SUPPLEMENTAL MATERIALS Supplemental Materials and Methods Identification of capsidiol by 1H- and 13C NMR 1 H- and 13 C-NMR spectroscopy were performed on a Bruker Biospin 500 spectrometer equipped with a cryoprobe in CDCl3 solution. Chemical shifts are reported in ppm relative to CHCl3 ( = 7.260 ppm) for 1H-NMR and CDCl3 ( = 77.16 ppm) for 13C-NMR spectroscopy. 13 C signal assignments were made according to Stillman et al. (1981) for capsidiol and Marshall et al. (1990) for α-cembratrienediol. All solvents of analytical grade were redistilled in a glass apparatus. For labeling experiments, leaves including their petioles were cut from 2 month-old tobacco plants (Nicotiana tabacum L. var. xanthi) grown in greenhouse. A 1% water solution (10 mL per 3 leaves) of (1-13C)-D-glucose (99% isotope abundance) was supplied and absorption was supported by a transpiration stream using a horizontal laminar flow hood. Once all visible liquid was absorbed, entire leaves were elicited for 16 h and capsidiol was adapted from the protocol described above (capsidiol production, extraction and analysis). A control experiment was performed without addition of any glucose to obtain a 13C natural abundance sample. Proteins interfering with the extraction procedure were precipitated with one volume of icecold acetone, removed from the collected aqueous/acetone solution by centrifugation and the water/acetone phase after elicitation was evaporated and the remaining aqueous solution was extracted with ethyl acetate (3 x 200 mL). The combined extracts were dried over anhydrous MgSO4, filtered and evaporated to dryness. This crude extract proved by 1H-NMR to contain mainly capsidiol and -cembratrienediol. As there was no overlapping of the 13 C signals of capsidiol and -cembratrienediol, the two terpenoids were not separated and the sample directly analyzed by NMR spectroscopy. 13 C isotope abundances of each carbon were determined by comparing the relative intensities of the signals 13C labeled sample with those of the 13C natural abundance sample (1.1 %) using as internal reference the C-11 signal in the capsidiol spectrum and the C-15 signal for the -cembratrienediol spectrum following the procedure previously described reported (Rohmer et al., 1993). Identification of capsidiol by GC-MS Capsidiol was identified by GC-MS with a 6890 gas chromatograph (Agilent) equipped with a HP5-MS column (Agilent J & W; 30m long, 0.32mm i.d., 0.25 mm film thickness) coupled 1 with a 5973 mass selective detector. Injections were made in splitless mode with ratio of 50; and the temperature of the injector was set at 250°C.The temperature program was a ramp from 60°C to 300°C at 10°C per min followed by a 5 min plateau. He as a carrier gas was set at 2mL/min. Mass spectra obtained for capsidiol at an electron ionization of 70eV were in agreement with that of an authentic sample (Mialoundama et al., 2009). Identification of capsidiol by UHPLC-ESI- MS/MS Extracts were analyzed on an ultra high performance liquid chromatography coupled to tandem mass spectrometry (UHPLC-MS/MS) at MS and MS/MS mode. The analyses were performed on a Waters Quattro Premier XE (Waters, Mildorf, MA USA) equipped with an Electrospray Ionisation (ESI) source and coupled to an Acquity UPLC system (Waters) with diode array detector (DAD). UV spectra were recorded from 190 to 500 nm. Chromatographic separation was achieved using an Acquity UPLC BEH C8 column (100 x 2.1 mm, 1.7µm; Waters), coupled to an Acquity UPLC BEH C8 pre-column (2.1 x 5 mm, 1.7µm; Waters). The two mobile phases were water (MS grade, Sigma) with 1% 1M NH4Ac, 0.1% acetic acid (Buffer A), and acetonitrile: isopropanol (7:3, UHPLC grade Sigma) containing 1% 1M NH4Ac, 0.1% acetic acid (Buffer B). The gradient separation, which was performed at a flow rate of 400 μL min-1, was as follow: 1 min 45% of buffer A, 3 min linear gradient from 45% of buffer A to 35% of buffer A, 8 min linear gradient from 25 to 11% of buffer A, 3 min linear gradient from 11% A to 1% of buffer A. After washing the column for 3 min with 1% of buffer A the buffer was set back to 45% of buffer A and the column was re-equilibrated for 4 min (22 min total run time). To determine capsidol best ionization parameters, positive and negative electrospray scan modes were used. Capsidiol was detected only at [M+ H-H2O] and [M+ H-2H2O] parent ions as described by Literakova et al. (2010). Capsidiol with adducts of (Cl, Na, K) were searched and not detected. The selected Ion recording (SIR) MS mode was then used to determine parent mass transition conditions. For the SIR mode the [M+ H-H2O] and the [M+ H-2H2O] parent ion were selected, (m/z 219 and m/z 201) as described by Literakova et al. (2010). Daughter scan (DS) MS/MS mode was then used to determine the fragmentation pattern of capsidiol. For fragmentation the cone voltage was set to 25 eV and collision energy after optimization was set to 18 eV. The fragmentation pattern of capsidiol was compared to published data and was similar to that obtained by Literakova et al. (2010). Acquisition and analysis were performed with the MassLynx software (version 5.1) running under Windows XP professional on a Pentium PC. 2 Cloning and heterologous expression of tobacco protein farnesyltransferase and protein geranylgeranyltransferase Total RNA was isolated from 3-day-old tobacco BY-2 cells using a Trizol-based protocol and cDNAs were prepared following the manufacturer’s instructions (Invitrogen). The cDNA encoding the alpha subunit of tobacco protein prenyltransferase was PCR amplified using primers from the full length Nicotiana benthamiana EST clone (TC18998). The full cDNAs coding for the β subunits (β-farnesyltransferase and β-geranylgeranyltransferase) were not available. Thus, a cDNA fragment was amplified as described by Courdavault et al., (2005). 5’-RACE-PCR and 3’-RACE-PCR were realized to determine the sequence of each extension of the cDNA according to the protocol described by Scotto-Lavino et al. (2006). Finally, after reconstitution of the sequence, a further PCR amplification was performed for isolation of the full-length cDNA to make sure that the reconstituted sequence belongs to the same gene. All primers utilized to isolate the full-length cDNAs coding for the three subunits are listed in Table S5. For heterologous expression in E. coli, the sequence coding for the α-subunit was cloned into the same vector as the β subunit to allow coexpression and reconstitution of the heterodimers constituting the protein prenyltransferases. The XhoI site in NtβF was removed by sitedirected mutagenesis using primers listed in Table S5. Open-reading frames were PCRamplified to introduce required restriction sites and the products were cloned into pRSFDuet1 (Novagen). Primers are listed in Table S5. The generated plasmids pRSF-NtPGGT (containing the Ntα and the NtβGG genes) or pRSF-Nt-PFT (containing the Nt-alpha gene and the NtβF) were transformed in E. coli BLRA cells (BL21DE3 cells (Novagen), containing the pRARE plasmid (Novagen)). Overnight cultures were diluted 100-fold in Luria Bertani (LB) medium containing kanamycin (30 µg mL-1). They were cultivated at 32°C and induced with isopropyl-β-D-thiogalactoside to a final concentration of 0.1 mM when the A600 reached 0.7, and further cultivated for 18 h before being harvested and stored at -20°C. Determination of inhibition of cell growth, cell death, toxicity, AOS production induced by chemical treatment The cell growth rate was evaluated by determining the fresh weight of cells collected by suction filtration after 24 h culturing. The rate is expressed in percentage of growth of treated cells, compared to the non-treated cell suspension. Following the protocol based on a double staining technique using propidium iodide and fluorescein diacetate and described by Hemmerlin and Bach (1998), cell viability was evaluated by fluorescence microscopy. Active 3 oxygen species (AOS) were detected by the DAB-uptake method using 3,3’diaminobenzidine (1 mg mL-1) and described by Thordal-Christensen et al. (1997). Supplementary REFERENCES Courdavault V, Burlat V, St-Pierre B, Giglioli-Guivarc’h N (2005) Characterization of CaaX-prenyltransferases in Catharanthus roseus: relationships with the expression of genes involved in the early stages of monoterpenoid biosynthetic pathway. Plant Sci 168: 1097-1107 Literakova P, Lochman J, Zdrahal Z, Prokop Zbynek, Mikes V, Kasparovsky T (2000) Determination of capsidiol in tobacco cells culture by HPLC. J Chromatogr Sci 48: 436-440 Mialoundama AS, Heintz D, Debayle D, Rahier A, Camara B, Bouvier F (2009) Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco. Plant Physiol 150: 1556-1566 Marshall JA, Robinson ED, Lebreton J (1990) Synthesis of the tumor inhibitory tobacco constituents α- and β-2,7,11-cembratriene-4,6-diol by diastereoselective [2,3] Wittig ring contraction. J Org Chem 55: 227-239 Rohmer M, Knani M, Simonin P, Sutter B, Sahm H (1993) Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate. Biochem J 295: 517-524 Scotto-Lavino E, Du G, Frohman MA (2006) 5’ end cDNA amplification using classic RACE. Nat Protoc 1: 2555-2562 Stillman MJ, Stothers JB, Stoessl A (1981) Capsidiol and 1-epicasidiol: absolute configuration, NMR, and optical spectra of the dibenzoates. Can J Chem 59: 2303-2035 Thordal-Christensen H, Zhang Z, Wei Y, Collinge DB (1997) Sub-cellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barleypowdery mildew interaction. Plant J 11: 1187-1194 4 Table S1. 1H-NMR (500 MHz, CDCl3) and 13C-NMR (125 MHz, CDCl3) of capsidiol and (1S,2E,4S,6R,7E,11E)-2,7,11-cembratriene-4,6-diol. Metabolite Capsidiol 1 H-NMR = 5.93 (1H, dd, J = 6.8, 2.1 Hz, 9-H), 4.72 & 4.69 (2x1H, 2 br. s, 12-Ha, 12-Hb), 4.57 (1H, dt, J = 12.3, 4.6 Hz, 3-H), 4.34 (1H, dd, J = 3.8, 2.5 Hz, 1-H), 1.72 (3H, s, 13-H), 1.35 (3H, s, 15-H), 0.86 (3H, d, J = 6.9 Hz, 14-H). C-NMR = 149.6 (C-11), 140.5 (C-10), 129.2 (C-9), 108.9 (C-12), 13 75.2 (C-1), 65.6(C-3), 47.8(C-4), 45.0 (C-6), 40.2(C-7), 39.2(C-5), 36.3(C-2), 32.2 (C-15), 30.5 (C-8), 21.2 (C-13), 9.1 (C-14). α-Cembratrienediol 1 H-NMR = 5.33 (3H, m, 2-H, 3-H, 7-H), 5.04 (1H, t, J = 6.0 Hz, 11H), 4.48 (1H, ddd, J = 9.5, 7.9, 2.6 Hz, 5-H), 1.67 (3H, d, J = 1.2 Hz, ), 1.52 (3H, br. d, J = 1.2 Hz, ), 1.35 (3H, s, H-18), 0.82 & 0.79 (2x3H, 2 d, J = 6.7 Hz, 6.7 Hz, 16-H/17-H). C-NMR = 137.6 (C-3),137.0 (C-8), 133.6 (C-12), 130.7 (C-7), 127.9 13 (C-2), 124.5 (C-11), 72.6 (C-4), 66.5 (C-6), 52.3 (C-5), 46.5 (C-1), 39.0 (C-9), 36.9 (C-13), 33.1 (C-15), 30.3, (C-18), 28.1 (C-14), 23.7 (C-10), 20.8 (C-17), 19.5 (C-16), 16.2 (C-19), 15.2 (C-20). 5 Table S2. 13C Isotopic abundances of isoprene units from capsidiol after incorporation of (113 C)glucose. The signal in C-11 (that is labeled neither by the MVA, nor by the MEP pathway) was utilized as internal reference. When indicated (4 or 5), the corresponding isoprene units can not be discriminated. Corresponding Capsidiol carbon δ (ppm) atoms isoprene units Isotope IPP and DMAPP abundance numbering 11 149.6 3 1.1 10 140.5 3 1.2 9 129.2 4 5.9 12 108.9 4 or 5 6.5 1 75.2 2 6.1 3 65.6 4 6.3 4 47.8 3 1.2 6 45 1 1.2 7 40.2 2 6.5 5 39.2 2 5.7 2 36.3 1 1.3 15 32.2 5 5.6 8 30.5 1 1.6 13 21.2 4 or 5 6.2 14 9.1 5 6.5 6 Table S3. 13 C isotope abundance of isoprene units of α-cembratrienediol (α-CBT) after incorporation of (1-13C)glucose. The signal of C-15 (that is labeled neither by the MVA, nor by the MEP pathway) was utilized as internal reference Corresponding α-CBT carbon δ (ppm) atoms isoprene units Isotope IPP and DMAPP abundance numbering 3 137.7 4 1.2 8 137.1 3 1.1 12 133.6 3 1.2 7 130.7 4 1.1 2 127.9 1 1.4 11 124.5 4 1.2 4 72.6 3 1.2 6 66.5 1 1.4 5 52.3 2 1.2 1 46.5 2 1.0 9 39 2 Overlap 13 36.9 2 1.2 15 33.1 3 1.1 18 30.3 5 1.4 14 28.1 1 1.5 10 23.4 1 Overlap 17 20.8 5 1.3 16 19.5 4 1.3 19 16.2 5 1.4 20 15.2 5 Overlap . 7 Table S4. Effect of carvone and known inhibitors of protein isoprenylation on capsidiol production in cellulase-elicited tobacco leaf-disks. Capsidiol was extracted from 3 mL culture-medium used to treat the leaf-disks during 18 h. Compound Formula FW Structure Conc. Control S-Carvone Percentage (capsidiol) 100% C10H14O O 150.21756 2 mM 0% 2 mM 0% 2 mM 0% 2 mM 0% O R-Carvone C10H14O 150.21756 OH S-Perillyl alcohol C10H18O 154.24932 OH R-Perillyl alcohol C10H18O 154.24932 8 Limonene PFT Inhibitor I GGti-2133 C10H16 136.23404 NH C19H29NNa3O6P O 467.37918 C27H28N4O3 456.53622 COONa PO 3Na2 H3C O NH H3C HO NH 2 mM 100% 60 µM 100% 60 µM 49% 50 µM 42% 50 µM 100% N NH O O AFC C20H33NO3S 367.54592 N H COOH S O AGGC C25H41NO3S 435.66294 N H COOH S 9 Table S5. Oligonucleotides used in this study. Oligonucleotides were custom synthesized (Sigma-Aldrich). Name Sequence (5’-3’) Comments Ntα-F GTCCGATCAGATCCCCGAGATCGA Isolation of Ntα Ntα-R TTCCCAGCAGATTCCGACGTG Isolation of Ntα NtβFdeg-F GACCWTGGCTKTGYTACTGG Cloning of a specific DNA fragment coding for NtβF NtβFdeg-R ARGTATACCCRCCRTGAGC Cloning of a specific DNA fragment coding for NtβF NtβGGdeg-F CAACAGSMWGATGGAAGYTTTATGC Cloning of a specific DNA fragment coding for NtβGG NtβGGdeg-R AAARCCACCRTCRTAWGAYTGACA Cloning of a specific DNA fragment coding for NtβGG NtβF-F1 CATTCAATCGCTTTGTTGGGAGAA 3’-RACE for NtβF NtβF-F2 CGCAACAACTTATGCTGCAGTCAA 3’-RACE for NtβF NtβF-R1 AACCTGGTTCGCCAGCAATTCCAC 5’-RACE for NtβF NtβF-R2 ATGCATCCTGAAGCCACCACTTGTG 5’-RACE for NtβF NtβGG-F1 AGAGACAGACCTCCGCTTTGTA 3’-RACE for NtβGG NtβGG-F2 AACTGGAGTGGCATTGACAAGGAG 3’-RACE for NtβGG NtβGG-R1 TCCAACATGGAAGAGATTGCAGC 5’-RACE for NtβGG NtβGG-R2 TACAAAGCGGAGGTCTGTCTCTG 5’-RACE for NtβGG Q0 CCAGTGAGCAGAGTGACG 3’- and 5’- RACE QT CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTT 3’- and 5’- RACE QI GAGGACTCGAGCTCAAGC 3’- and 5’- RACE NtβF-F3 ATGGAGTCGAGGAGAGTAACGAAGACGCTGG Site-directed mutagenesis of NtβF to remove the XhoI-RS NtβFmutXhoI-R3 GAGACCCCGAGTGAGATAATCG Site-directed mutagenesis of NtβF to remove the XhoI-RS BamHI-Ntα-F CGGGATCCGATGGATACTGGCGAAGATAAGCG Construction of the pRSF-His6α plasmid Ntα-HindIII-R CCCAAGCTTCTACAAGTTATCCTGCATGC Construction of the pRSF-His6α plasmid NdeI-NtβGG-F GGGTTTCATATGGCGGAGGAAGATGATGAATTTCGGAGC Construction of the pRSF-His6α-βGG plasmid NtβGG-XhoI-F CCGCTCGAGTCAAAGTCTAGTGCGTGTACCA Construction of the pRSF-His6α-βGG plasmid 10 NdeI-NtβF-F GGGTTTCATATGGAGTCGAGGAGAGTAACGAAGACGCTGG Construction of the pRSF-His6α-βF plasmid NtβF-XhoI-F CCGCTCGAGTCACAAGCATGAGAAGAACCTGCG Construction of the pRSF-His6α-βF plasmid NdeI-NtHMGR2-F GGAATTCCATATGCATCACCATCACCATCACGATAATAATGATGAATGTTGGGAT Construction of the pBAD-H6-CatHMGR2 plasmid NtHMGR2-EcoRI-R CGGAATTCCGGTTAGGAGGATGCCTTTGTGAC Construction of the pBAD-H6-CatHMGR2 plasmid N6 NNNNNN Reverse transcription random hexamers dT18 TTTTTTTTTTTTTTTTTTVN Reverse transcription Q-actin-F TGATAACGGAACAGGAATGG Quantitative RT-PCR Q-actin-R TCGAGGTCGACCAACAATAC Quantitative RT-PCR Q-EF2-F TGCTGGTACACAAGCTCATCAA Quantitative RT-PCR Q-EF2-R AGTCACTGCCTGCTTCAAACC Quantitative RT-PCR Q-α-F GCTATTCCGTTAAACCCTGGAAA Quantitative RT-PCR Q-α-R CCCAGCAATGCGATCAACA Quantitative RT-PCR Q-βF-F CGTCAAGTTCGGGAGATATACGA Quantitative RT-PCR Q-βF-R GTGCTTATCACGTTGAAGCTCTAAGAT Quantitative RT-PCR Q-βGG-F CTGGAGTGGCATTGACAAGG Quantitative RT-PCR Q-βGG-R GTGGCACCACCATGTGATTC Quantitative RT-PCR Q-HMGR1-F GGCATTAGTCATGTGGAGAAAG Quantitative RT-PCR Q-HMGR1-R CTCACATGCCTTCATAGAAAGAATACA Quantitative RT-PCR Q-HMGR2-F TCAGGACCCAGCTCAGAACATA Quantitative RT-PCR Q-HMGR2-R TCAATGGAAGGCATTGTAACAGAA Quantitative RT-PCR 11 Figure S1. GC-MS spectra of (1S,2E,4S,6R,7E,11E)-2,7,11-cembratriene-4,6-diol (A) and capsidiol (B). 12 Figure S2. Ultra-performance liquid chromatography coupled with tandem mass spectrometry (UHPLC-MS/MS) spectra of capsidiol. A. Single ion recording chromatograms of untreated leaf-disks or elicited for 4 h or 18 h. The accumulation of capsidiol is indicated. B. MS fragmentation spectrum. ES+ scan of the compound with a retention time of 3.99 min corresponding to capsidiol (FW: 236.34986). 13 Figure S3. Subcellular distribution of the fluorescence observed by confocal microscopy in tobacco BY-2 cells expressing GFP-BD-CVIL and treated with different inhibitors used in this study. Illustrated pictures are representative of the majority of observed cells under each condition. Control, untreated cells; S-Ca: S-carvone (1 mM); Fol: farnesol (20 µM); GGol: geranylgeraniol (20 µM); PFT-I: PFT Inhibitor I (60 µM); GGti: GGti-2133 (60 µM); Fos: fosmidomycin (100 µM); MV: mevinolin (10 µM). Cell suspensions were shacked (130 rpm) for 18 h in six well-plates at 26°C in the dark. White bar = 20 µm. 14 Figure S4. Evaluation of IC50 values for the inhibition of Nt-PPTases initial velocities by S-carvone. SDS-PAGE (Coomassie blue stained) of total protein extracts of E. coli cells in which PPTases were overexpressed. The corresponding purified heterodimeric enzymes are also illustrated with the subunit Nt-α (41 kDa), Nt-βF (51 kDa) and Nt-βGG (40 kDa). S: supernatant; E250: elution with 250 mM imidazole. The fraction S was used to determine initial velocities (V0) of PPTases in the presence of increasing concentrations of S-carvone using a fluorimetric assay. PFT activity was measured with Dansyl-GCVIM and FPP as substrates, while PGGT-I activity was measured with Dansyl-GCVIL and GGPP as substrates. Percentages of residual activities were calculated and IC50 determined (IC50PFT = 1.4 mM). The IC50PGGT-I could not be determined, as it appeared that for concentrations < 4 mM, V0 were activated. Radio assays using untreated tobacco BY-2 protein extracts were performed as described in the Materials and Methods section using His6-GFP-BDCVIM/[3H]FPP as substrates for PFT or His6-GFP-BD-CVIL/[3H]GGPP to evaluate PGGT-I activity. Increasing concentrations of S-carvone were added in vitro. 15
© Copyright 2026 Paperzz