf and hemodynamics were measured at baseline and 60 minutes after treatment with the
TRPV4 agonist 4␣-phorbol-12,13-didecanoate (4␣PDD) (1 to
10 ␮mol/L, n⫽3 per dose) or the TRPV1 agonist 4␣-phorbol-12,13didecanoate-20 homovanillate (4␣PDDHV) (10 ␮mol/L, n⫽4). Using 0.02 mmol/L [Ca2⫹] perfusate, Kf and hemodynamics were
measured at baseline and 45 minutes after treatment (n⫽5 per group)
with 4␣PDD (3 ␮mol/L), 5,6-EET or 14,15-EET (3 ␮mol/L,
Biomol), or thapsigargin (150 nmol/L), with or without the TRPV
antagonist ruthenium red (1 ␮mol/L). Subsequently, CaCl2 was
added to achieve physiological [Ca2⫹] (Ca2⫹ add-back), and measurements repeated 15 minutes later. Lungs isolated from TRPV4⫺/⫺
mice or wild-type littermates (n⫽4 to 5 per group) were perfused
with buffer containing 4% albumin and physiological [Ca2⫹]. Kf and
hemodynamics were measured baseline and 60 minutes after treatment with vehicle (50 ␮L DMSO), 4␣PDD (10 ␮mol/L), or
thapsigargin (150 nmol/L). Vehicle controls in rat lungs (n⫽5 each)
included ethanol (910 ␮L or 2%) or DMSO (50 ␮L or 0.1%); DMSO
was also evaluated in lungs from wild-type mice (n⫽4). All drugs
were added to the perfusate; final circulating concentrations
are noted.
TRPV4 Expression
Statistical Analysis
Human lung resection specimens (n⫽3), obtained under a protocol
approved by the Institutional Review Board, were fixed by immersion in 10% formalin or 100% ethanol. Rat and mouse lungs (n⫽2 to
3 in each group) were perfusion fixed with 4% paraformaldehyde.
Sections (5 ␮m) were processed for immunohistochemistry using a
rabbit anti-TRPV4 polyclonal antibody (Alomone), stained with
diaminobenzidine and counterstained with hematoxylin. Western
blots were prepared from lysates (40 ␮g of total protein) of rat
pulmonary artery and microvascular endothelium and TRPV4 detected using enhanced chemiluminescence. Total RNA from mouse
lung was reverse transcribed, then PCR performed using primers
designed to amplify the pore-loop region of TRPV4 (see the online
data supplement, available at http://circres.ahajournals.org).
Quantitative data are presented as mean⫾SEM. Group means were
compared using a paired t test (2 tailed) or ANOVA, as appropriate;
the Newman–Keuls multiple comparison test was used to identify
specific differences. Probability values of ⬍0.05 were considered
statistically significant.
Materials and Methods
Animals
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Microscopic Assessment of Acute Lung Injury
Light microscopy and transmission electron microscopy (EM) were
used to evaluate structural changes in glutaraldehyde-fixed lung,19
after treatment with vehicle (910 ␮L of ethanol), 4␣PDD (3 or
10 ␮mol/L in rat or mouse lung, respectively), 14,15-EET
(3 ␮mol/L, rat lung only), or thapsigargin (150 nmol/L) for 60
minutes (n⫽3 per group). Using 1-␮m thick sections, extraalveolar
vessel cuffing and alveolar flooding were evaluated. Cuff frequency
and the cuff volume (Vc) fraction of total wall volume (Vc/Vw) were
determined, the latter using a point-counting strategy.29 Pointcounting was used to determine alveolar fluid volume (Vaf) fraction
in the alveolar space (Vaf/Vas). Thin sections (80 nm) from the same
blocks were examined via transmission EM. Junctional discontinuities (gaps), blebs, or breaks in septal capillaries were enumerated.
Means for cuff frequency, volume fractions and blebs or breaks per
capillary were determined separately for each lung, then overall
descriptive statistics derived for each group.
Isolated Lung and Assessment of
Endothelial Permeability
Both rat and mouse lungs were perfused at constant flow with buffer
(in mmol/L: 116.0 NaCl, 5.2 KCl, 0.9 MgSO4, 1.0 Na2HPO4, 2.2
NaHCO3, 8.3 D-glucose) containing 4% BSA and either physiological (2.2 mmol/L) or low (0.02 mmol/L) CaCl2 at pH 7.4 (38°C).
Hemodynamics and the filtration coefficient (Kf) were measured as
previously described,6,19,30,31 using zone 3 conditions. Kf was calculated as the rate of weight gain obtained 13 to 15 minutes after a 7
to 10 cmH2O increase in pulmonary venous pressure, normalized per
g lung dry weight. Kf, the product of specific endothelial permeability and surface area for exchange, is a sensitive measure of lung
endothelial permeability when surface area is fully recruited.32
Results
Baseline Parameters in Isolated Rat and
Mouse Lung
Total pulmonary vascular resistance, the distribution of vascular resistance and baseline Kf were similar in rat and mouse
lungs (Table 1) and were not impacted by the choice of
perfusate [Ca2⫹]. There were no differences with respect to
baseline measurements between TRPV4⫹/⫹ and TRPV4⫺/⫺
mice.
Expression of TRPV4 in Lung:
Functional Consequences
TRPV4 was expressed in the septal compartment of lungs
from humans, rats and mice (Figure 1A through 1C, respectively), as well as in bronchiolar epithelium (not shown).
TRPV4 was also expressed in smooth muscle in human and
rat extraalveolar vessels. Although TRPV4 expression in
cultured rat pulmonary artery endothelium was similar to that
in microvascular endothelium (Figure 1D), TRPV4 was not
consistently expressed in extraalveolar vessel endothelium in
intact lung (Figure 1A through 1C). In rat lung, 1, 5, and
10 ␮mol/L 4␣PDD increased Kf by 1.7-, 4.2-, and 5.6-fold,
respectively (Figure 1E), supporting the notion that TRPV4
may play a role in regulating endothelial permeability. In
contrast, the TRPV1 agonist 4␣PDDHV had no impact on
endothelial permeability despite use of a ⬎EC100 dose.33 To
determine whether activation of TRPV4 increased permeability in a Ca2⫹ entry-dependent fashion, Kf was reevaluated
using the low Ca2⫹/Ca2⫹ add-back strategy. The Ca2⫹ concentration chosen for the low Ca2⫹ segment of these experiments
was based on the lowest concentration that allowed stable Kf
for at least 1 hour (see the online data supplement). Ca2⫹
add-back provides a normal inward Ca2⫹ gradient, and if Ca2⫹
990
Circulation Research
October 27, 2006
TABLE 1. Baseline Hemodynamics and Permeability in Isolated Rat and
Mouse Lung
Rat Lung
Mouse Lung
Perfusate 关Ca 兴, mmol/L
2.2
0.02
N
51
76
2⫹
Body weight, g
Q, mL/min/g body weight
344⫾6
377⫾5
0.041⫾0.001
0.037⫾0.001
2.2
23
22⫾1
0.055⫾0.002
Q, L/min/100 g PLW
1.05⫾0.03
0.93⫾0.02
1.23⫾0.04
Pa, cm H2O
17.0⫾0.1
14.8⫾0.2
16.5⫾0.3
Pc, cm H2O
10.2⫾0.1
9.0⫾0.1
10.4⫾0.2
Pv (cm H2O)
4.0⫾0.0
4.0⫾0.0
4.2⫾0.1
Ra, cm H2O/L/min/100 g PLW
6.8⫾0.2
6.4⫾0.2
5.0⫾0.2
Rv, cm H2O/L/min/100 g PLW
6.1⫾0.2
5.5⫾0.2
5.2⫾0.3
Rt, cm H2O/L/min/100 g PLW
Kf, mL/min/cm H2O/g dry weight
12.9⫾0.4
11.9⫾0.3
10.2⫾0.4
0.0102⫾0.0003
0.0106⫾0.0004
0.0123⫾0.0003
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Q indicates perfusate flow; PLW, predicted lung wet weight55,56; Pa, pulmonary artery pressure; Pc,
pulmonary capillary pressure; Pv, pulmonary venous pressure; Ra, arterial vascular resistance; Rv,
venous vascular resistance; Rt, total vascular resistance.
permeant channels have been activated by the treatment, Ca2⫹
entry results and endothelial permeability increases. The
⬇3-fold increase in Kf induced by 4␣PDD was clearly
dependent on Ca2⫹ entry (Figure 2A) and was blocked by
ruthenium red (Figure 2B), which potently blocks TRPV4 by
binding to an extracellular domain on the channel.24,33 We
confirmed that the permeability response to 14,15-EET and
thapsigargin in rat lung is dose dependent (see the online data
supplement) and Ca2⫹ entry dependent (Figure 2A) and
documented a similar pattern for 5,6-EET (online data supplement and Figure 2A). At 0.02 mmol/L [Ca2⫹], both
5,6-EET and 14,15-EET evoked a small increase in perme-
ability, although Ca2⫹ add-back was required for the development of the normal permeability response to the EETs.6 In
the absence of Ca2⫹ add-back, the increase in Kf induced by
14,15-EET in 0.02 mmol/L [Ca 2⫹ ] (0.010⫾0.001 to
0.024⫾0.003 mL/min per cm H2O per gram dry weight,
P⫽0.0007, n⫽5) was transient and Kf returned to baseline
within 15 minutes (P⫽0.007). Ruthenium red (Figure 2B)
blocked the Ca2⫹ entry-dependent component of the permeability response to 5,6- and 14,15-EET but had no impact on
the Ca2⫹ entry-dependent permeability response to thapsigargin. In the absence of treatment, 0.02 mmol/L [Ca2⫹] had no
impact on Kf with or without Ca2⫹ add-back (see the online
Figure 1. Activation of TRPV4 expressed
in lung increases endothelial permeability. In human (A), rat (B), and mouse (C)
lung, TRPV4 was expressed in the alveolar septal compartment (left panels) and
bronchial epithelium (not shown). TRPV4
expression in vascular smooth muscle in
extraalveolar vessels (right panels) was
observed in human and rat lung,
whereas little was seen in mouse lung.
Western blotting (D) showed similar
TRPV4 expression in rat microvascular
(MV) and pulmonary artery (PA) endothelium (TRPV4/␤-actin band density was
1.1 in both groups). However, TRPV4
was not consistently expressed in
extraalveolar vessel endothelium in intact
lung (A through C). The TRPV4 agonist
4␣PDD (E) increased the filtration coefficient Kf in isolated rat lung (P⫽0.021) in
a dose-dependent fashion (P⫽0.002);
*P⬍0.05 vs 1 or 5 ␮mol/L. The TRPV1
agonist 4␣PDDHV had no effect
(P⫽0.201, paired t test).
Alvarez et al
TRPV4-Mediated Alveolar Septal Barrier Disruption
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Figure 2. Activation of TRPV4 or store-operated channels
increases permeability in a Ca2⫹ entry-dependent fashion. In low
(0.02 mmol/L) extracellular [Ca2⫹] (hatched bars), Kf was measured at baseline (BL) and 45 minutes after treatment with the
TRPV4 agonists 4␣PDD or EETs, or thapsigargin, which activates store-operated channels. A final Kf was measured 15 minutes after Ca2⫹ add-back (2.2 mmol/L, filled bars). Vehicle (A) or
the TRPV antagonist ruthenium red (1 ␮mol/L) (B) was added 15
minutes before treatment. Ca2⫹ entry was required for the permeability response to all agonists (A), yet only the response to
4␣PDD or EETs was blocked by ruthenium red (B). Probability
values (ANOVA) are shown above each group; post hoc tests
identified specific differences: *P⬍0.05 vs BL, #P⬍0.05 vs agonist in low Ca2⫹.
data supplement). EETs activate large conductance Ca2⫹-activated potassium channels (BKCa), providing an increased
driving gradient for Ca2⫹ entry.34,35 However, blockade of
BKCa channels did not alter the EET-induced permeability
response (see the online data supplement).
Compartmentalization of Barrier Disruption
Results of the morphometric analysis from light microscopy
(Figure 3) and transmission EM (Figure 4) are shown in Table
2. 4␣PDD and thapsigargin resulted in frequent extraalveolar
cuffs in rat (P⫽0.006), but not in mouse lung, compared with
control. Nonetheless, Vc/Vw was not different between groups
in either rat or mouse lung. Activation of TRPV4 resulted in
blebs or breaks in septal endothelium in both rat and mouse
lung (P⫽0.009 and P⫽0.019, respectively, versus control or
991
thapsigargin). Furthermore, the TRPV4 agonists disrupted
type I alveolar epithelial cells, manifested as separation of the
epithelium from the basal lamina. 4␣PDD increased Vaf/Vas,
compared with control and thapsigargin, in both rat and
mouse lung (P⫽0.003 and 0.011, respectively). Whereas
14,15-EET caused significant septal injury, the increase in
Vaf/Vas was more variable, and as a result the 4-group
ANOVA was not significant. In contrast, thapsigargin primarily targeted interendothelial junctional complexes in extraalveolar vessels, leading to formation of gaps; the septal
capillary network was spared, and Vaf/Vas did not increase.
Together, these data support the notion that activation of
TRPV4 (via 4␣PDD or EETs) and activation of storeoperated channels (via thapsigargin) promote barrier disruption in discrete vascular compartments of the lung even
though these agents cause similar increases in total lung Kf in
a Ca2⫹ entry-dependent fashion.
The 4␣PDD and EET-mediated permeability responses
were inhibited with ruthenium red, a pleiotropic antagonist
that blocks TRPV4. Although activation of TRPV1 had no
impact on endothelial permeability in rat lung, it was possible
that ruthenium red blocked other TRPV isoforms, contributing to its impact on the permeability response. Thus, we used
mice genetically engineered for a targeted deletion of exon 12
in the trpv4 gene,28 encoding the transmembrane domains 5
and 6, which includes the predicted pore loop region of the
channel (TRPV4⫺/⫺). Genotyping (see the online data supplement) and PCR (Figure 5A) were used to document expression of TRPV4 in wild-type mice. Whereas 3 ␮mol/L 4␣PDD
had no impact on permeability in TRPV4⫹/⫹ mice, 10 ␮mol/L
4␣PDD increased Kf 2.8-fold (Figure 5B); this dose did not
alter Kf in lungs from TRPV4⫺/⫺ littermates. Thapsigargin
increased Kf ⬇3-fold in both TRPV4⫹/⫹ and TRPV4⫺/⫺ mice.
These results confirm that activation of TRPV4 increases
endothelial permeability in the mouse lung.
Discussion
This study provides the first evidence of a functional role for
TRPV4 in lung endothelium, implicating TRPV4 in Ca2⫹
entry-dependent regulation of endothelial permeability and
barrier integrity in the alveolar septal network. Despite
similar impact on Kf, activation of TRPV4 and store-operated
channels led to injury in distinct vascular compartments.
Activation of TRPV4 by 4␣PDD and 14,15-EET preferentially targeted the alveolar septal microvessels, whereas
thapsigargin-induced store depletion targeted extraalveolar
vessels. The TRPV4 agonists typically caused endothelial
blebs and/or breaks, whereas thapsigargin induced formation
of gaps at endothelial cell junctions. These data suggest that
distinct endothelial compartments, and possibly distinct subcellular compartments of lung endothelial cells, must be
targeted subsequent to Ca2⫹ entry via these TRP channels.
The observation that the Ca2⫹ entry-dependent component of
the permeability response to 5,6- and 14,15-EET, as well as
the TRPV4 agonist 4␣PDD, was ablated by pretreatment of
rat lung with ruthenium red suggests an important role for
TRPV4 in regulation of lung endothelial permeability. This
notion is corroborated by the loss of the permeability response to the TRPV4 agonist 4␣PDD in lungs from
992
Circulation Research
October 27, 2006
Figure 3. Microscopic assessment of
perivascular cuffing and fluid. Perivascular cuffs were infrequently observed in
control rat lungs (A). Perivascular cuffing
induced by 4␣PDD (B), 14,15-EET (C), or
thapsigargin (D) was heterogeneous
(arrows), and cuff volume fraction was no
different among groups (see Table 2).
Alveolar fluid volume fraction was
increased by 4␣PDD and 14,15-EET,
(Table 2). Scale bars⫽100 ␮m. PA indicates pulmonary arteriole; Br, bronchiole;
L, lymphatic.
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
TRPV4⫺/⫺ mice. In light of the critical vulnerability of the
alveolar septal barrier in acute lung injury,2,3 our findings in
the rodent models of lung injury and the finding of TRPV4
expression in human alveolar septum lead us to hypothesize
that TRPV4 is likely to play a role in the development of
acute lung injury and the acute respiratory distress syndrome
in humans.
TRP Channels and Permeability
Ca2⫹ entry into endothelial cells occurs via activation of
selective Ca2⫹ channels or nonselective cation channels, such
as those encoded by the large superfamily of TRP channel
proteins. Much of the focus in lung endothelium has been on
the TRPC subfamily. Endothelial cells express mRNA and
protein for TRP channels, including TRPC1, TRPC3,
TRPC4, TRPC6, and TRPC7.14,36,37 In rat lung, TRPC1,
TRPC3, TRPC4, and TRPC6/7 protein is expressed in endothelium of extraalveolar vessels. Although mRNA for several
members of the TRPV subfamily, including TRPV4, are
expressed in human pulmonary artery endothelium,36 only a
subset of TRP proteins may actually play a physiological role
in regulation of lung endothelial permeability. Two studies
have addressed a role for TRPC channels in regulation of
permeability in the intact lung. Tiruppathi et al reported a
partial loss of the permeability response to thrombin in
TRPC4⫺/⫺ mice,18 and we recently found that in an aortocaval
fistula model of heart failure, endothelial TRPC1 and TRPC4
expression in extraalveolar vessels is downregulated and the
Figure 4. Assessment of endothelial ultrastructure in rat lung. Endothelial cell integrity
was assessed using transmission electron
microscopy. Random blocks were selected
from glutaraldehyde-fixed lung 1 hour after
treatment with vehicle or drug. Kf was measured to document permeability prior to fixation. Representative micrographs from
extraalveolar vessels (A through D) and septal capillaries (E through H) are shown. Endothelial ultrastructure was retained in control
lung (A and E), although occasional blebs or
breaks in septal capillaries were observed.
4␣PDD (B and F) and 14,15-EET (C and G)
rarely altered junctional morphology. However, both agonists resulted in endothelial
breaks and blebs (asterisk) in the septal capillary endothelium (F and G), as well as blebs
in the alveolar epithelium (inset in G). Thapsigargin resulted in development of gaps at
junctions between endothelial cells in
extraalveolar vessels (arrowhead) (D) but had
no impact in the septal compartment (H).
Scale bars: 2 ␮m (A through H); 500 nm
(inset in G).
Alvarez et al
TABLE 2.
TRPV4-Mediated Alveolar Septal Barrier Disruption
993
Extraalveolar Cuffs and Alveolar Septal Barrier Disruption
Septal
Alveolar Fluid
Percentage of
Cuff Volume
Capillaries Blebs, Breaks Volume Fraction
Extraalveolar Extraalveolar Vessels
Fraction
(n)
(n Per Capillary)
(Vaf/Vas)
Vessels (n)
With Cuffs
(Vc/Vw)
Isolated rat lung
Control
231
6.0⫾3.6
0.158⫾0.054
367
0.15⫾0.05
0.008⫾0.008
0.055⫾0.007
4␣ PDD
129
29.0⫾2.6*†
0.320⫾0.118
223
1.34⫾0.25*‡
14,15-EET
219
8.3⫾5.2
0.237⫾0.081
470
1.29⫾0.36*‡
0.172⫾0.157
Thapsigargin
190
36.2⫾7.0*†
0.458⫾0.089
397
0.33⫾0.08
0.003⫾0.003
Isolated mouse lung (TRPV4⫹/⫹)
Control
434
13.8⫾0.2
0.157⫾0.049
528
0.16⫾0.03
0.012⫾0.003
4␣ PDD
454
17.1⫾4.9
0.254⫾0.068
408
1.49⫾0.42*‡
0.108⫾0.027*‡
Thapsigargin
348
21.4⫾7.3
0.202⫾0.025
403
0.28⫾0.15
0.015⫾0.009
Data are mean⫾SEM (3 lungs per group). Injury in the extraalveolar compartment was not quantified, because at this magnification
the entire vessel perimeter is not visualized. *P⬍0.05 vs control, †P⬍0.05 vs 14,15-EET, ‡P⬍0.05 vs thapsigargin.
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
permeability response to thapsigargin is lost.19 Although Ca2⫹
entry can occur via receptor-operated TRP channels (TRPC3,
TRPC6, and TRPC7),38 and these channels are indeed expressed in rat lung endothelium, activation of these channels
with a diacylglycerol analog had no impact on endothelial
permeability in rat lung.19 A role in regulation of lung
endothelial permeability has not been explored for TRP
proteins outside the canonical TRP family. Aside from
thrombin and thapsigargin, we do not know whether the Ca2⫹
entry-dependent increases in endothelial permeability are
attributable to gating of TRP channels, nor which TRP
channels are involved. Our previous work evaluating the
impact of EETs, P450 epoxygenase derivatives of arachidonic acid, on lung endothelial permeability in normal rats and
rats with chronic heart failure6,19 supports the notion of
heterogeneity in Ca2⫹-dependent regulation of endothelial
permeability in lung. P450 epoxygenases metabolize arachidonic acid to form four regioisomers: 5,6-EET, 8,9-EET,
11,12-EET, and 14,15-EET.39 EETs are released from human
lung after inflammatory challenge,40 suggesting their potential involvement in acute lung injury. In canine lung, blockade of EET synthesis attenuated the pulmonary edema and
hypoxemia resulting from ethchlorvynol.41 Furthermore, exogenous 5,6-EET and 14,15-EET increased endothelial permeability in canine and rat lung,6,27 in a Ca2⫹ entry-dependent
manner. The notion that EETs must target Ca2⫹ permeant
channels distinct from TRPC1/TRPC4 is based on the following evidence: (1) the permeability response to both EETs
and thapsigargin in rat lung requires Ca2⫹ entry; (2) the
response to 14,15-EET was retained after experimentally
induced heart failure, although that to store depletion was
lost; and (3) TRPC1 and TRPC4 expression were downregulated in extraalveolar vessels from rats with heart failure.6,19
Our current results support the notion that TRPV4 expressed
in lung septal microvascular endothelium plays a critical role
in the permeability response to EETs and 4␣PDD.
Functional Role for TRPV4 Channels in the
Alveolar Septal Network
Figure 5. Activation of TRPV4 increases endothelial permeability
in mouse lung. A, Using primers designed to amplify across the
pore-loop region of TRPV4 mRNA, the predicted 612-bp product was observed in wild-type and heterozygote mice but not in
null animals. B, In isolated mouse lung, we showed that the
TRPV4 agonist 4␣PDD (10 ␮mol/L) increased endothelial permeability (Kf) in only TRPV4⫹/⫹ mice (P⫽0.036, paired t test). In
contrast, activation of store-operated channels via thapsigargin
(150 nmol/L) increased permeability in both wild-type and null
mice (P⫽0.032 and 0.008, respectively, paired t test). These
results confirm the role of TRPV4 in mediating acute lung injury.
*P⬍0.05 vs baseline (paired t test).
TRPV4, a channel originally described as activated by
hypotonicity,20,23,42 appears to participate in detection of
changes in extracellular fluid osmolality.28 Although TRPV
channels are appreciated for their role in sensory transduction,43– 46 nonsensory functions are now recognized.21,47–50
Work from Nilius and colleagues25,26,51 suggests that TRPV4
likely plays a significant role in endothelial Ca2⫹ signaling.
Both 4␣PDD and 5,6-EET activate TRPV4 heterologously
expressed in HEK-293 cells as well as endogenous TRPV4 in
aortic endothelial cells, promoting Ca2⫹ entry which was
inhibited by ruthenium red.26 Furthermore, EET-induced
Ca2⫹ entry in aortic endothelial cells was diminished in
endothelium derived from TRPV4⫺/⫺ mice.25 Collectively,
994
Circulation Research
October 27, 2006
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
these data suggested that TRPV4 could play a role in Ca2⫹
entry-dependent regulation of endothelial permeability. Our
results provide a functional role for TRPV4 expressed in the
lung alveolar septal network. The TRPV4 agonist 4␣PDD
increased endothelial permeability in rat lung in a Ca2⫹
entry-dependent fashion. This response, and the Ca2⫹ entrydependent permeability response to 5,6- and 14,15-EET,
could be blocked with ruthenium red. Furthermore, the
permeability response to 4␣PDD observed in TRPV4⫹/⫹ mice
was lacking in TRPV4⫺/⫺ littermates.
Transmission EM documented that both 4␣PDD and
14,15-EET caused disruption of the alveolar epithelium, in
addition to an impact on the septal endothelial barrier, which
very likely contributed to the increase in Kf and alveolar
flooding induced by these TRPV4 agonists. TRPV4 has
previously been demonstrated to be expressed in respiratory
epithelial cells,52–54 although its functional role in bronchiolar
or alveolar epithelium in the intact lung has not been clarified.
Our results suggest that an exploration of the signaling
cascade linking Ca2⫹ entry via TRPV4 in alveolar type I cells
to detachment of those cells from the basement membrane
would be informative.
In summary, this work provides critical evidence of a
functional role for TRPV4 in regulation of barrier integrity in
the lung alveolar septal network. Although Ca2⫹ entry via
store-operated TRP channels causes gap formation in extraalveolar vessels, the functional consequences of barrier disruption in this compartment are likely distinct from those
resulting from TRPV4-dependent barrier disruption in the
septal compartment. Activation of store-operated channels in
extraalveolar endothelium leads to fluid accumulation in
perivascular cuffs, although this likely has little impact on
alveolar gas exchange. In contrast, disruption of the vulnerable alveolar septal barrier, such as that resulting from Ca2⫹
influx via TRPV4, leads to alveolar flooding and thus would
be predicted to impair gas exchange. Indeed this is a hallmark
of acute lung injury. The implication of this work for
translational biomedical research is that TRPV4 is likely a
novel molecular target for therapeutic intervention in acute
lung injury.
Acknowledgments
We thank Sue Barnes, Freda McDonald, and Doug Drake for
technical support.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Sources of Funding
This work was supported by grants from the NIH (HL081851 and
MH064702) and a fellowship from the American Heart Association
(0315049B).
23.
24.
Disclosures
None.
References
1. Bernard GR, Artigas A, Brigham KL, Carlet J, Falke K, Hudson L, Lamy
M, LeGall JR, Morris A, Spragg R. The American-European Consensus
Conference on ARDS. Definitions, mechanisms, relevant outcomes, and
clinical trial coordination. Am J Respir Crit Care Med. 1994;149:
818 – 824.
2. Matthay MA, Zimmerman GA, Esmon C, Bhattacharya J, Coller B,
Doerschuk CM, Floros J, Gimbrone MA Jr, Hoffman E, Hubmayr RD,
Leppert M, Matalon S, Munford R, Parsons P, Slutsky AS, Tracey KJ,
25.
26.
27.
Ward P, Gail DB, Harabin AL. Future research directions in acute lung
injury: summary of a National Heart, Lung, and Blood Institute working
group. Am J Respir Crit Care Med. 2003;167:1027–1035.
Ware LB, Matthay MA. Clinical practice. Acute pulmonary edema.
N Engl J Med. 2005;353:2788 –2796.
Moore TM, Chetham PM, Kelly JJ, Stevens T. Signal transduction and
regulation of lung endothelial cell permeability. Interaction between
calcium and cAMP. Am J Physiol. 1998;275:L203–L222.
Tiruppathi C, Minshall RD, Paria BC, Vogel SM, Malik AB. Role of Ca2⫹
signaling in the regulation of endothelial permeability. Vascul
Pharmacol. 2002;39:173–185.
Alvarez DF, Gjerde EA, Townsley MI. Role of EETs in regulation of
endothelial permeability in rat lung. Am J Physiol Lung Cell Mol Physiol.
2004;286:L445–L451.
Chetham PM, Babal P, Bridges JP, Moore TM, Stevens T. Segmental
regulation of pulmonary vascular permeability by store-operated Ca2⫹
entry. Am J Physiol. 1999;276:L41–L50.
Alvarez DF, King JA, Townsley MI. Evaluation of endothelial permeability by a corrosion casting technique. Microsc Microanal. 2004;
10(suppl 2):200 –201.
Gebb S, Stevens T. On lung endothelial cell heterogeneity. Microvasc
Res. 2004;68:1–12.
King J, Hamil T, Creighton J, Wu S, Bhat P, McDonald F, Stevens T.
Structural and functional characteristics of lung macro- and microvascular endothelial cell phenotypes. Microvasc Res. 2004;67:139 –151.
Clapham DE, Runnels LW, Strübing C. The TRP ion channel family. Nat
Rev Neurosci. 2001;2:387–396.
Freichel M, Philipp S, Cavalie A, Flockerzi V. TRPC4 and TRPC4deficient mice. Novartis Found Symp. 2004;258:189 –199.
Harteneck C, Plant TD, Schultz G. From worm to man: three subfamilies
of TRP channels. Trends Neurosci. 2000;23:159 –166.
Nilius B, Droogmans G, Wondergem R. Transient receptor potential
channels in endothelium: solving the calcium entry puzzle? Endothelium.
2003;10:5–15.
Vazquez G, Wedel BJ, Aziz O, Trebak M, Putney JW Jr. The mammalian
TRPC cation channels. Biochim Biophys Acta. 2004;1742:21–36.
Brough GH, Wu S, Cioffi D, Moore TM, Li M, Dean N, Stevens T.
Contribution of endogenously expressed Trp1 to a Ca2⫹-selective, storeoperated Ca2⫹ entry pathway. FASEB J. 2001;15:1727–1738.
Cioffi DL, Wu S, Stevens T. On the endothelial cell ISOC. Cell Calcium.
2003;33:323–336.
Tiruppathi C, Freichel M, Vogel SM, Paria BC, Mehta D, Flockerzi V,
Malik AB. Impairment of store-operated Ca2⫹ entry in TRPC4-/- mice
interferes with increase in lung microvascular permeability. Circ Res.
2002;91:70 –76.
Alvarez DF, King JA, Townsley MI. Resistance to store depletioninduced endothelial injury in rat lung after chronic heart failure. Am J
Respir Crit Care Med. 2005;172:1153–1160.
Liedtke W, Choe Y, Marti-Renom MA, Bell AM, Denis CS, Sali A,
Hudspeth AJ, Friedman JM, Heller S. Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor.
Cell. 2000;103:525–535.
Liedtke W. TRPV4 plays an evolutionary conserved role in the transduction of osmotic and mechanical stimuli in live animals. J Physiol.
2005;567:53–58.
Nilius B, Vriens J, Prenen J, Droogmans G, Voets T. TRPV4 calcium
entry channel: a paradigm for gating diversity. Am J Physiol Cell Physiol.
2004;286:C195–C205.
Strotmann R, Harteneck C, Nunnenmacher K, Schultz G, Plant TD.
OTRPC4, a nonselective cation channel that confers sensitivity to extracellular osmolarity. Nat Cell Biol. 2000;2:695–702.
Voets T, Prenen J, Vriens J, Watanabe H, Janssens A, Wissenbach U,
Bödding M, Droogmans G, Nilius B. Molecular determinants of permeation through the cation channel TRPV4. J Biol Chem. 2002;277:
33704 –33710.
Vriens J, Owsianik G, Fisslthaler B, Suzuki M, Janssens A, Voets T,
Morisseau C, Hammock BD, Fleming I, Busse R, Nilius B. Modulation
of the Ca2⫹ permeable cation channel TRPV4 by cytochrome P450
epoxygenases in vascular endothelium. Circ Res. 2005;97:908 –915.
Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T, Nilius B.
Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels. Nature. 2003;424:434 – 438.
Ivey CL, Stephenson AH, Townsley MI. Involvement of cytochrome
P-450 enzyme activity in the control of microvascular permeability in
canine lung. Am J Physiol. 1998;275:L756 –L763.
Alvarez et al
TRPV4-Mediated Alveolar Septal Barrier Disruption
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
28. Liedtke W, Friedman JM. Abnormal osmotic regulation in trpv4-/- mice.
Proc Natl Acad Sci U S A. 2003;100:13698 –13703.
29. Weibel ER. Morphometry: sterological theory and practical methods. In:
Gil J, ed. Models of Lung Disease. Microscopy and Structural Methods.
New York: Marcel Dekker Inc; 1990:199 –252.
30. Townsley MI, Korthuis RJ, Rippe B, Parker JC, Taylor AE. Validation of
double vascular occlusion method for Pc,i in lung and skeletal muscle.
J Appl Physiol. 1986;61:127–132.
31. Townsley MI, Fu Z, Mathieu-Costello O, West JB. Pulmonary microvascular permeability. Responses to high vascular pressure after induction
of pacing-induced heart failure in dogs. Circ Res. 1995;77:317–325.
32. Parker JC, Townsley MI. Evaluation of lung injury in rats and mice. Am J
Physiol Lung Cell Mol Physiol. 2004;286:L231–L246.
33. Watanabe H, Davis JB, Smart D, Jerman JC, Smith GD, Hayes P, Vriens
J, Cairns W, Wissenbach U, Prenen J, Flockerzi V, Droogmans G,
Benham CD, Nilius B. Activation of TRPV4 channels (hVRL-2/
mTRP12) by phorbol derivatives. J Biol Chem. 2002;277:13569 –13577.
34. Harder DR, Campbell WB, Roman RJ. Role of cytochrome P-450
enzymes and metabolites of arachidonic acid in the control of vascular
tone. J Vasc Res. 1995;32:79 –92.
35. Roman RJ. P-450 metabolites of arachidonic acid in the control of
cardiovascular function. Physiol Rev. 2002;82:131–185.
36. Fantozzi I, Zhang S, Platoshyn O, Remillard CV, Cowling RT, Yuan JX.
Hypoxia increases AP-1 binding activity by enhancing capacitative Ca2⫹
entry in human pulmonary artery endothelial cells. Am J Physiol Lung
Cell Mol Physiol. 2003;285:L1233–L1245.
37. Yao X, Garland CJ. Recent developments in vascular endothelial cell
transient receptor potential channels. Circ Res. 2005;97:853– 863.
38. Trebak M, Bird GS, McKay RR, Birnbaumer L, Putney JW Jr. Signaling
mechanism for receptor-activated canonical transient receptor potential 3
(TRPC3) channels. J Biol Chem. 2003;278:16244 –16252.
39. Spector AA, Fang X, Snyder GD, Weintraub NL. Epoxyeicosatrienoic
acids (EETs): metabolism and biochemical function. Prog Lipid Res.
2004;43:55–90.
40. Kiss L, Schütte H, Mayer K, Grimm H, Padberg W, Seeger W, Grimminger F. Synthesis of arachidonic acid-derived lipoxygenase and cytochrome P450 products in the intact human lung vasculature. Am J Respir
Crit Care Med. 2000;161:1917–1923.
41. Stephenson AH, Sprague RS, Weintraub NL, McMurdo L, Lonigro
AJ. Inhibition of cytochrome P-450 attenuates hypoxemia of acute lung
injury in dogs. Am J Physiol. 1996;270:H1355–H1362.
42. Wissenbach U, Bödding M, Freichel M, Flockerzi V. Trp12, a novel Trp
related protein from kidney. FEBS Lett. 2000;485:127–134.
995
43. Alessandri-Haber N, Dina OA, Yeh JJ, Parada CA, Reichling DB, Levine
JD. Transient receptor potential vanilloid 4 is essential in chemotherapyinduced neuropathic pain in the rat. J Neurosci. 2004;24:4444 – 4452.
44. Lee H, Iida T, Mizuno A, Suzuki M, Caterina MJ. Altered thermal
selection behavior in mice lacking transient receptor potential vanilloid 4.
J Neurosci. 2005;25:1304 –1310.
45. Liedtke W, Tobin DM, Bargmann CI, Friedman JM. Mammalian TRPV4
(VR-OAC) directs behavioral responses to osmotic and mechanical
stimuli in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2003;100:
14531–14536.
46. Suzuki M, Mizuno A, Kodaira K, Imai M. Impaired pressure sensation in
mice lacking TRPV4. J Biol Chem. 2003;278:22664 –22668.
47. Caterina MJ. Vanilloid receptors take a TRP beyond the sensory afferent.
Pain. 2003;105:5–9.
48. Liu X, Bandyopadhyay B, Nakamoto T, Singh B, Liedtke W, Melvin JE,
Ambudkar I. A role for AQP5 in activation of TRPV4 by hypotonicity:
concerted involvement of AQP5 and TRPV4 in regulation of cell volume
recovery. J Biol Chem. 2006;281:15485–15495.
49. Nilius B, Watanabe H, Vriens J. The TRPV4 channel: structure-function
relationship and promiscuous gating behaviour. Pflügers Arch. 2003;446:
298 –303.
50. O’Neil RG, Heller S. The mechanosensitive nature of TRPV channels.
Pflügers Arch. 2005;451:193–203.
51. Vriens J, Watanabe H, Janssens A, Droogmans G, Voets T, Nilius B. Cell
swelling, heat, and chemical agonists use distinct pathways for the activation of the cation channel TRPV4. Proc Natl Acad Sci U S A. 2004;
101:396 – 401.
52. Delany NS, Hurle M, Facer P, Alnadaf T, Plumpton C, Kinghorn I, See
CG, Costigan M, Anand P, Woolf CJ, Crowther D, Sanseau P, Tate SN.
Identification and characterization of a novel human vanilloid
receptor-like protein, VRL-2. Physiol Genomics. 2001;4:165–174.
53. Fernandez-Fernandez JM, Nobles M, Currid A, Vazquez E, Valverde
MA. Maxi K⫹ channel mediates regulatory volume decrease response in
a human bronchial epithelial cell line. Am J Physiol Cell Physiol. 2002;
283:C1705–C1714.
54. Sidhaye VK, Güler AD, Schweitzer KS, D’Alessio F, Caterina MJ, King
LS. Transient receptor potential vanilloid 4 regulates aquaporin-5
abundance under hypotonic conditions. Proc Natl Acad Sci U S A. 2006;
103:4747– 4752.
55. Parker JC, Ivey CL, Tucker JA. Gadolinium prevents high airway
pressure-induced permeability increases in isolated rat lungs. J Appl
Physiol. 1998;84:1113–1118.
56. Parker JC, Gillespie MN, Taylor AE, Martin SL. Capillary filtration
coefficient, vascular resistance, and compliance in isolated mouse lungs.
J Appl Physiol. 1999;87:1421–1427.
Downloaded from http://circres.ahajournals.org/ by guest on July 31, 2017
Transient Receptor Potential Vanilloid 4−Mediated Disruption of the Alveolar Septal
Barrier: A Novel Mechanism of Acute Lung Injury
Diego F. Alvarez, Judy A. King, David Weber, Emile Addison, Wolfgang Liedtke and Mary I.
Townsley
Circ Res. 2006;99:988-995; originally published online September 28, 2006;
doi: 10.1161/01.RES.0000247065.11756.19
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2006 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/99/9/988
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2006/09/28/01.RES.0000247065.11756.19.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
MATERIALS AND METHODS
Animals.
Genomic DNA was isolated from mouse tails harvested at weaning and used as a template for PCRbased genotyping. Forward and reverse primers were CATGAAATCTGACCTCTTGTCCCC and
TTGTGTACTGTCTGCACACCAGGC, respectively 1. PCR products were resolved on a 0.8% agarose
gel. A 2.1 kB band was observed in wild type TRPV4+/+ mice and a 1.1 kB band in TRPV4-/- mice; both
bands were observed in heterozygotes. Results were confirmed by absence of an exon 12 amplicon,
while the exon 15 amplicon was present 1.
TRPV4 Expression.
Human lung resection specimens (n=3), obtained under a protocol approved by the Institutional Review
Board, were fixed by immersion in 10% formalin or 100% ethanol. Rat and mouse lungs (n=2-3 in each
group) were perfusion-fixed with 4% paraformaldehyde. Sections (5 μm) were incubated overnight at 4
°C with a goat anti-TRPV4 polyclonal antibody (1:250, Alomone) and 1 h at room temperature with a
horseradish peroxidase-conjugated secondary antibody (1:100, Santa Cruz Biotechnology). Sections
were stained with diaminobenzidine and counterstained with hematoxylin. Western blots were prepared
from lysates (40 μg total protein) of rat pulmonary artery and microvascular endothelium. TRPV4 was
detected (1:200 primary antibody) using enhanced chemiluminescence. Blots were probed for β-actin
(1:5000 primary antibody) as a loading control. Total RNA from mouse lung was reverse transcribed,
then PCR performed (40 cycles) using forward (TCACGAAGAAATGCCCTGGAGTGA) and reverse
(ACTGCAACTTCCAGATGTGCTTGC) primers designed to amplify nucleotides 1667-2278 of mouse
TRPV4 (AF263522), coding for the pore-loop region, resulting in a 612 bp product in wild type or
heterozygous mice. PCR products were resolved on a 2% agarose gel.
Protocols.
1
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
The optimal [Ca2+] for the low Ca2+/Ca2+ add-back strategy in isolated rat lungs was assessed by
determining the lowest [Ca2+] which allowed a normal, stable Kf for at least 1 hr. Separate groups of
lungs (n=2-3 per group), were perfused upon isolation with buffer/albumin in which [Ca2+] was set at
physiologic concentration (2.2 mmol/L) or one of several concentrations ranging to as low as 0.01
mmol/L. Paired measurements of Kf were made at baseline and after 60 min perfusion. In separate
experiments (n=2-5 per group), the stability of isolated rat lungs in the low Ca2+/Ca2+ add-back paradigm,
in the absence of other treatment, was assessed. Kf was measured at baseline and after 30 or 60 min
perfusion with a low Ca2+ (0.02 mmol/L) perfusate, with or without Ca2+ add-back to 2.2 mmol/L.
To determine whether EET-induced activation of large conductance Ca2+-activated potassium channels
(BKCa) modulated the permeability response to EETs, we focused on 14,15-EET. The effect of 14,15EET (3 µmol/L) on Kf in rat lung was tested in the presence of the selective BKCa inhibitors charybdotoxin
(100 nmol/L) and apamin (300 nmol/L) 2, using the low Ca2+/Ca2+ add back protocol. Kf was measured at
baseline and then either vehicle (55 μL DMSO, n=5) or the combination of the two inhibitors (n=5) were
added and allowed to circulate for 15 min before addition of 14,15-EET (3 μmol/L). A second Kf was
measured 30 min later, then again 15 min after Ca2+ add-back.
RESULTS
Evaluation of the dose-dependent impact of lowering perfusate [Ca2+] in isolated rat
lungs (Online Figure 2, top panel) showed that endothelial permeability remained stable
down to 0.02 mmol/L Ca2+. Although baseline Kf was normal in 0.01 mmol/L Ca2+,
permeability tended to increase after 1 hr of perfusion. Thus, 0.02 mmol/L was chosen
as the “low Ca2+” concentration. Next, we tested the integrity of the endothelial barrier
in isolated rat lung using the low Ca2+/Ca2+ add back protocol, without treatment (lower
panel). Perfusion of the lung at 0.02 mmol/L [Ca2+] did not have a significant impact on
2
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Kf, nor did Ca2+ add-back to reestablish a physiological [Ca2+] have any effect in lungs
perfused with this low [Ca2+].
We evaluated the permeability responses in rat lung to 5,6-EET, 14,15-EET (Online Figure 3) and
thapsigargin (Online Figure 4). Both the EETs and thapsigargin increased Kf in a dose-dependent
fashion. Based on this information, we chose to use 3 μmol/L EETs and 150 nmol/L thapsigargin in
subsequent studies. Higher doses were accompanied by significant pressor responses. Although EETs
have been shown to activate BKCa channels, thus providing an increased driving gradient for Ca2+ entry 3,
4
, we found that blockade of BKCa channels did not alter the permeability response to 14,15-EET (Online
Figure 5).
REFERENCES
1.
Liedtke W, Friedman JM. Abnormal osmotic regulation in trpv4-/- mice. Proc Natl Acad Sci U S A.
2003;100:13698-13703.
2.
Edwards G, Thollon C, Gardener MJ, Feletou M, Vilaine J, Vanhoutte PM, Weston AH. Role of gap
junctions and EETs in endothelium-dependent hyperpolarization of porcine coronary artery. Br J
Pharmacol. 2000;129:1145-1154.
3.
Harder DR, Campbell WB, Roman RJ. Role of cytochrome P-450 enzymes and metabolites of
arachidonic acid in the control of vascular tone. J Vasc Res. 1995;32:79-92.
4.
Roman RJ. P-450 metabolites of arachidonic acid in the control of cardiovascular function. Physiol
Rev. 2002;82:131-185.
3
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Online Figure Legends.
Online Figure 1. PCR-based genotyping in mice. A 2.1 kB band was observed in wild type TRPV4+/+
mice and a 1.1 kB band in TRPV4-/- mice; both bands were observed in heterozygotes.
Online Figure 2. Impact of low Ca2+ perfusate in isolated rat lung. Lowering perfusate [Ca2+] had no
significant effect on the filtration coefficient (Kf) down to a concentration of 0.02 mmol/L (top panel). In
lungs perfused at 0.02 mmol/L [Ca2+], Ca2+ add-back to 2.2 mmol/L had effect on Kf (bottom panel). The
tendency for Kf to increase in 0.01 mmol/L L [Ca2+] was reversed with Ca2+ add-back.
Online Figure 3. Dose-dependent effect of 5,6- and 14,15-EET on endothelial
permeability in isolated rat lung. In separate groups of lungs, the filtration coefficient
(Kf) was measured at baseline and 60 min after treatment with 0.5-5 μmol/L 5,6- or
14,15-EET (n=2-3 per dose). Both EET regioisomers caused a dose-dependent
increase in endothelial permeability. Higher doses were not evaluated due to vehicleinduced pressor responses. *p<0.05 vs. baseline.
Online Figure 4. Dose-dependent effect of thapsigargin on endothelial permeability in
rat lung. The filtration coefficient (Kf) was measured at baseline and 60 min after
treatment with thapsigargin, 50-300 nM thapsigargin (n=3 per dose). At 150 and 300
nmol/L, thapsigargin significantly increased endothelial permeability, though at 300
nmol/L the permeability response was accompanied by a significant pressure response.
* p<0.05 vs. baseline.
Online Figure 5. BKCa channels do not modulate 14,15-EET-induced increases in endothelial
permeability in rat lung. Pretreatment of the isolated rat lung with the selective BKCa inhibitors
4
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
charybdotoxin (CTX, 100 nM) and apamin (300 nM) had no significant impact on the permeability
response to 14,15-EET (3 μmol/L) in rat lung. *p<0.05 vs. baseline; #p<0.05 vs agonist at low Ca2+.
5
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Online Figure 1.
+/
+/- +/
-/ 2.2
1.1
6
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Online Figure 2.
7
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Online Figure 3.
8
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Online Figure 4.
9
Online Supplement
Alvarez et al.
TRPV4-mediated alveolar septal barrier disruption
Online Figure 5.
10