East Tennessee State University
Digital Commons @ East
Tennessee State University
Electronic Theses and Dissertations
5-2015
Identification of Plant Transcription Factors that
Play a Role in Triacylglycerol Biosynthesis
Parker Dabbs
East Tennessee State University
Follow this and additional works at: http://dc.etsu.edu/etd
Recommended Citation
Dabbs, Parker, "Identification of Plant Transcription Factors that Play a Role in Triacylglycerol Biosynthesis" (2015). Electronic Theses
and Dissertations. Paper 2496. http://dc.etsu.edu/etd/2496
This Thesis - Open Access is brought to you for free and open access by Digital Commons @ East Tennessee State University. It has been accepted for
inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more
information, please contact [email protected].
Identification of Plant Transcription Factors that Play a Role in Triacylglycerol Biosynthesis
_____________________
A thesis
presented to
the faculty of the Department of Biological Sciences
East Tennessee State University
In partial fulfillment
of the requirements for the degree
Master of Science in Biology
_____________________
by
Parker Dabbs
May 2015
_____________________
Aruna Kilaru, Ph.D., Chair
Lev Yampolsky, Ph. D.
Cecilia McIntosh, Ph. D.
Keywords: avocado, triacylglycerol, lipid biosynthesis, mesocarp, WRINKLED
ABSTRACT
Identification of Plant Transcription Factors that Play a Role in Triacylglycerol Biosynthesis
by
Parker Dabbs
This work identifies transcription factors (TF) controlling triacylglycerol (TAG) synthesis and
accumulation in plant tissues. TAG plays vital role in plants and are used by humans. Most
plants accumulate oil in the seed, but some species accumulate oil in other tissues. The
Wrinkled1 (WRI1) TF has been shown to regulate oil accumulation in multiple species and
tissues. Here, four WRI homologues in avocado were identified, their phylogeny was examined
and three of them were cloned into expression vectors for further characterization. However,
WRI1 likely does not act alone in regulation of TAG accumulation in plants. Additional
candidate TFs were identified by using transcriptome data from a variety of species, and cloned
into expression vectors. Future studies will be able to use this information to better understand
regulation of TAG accumulation, which will allow increased oil accumulation in plants for
various human uses.
2
ACKNOWLEDGEMENTS
I would like to thank my advisor and thesis committee chair Dr. Aruna Kilaru for her
support during my time in the lab. I would also like to thank my committee members Dr. Lev
Yampolsky and Dr. Cecilia McIntosh for their valuable guidance and input on the thesis project.
I would also like to thank my fellow lab members for their help and assistance within the lab.
I thank Dr. John Ohlrogge, Michigan State University, for providing the transcriptome
data, and also acknowledge all the other individuals who worked to collect these data. I would
like to thank Dr. Mary Lu Arpaia, University of California at Riverside, for providing the
avocado fruits, and Dr. Sanjaya, Michigan State University, for Arabidopsis seeds.
I thank the support in the form of the Graduate Assistantship and the Fraley’s Memorial
Award from the Department of Biological Sciences, East Tennessee State University (ETSU). I
would also like to thank the ETSU School of Graduate Studies for providing funding through the
Student Research Grant and The James H. Quillen Scholarship. Additional funding for this work
was provided by the Sigma-Xi Grants-in-Aid of Research Award (2014) and ETSU Research
Development Committee.
3
TABLE OF CONTENTS
Page
ABSTRACT .................................................................................................................................... 1
ACKNOWLEDGEMENTS ............................................................................................................ 3
LIST OF TABLES .......................................................................................................................... 7
LIST OF FIGURES ........................................................................................................................ 8
Chapter
1. INTRODUCTION ...................................................................................................................... 9
Triacylglycerol Synthesis........................................................................................................ 10
Fatty Acid Synthesis ......................................................................................................... 10
Triacylglycerol Assembly ................................................................................................. 12
Triacylglycerol Storage ..................................................................................................... 14
Transcription Factors Controlling TAG Biosynthesis ............................................................ 15
Master Regulators of Seed Maturation ............................................................................. 17
WRI1 Transcription Factor ............................................................................................... 18
TAG Production and Function in Various Plant Tissues ........................................................ 20
The Roles of TAG in Plants .............................................................................................. 20
TAG in Seed Tissues ........................................................................................................ 20
TAG in Non-seed Tissues ................................................................................................. 21
Avocado Model ................................................................................................................. 22
Human Uses of Plant Oils ....................................................................................................... 23
Hypothesis, Rationale, and Specific Aims .............................................................................. 24
2. MATERIALS AND METHODS .............................................................................................. 26
4
Plant Material .......................................................................................................................... 26
Extraction of RNA .................................................................................................................. 26
Cloning of Avocado WRI Homologues .................................................................................. 26
Construction of WRI Gene Phylogeny ................................................................................... 28
Data Analysis for Identification of Candidate Transcription Factors ..................................... 28
Cloning of Candidate Genes ................................................................................................... 30
3. RESULTS ................................................................................................................................. 32
Identification of Avocado WRI Homologues ......................................................................... 32
A Homolog of AtWRI1 Shows High Expression During Oil Accumulation in Avocado
Mesocarp ........................................................................................................................... 32
Homologues of WRI Gene Family Are Also Highly Expressed in Avocado Mesocarp .. 33
Three Avocado WRI Homologues Were Cloned for Future Validation of Their Role in
Oil Biosynthesis ................................................................................................................ 34
WRI Phylogeny Shows Multiple Gene Duplications with WRI2 Appearing to be the
Oldest Form of the WRI Gene .......................................................................................... 38
Identification of Transcription Factors That May Play a Role in Oil Accumulation ............. 40
Transcription Factors That Were Differentially Expressed Between Oil-rich Seed and
Non-seed Tissues were Identified ..................................................................................... 40
Three Transcriptions Factors Were Selected for Cloning and Future Validation of Their
Role in Oil Biosynthesis .................................................................................................. 41
Cloning of Candidates for Validation of Their Role in Oil Biosynthesis ......................... 42
4. DISCUSSION ........................................................................................................................... 46
Three WRINKLED Homologues are Highly Expressed in Avocado Mesocarp Tissue ........ 46
5
The WRINKLED Gene Family Appears to Have Undergone Multiple Duplications and
Likely has Conserved Function .............................................................................................. 46
Three WRINKLED Genes Highly Expressed in Avocado Mesocarp Cloned into Gateway
Cloning System ....................................................................................................................... 47
Transcription Factor Candidates Identified that May Play a Role in TAG Accumulation ..... 47
Three Candidate Transcription Factors Cloned into Gateway Cloning System ..................... 48
5. CONCLUSIONS AND FUTURE DIRECTIONS ................................................................... 49
REFERENCES ............................................................................................................................. 51
APPENDICES .............................................................................................................................. 60
Appendix A: R Scripts Used in Analyzing Transcriptome Data ....................................... 60
Appendix B: Entry Clone Sequences Obtained from Molecular Biology Core Facility ... 67
VITA ............................................................................................................................................. 72
6
LIST OF TABLES
Table
Page
1. Gene Specific Primers Used for Gateway Cloning ....................................................... 27
2. Candidate Transcription Factors Identified by Transcriptome Analysis ....................... 41
7
LIST OF FIGURES
Figure
Page
1. A Schematic Pathway of Fatty Acid Synthesis in Plants............................................... 11
2. A Schematic Pathway of Triacylglycerol Assembly in Plants ...................................... 13
3. Transcriptional Regulation of Triacylglycerol Synthesis in Plants ............................... 16
4. Phylogenetic Tree of Species for Which Transcriptome Data Has Been Obtained ...... 23
5. Expression Levels for Avocado WRI Homologues ....................................................... 33
6. Cloning of PaWRI1 into Entry Vector ........................................................................... 35
7. Cloning of PaWRI2 into Entry Vector ........................................................................... 36
8. Cloning of PaWRI3 into Entry Vector ........................................................................... 37
9. Phylogenetic Analysis of the WRI Family of Genes ...................................................... 39
10. Cloning of C3H into Entry Vector ................................................................................. 43
11. Cloning of NAC014 into Entry Vector........................................................................... 44
12. Cloning of OZF into Entry Vector ................................................................................. 45
8
CHAPTER 1
INTRODUCTION
Triacylglycerols (TAG) are a class of lipid molecules composed of three fatty acyl chains
esterified to a glycerol backbone. Many plants produce substantial amounts of these compounds
in various tissues and for different purposes. Humans also utilize the TAG produced by plants for
food products, supplements, and a multitude of industrial applications (Durrett et al.
2008;Carlsson 2009). Due to the increasing utilization of these plant products, many people
today are interested in increasing TAG production in different plants to produce greater
quantities. However in order to increase the yield of TAGs in plants, the pathway that produces
these compounds and the mechanisms that control it must be better understood. Arabidopsis
thaliana has been used as a model plant to study this pathway and its control mechanisms, and it
has been utilized to understand many of the important factors (Harwood 2005;Baud andLepiniec
2009;Weselake et al. 2009). In Arabidopsis seeds the control of TAG production and storage is
directly regulated by WRINKLED1 (WRI1) (Focks andBenning 1998;Cernac andBenning
2004), with master regulators of seed maturation such as FUSCA3 (FUS3), LEAFYCOTYLEDON 1 (LEC1) and 2 (LEC2), LEC1-Like (L1L), and ABSCIC ACID INSENSITIVE
3 (ABI3) acting upstream of WRI1 (Meinke et al. 1994;West et al. 1994;Kagaya et al. 2005;Mu
et al. 2008;Yamamoto et al. 2010). WRI1-like genes have also been shown to have similar roles
in regulating oil accumulation in other plant seeds, such as maize and Brassica napus (Liu et al.
2010;Pouvreau et al. 2011). Despite the absence of seed maturation transcription factors, a
WRI1 homologue also exerts control over the TAG biosynthesis pathway in non-seed tissues
9
(Ma et al. 2013) and the factors that regulate WRI1 in such non-seed tissues are yet to be
elucidated.
Triacylglycerol Synthesis
Triacylglycerol biosynthesis can be divided into two separate sets of reactions that
primarily take place in two different cellular compartments. The first set involves the production
of fatty acids from precursor carbon molecules. In plants, de novo fatty acid synthesis primarily
takes place in the plastid (Harwood 2005). These fatty acids are then transported to the
endoplasmic reticulum (ER) where they are sequentially esterified to a glycerol-3-phosphate
backbone to form TAG (Weselake 2009).
Fatty Acid Synthesis
The fatty acid, or acyl, chains of TAG are primarily produced in the plastid. The
reactions of this pathway have been well understood for decades and are highly conserved
(Harwood 2005). The precursor of fatty acid synthesis, acetyl-CoA, is produced from pyruvate
through the glycolytic pathway. Evidence from a variety of sources suggests that the pyruvate
used may be from glycolysis in the cytosol or the plastid, with cytosolic pyruvate or
phosphoenolpyruvate being imported into the plastid and then converted to acetyl-CoA
(Harwood 2005). A pyruvate dehydrogenase enzyme complex converts the pyruvate to acetylCoA, which is then converted to malonyl-CoA by a multi-subunit acetyl-CoA carboxylase
(ACCase) (Johnston et al. 1997;Mooney et al. 1999;Reverdatto et al. 1999). The ACCase
enzyme of plastids is composed of multiple subunits encoded by different genes and is
considered to catalyze the first committed step of fatty acid synthesis (Reverdatto et al.
1999;Harwood 2005). The ACCase complex of plastids contains biotin carboxylase, biotin
10
carboxyl carrier protein (BCCP), and carboxyl transferase subunits (Kannangara andStumpf
1972;Reverdatto et al. 1999). The ACCase has been considered a key regulatory enzyme in fatty
acid synthesis and it has been shown that WRI1 acts to regulate the expression of the BCCP2
gene in A. thaliana (Baud et al. 2009) (Figure 1).
Malonyl-CoA is converted to malonyl-ACP by a malonyl-CoA:ACP acyltransferase
(Harwood 2005). The malonyl-ACP is then condensed with acetyl-CoA in the first reaction of a
Figure 1. A schematic pathway of fatty acid synthesis in plants. The
reactions of fatty acid synthesis with enzymes and the structures of
intermediates. The initial reactions up to pyruvate synthesis take place in
either the cytoplasm or the plastid. However, only plastid pyruvate
participates in subsequent reactions to generate Acyl-CoA. Note that KASI
initiates fatty acid synthesis for chain lengths between 6 and 16 carbons
while KASII initiates fatty acid synthesis of 18 carbon long fatty acids.
ACP, acyl carrier protein. Proteins in red are regulated by the
11
cycle that extends acyl chains of fatty acids. Subsequent reactions are catalyzed by a multitude
of enzymes that form a large dissociable multi-enzyme complex known as fatty acid synthase
(FAS) (Harwood 2005). The initial acylation is carried out by β-ketoacyl-ACP synthase (KAS)
III, which works specifically to acylate malonyl-ACP with acetyl-CoA (Clough et al.
1992;Jaworski et al. 1993). After this β-ketoacyl-ACP reductase carries out the first reduction
reaction, β-hydroxyacyl-ACP dehydrogenase carries out the dehydration reaction, and then
enoyl-ACP reductase carries out the second reduction reaction (Harwood 2005). KAS I is then
utilized for further acylations up to a 16 carbon fatty acid (Siggaard-Andersen et al.
1991;Harwood 2005). KASII acylates palmitoyl-ACP (16:0) to form stearoyl-CoA (18:0) and
this enzyme is responsible for the ratio of 16C:18C fatty acids in plants (Harwood 1996).
Termination of fatty acid synthesis can be carried out in various ways within plants, but for fatty
acids bound for TAG production in the ER, the termination procedure involves hydrolysis by
acyl-ACP thioesterases to form acyl-CoA moieties (Slabas et al. 1990;Hellyer et al.
1992;Harwood 2005).
Flux and transcriptome analysis of oil palm mesocarp suggests that the reactions of fatty
acid synthesis are more important in regulating oil accumulation than the later reactions of lipid
assembly (Ramli et al. 2002;Bourgis et al. 2011). This suggests that these enzymes are likely
targeted by regulatory mechanisms in order to control TAG levels in plants and WRI1 is the only
known direct regulator of enzymes of late glycolysis and fatty acid synthesis (Baud et al. 2009).
Triacylglycerol Assembly
After synthesis of fatty acids in the plastid these compounds are exported to the ER
where they act as precursors for production of both storage and membrane lipids. The first three
reactions that lead to the production of diacylglycerol (DAG) are shared by the two pathways
12
Figure 2. A schematic pathway of triacylglycerol assembly in plants. The acyl-CoA pool
in the endoplasmic reticulum is primarily provided by de novo fatty acid synthesis in the
plastid. Proteins in ‘red’ show distinct expression profiles in TAG accumulating tissues or
dramatically increase TAG accumulation when overexpressed. Abbreviations: G3P,
glycerol-3-phosphate; LPA, lysophosphatidic acid; PA, phosphatidic acid; DAG,
diacylglycerol; MAG, monoacylglycerol; TAG , triacylglycerol; PC, phosphatidylcholine;
LPC, lysophosphatidic acid. GPAT, G3P acyltransferase; LPAAT, LPA acyltransferase;
PAP, PA phosphatase; DGAT, DAG acyltransferase; DGTA, DAG tranacylase; CPT,
CDP-choline:DAG cholinephosphotransferase
(Figure 2). First sn-glycerol-3-phosphate acyltransferase (GPAT), which many plants have a
multitude of copies for, catalyzes the addition of an acyl chain from acyl-CoA to the sn1 position
of glycerol-3-phosphate to form lysophosphatidic acid (LPA) (Weselake 2009). This LPA
intermediate is then acylated at the sn2 position through the action of LPA acyltransferase
(LPAAT), another gene family with multiple homologues in plants, to form phosphatidic acid
13
(PA) (Weselake 2009). The PA is then dephosphorylated by PA phosphatase (PAP) to form
DAG (Pierrugues et al. 2001;Weselake 2009). DAG can then be utilized to form triacylglycerol
by a variety of enzymes or in the formation of phosphatidylcholine (PC) (Weselake 2009). The
formation of PC from DAG is catalyzed by the enzyme cytidine diphosphate choline:1,2diacylglycerol cholinephosphotransferase (CPT) (Weselake 2009).
The most straightforward reaction of TAG synthesis is catalyzed by diacylglycerol
acyltransferase (DGAT), which utilizes acyl-CoA to acylate the sn-3 position of DAG to form
TAG (Routaboul et al. 1999;Zou et al. 1999;Zhou et al. 2013). Another enzyme known as
diacylglycerol transacylase (DGTA) acts on two different DAG molecules to produce TAG and
monoacylglycerol (MAG) (Stobart et al. 1997). Finally, DAG and PC may act as substrates for
phosphatidylcholine acyltransferase (PDAT) to produce TAG and LPA (Dahlqvist et al. 2000).
The incorporation of PC acyl chains into the TAG pool is important because desaturases (other
than the plastid desaturase that forms 18:1 fatty acids) and fatty acid elongases act on acyl chains
attached to PC (Weselake 2009). Thus, the incorporation of most desaturated fatty acids or chain
lengths over 18 into TAG requires the channeling of fatty acids through the PC pool.
Currently it is not known how the enzymes of TAG assembly are actually regulated and
which, if any, transcription factors might play a role in their control. However, some of the
proteins and enzymes involved in these later steps show differential regulation in TAG
accumulating tissue or cause increased TAG accumulation in overexpression lines (Jako et al.
2001;Banilas et al. 2011;Troncoso-Ponce et al. 2011).
Triacylglycerol Storage
Once TAGs have been assembled in the ER they must be stored in the cell. In plants,
TAGs are stored in small compartments known as oil bodies. These compartments are different
14
from most other cellular compartments in that they have a single layer phospholipid membrane,
with the polar head groups in contact with the cytosol and the non-polar tails in contact with the
internal lipids (Yatsu andJacks 1972). Oleosins are small proteins unique to plants that coat the
oil bodies, helping to determine size and shape and preventing coalescence of the oil bodies
(Tzen andHuang 1992;Leprince et al. 1997;Hsieh andHuang 2004). Much like TAG assembly
enzymes, it is not known what transcription factors directly regulate oleosin expression levels.
However A. thaliana has at least 17 oleosin genes, which are differentially expressed in various
tissues, suggesting that these genes are highly regulated even within a single plant species (Hsieh
andHuang 2004). Oleosins are not highly expressed in non-seed oil accumulating tissues such as
the mesocarp of olive, oil palm, and avocado (Murphy 2012). Recently however lipid droplet
associated proteins have been identified in these tissues that may play a similar role (Horn et al.
2013).
Transcription Factors Controlling TAG Biosynthesis
The majority of research on transcription factors that control TAG biosynthesis has been
conducted on seed tissues. In plants, the master regulators of embryogenesis and seed maturation
such as LEC1, L1L, LEC2, FUS3, and ABI3 play a role in controlling oil accumulation, but
these master regulators act to regulate TAG synthesis through downstream transcription factors
(Kagaya et al. 2005;Mu et al. 2008;Baud et al. 2009). The most understood downstream
regulator of lipid biosynthesis in seeds is the WRI1 protein, as discussed later. In seeds, WRI1
has been shown to play a role in controlling genes involved in late glycolysis and fatty acid
synthesis (Baud et al. 2009). Studies have also shown that WRI1 homologues play roles in TAG
accumulation outside of seed tissues in other plants (Ma et al. 2013). WRI1 homologues outside
of seed tissues are likely regulated by currently unknown upstream transcription factors, since
15
these WRI genes are highly expressed but the master regulators of seed tissue are not expressed
outside of seed tissue (Bourgis et al. 2011;Kilaru 2015). Other transcription factors are thought to
play a role in regulating transcript levels involved in later steps of TAG accumulation and
storage, such as the acyltransferases involved in TAG assembly and the oleosins needed to form
oil bodies due to these genes often being differentially expressed during oil accumulation
(Dussert et al. 2013;Kilaru 2015).
Transcription factors that play a role in regulating TAG assembly enzymes are yet to be
elucidated (Figure 3). Recent analysis showed that, in seeds, upstream regions of genes of TAG
Figure 3. Transcriptional regulation of triacylglycerol synthesis in plants. It is
currently not known what (if any) transcription factors regulate the proteins
involved with TAG assembly and TAG storage. It is also not known what
transcription factors might regulate WRI1 genes in non-seed tissues that
accumulate oil. OPPP, oxidative pentose phosphate pathway
16
storage are overrepresented for binding motifs for B3-domain containing factors and bZIP
factors (Peng andWeselake 2011). Additionally, in some plant species, such as A. thaliana and B.
napus, increases in the activity of various acyltransferase enzymes has been shown to increase
oil content (Zou et al. 1997;Weselake et al. 2008;Xu et al. 2008;Baud andLepiniec 2009). This
evidence suggests that regulation of TAG assembly enzymes exerts control over TAG content. It
is necessary to discover which transcription factors may be acting to alter expression levels of
these TAG assembly enzymes in plants in order to better understand oil accumulation.
Master Regulators of Seed Maturation
While this project is primarily focused on regulation of oil accumulation in non-seed
tissues, most of the regulatory factors currently known were discovered in oilseed plants. It is
important to understand these factors since, much like WRI1, there may be some relationship
between them and the control mechanisms in non-seed tissues. As stated before, a multitude of
transcription factors affect oil accumulation in seed tissues. These transcription factors are often
referred to as master regulators of seed maturation (LEC1, LEC2, FUS3, ABI3) and unlike
WRI1, mutations in these genes often have a variety of effects beyond altered oil content, such as
cotyledons displaying characteristics of leaves, lower desiccation tolerance, and accumulation of
abnormal levels of pigments (Santos‐Mendoza et al. 2008). These transcription factors have been
shown to regulate each other locally and their effects on seed development are dependent upon
the downstream activity of other transcription factors (Kagaya et al. 2005;To et al. 2006;Mu et
al. 2008). They together create a network of regulation, with each transcription factor regulating
genes involved in a variety of seed developmental pathways, the other master regulators of seed
maturation, and even themselves (Santos‐Mendoza et al. 2008).
17
Current evidence suggests that of the master regulators LEC2, and to an extent LEC1,
exert direct control over WRI1 (Baud et al. 2007;Santos‐Mendoza et al. 2008). Consistent with
their redundant regulatory actions, LEC2, FUS3, and ABI3 all belong to the B3 family of
transcription factors and all bind to an RY motif present in the promoter of target genes, but
other regulatory elements are required for proper expression patterns of the target genes (Santos‐
Mendoza et al. 2008). LEC1 has homology with the CAAT box-binding factors (CBFs) (Lotan
et al. 1998). The exact regulatory elements controlling WRI1 transcription have not been
discovered in either seed or non-seed tissue.
WRI1 Transcription Factor
The WRI1 gene was originally discovered as a low seed oil mutant in Arabidopsis
thaliana that showed impairment in seed development (Focks andBenning 1998). The
homozygous wri1 mutant showed 80% lower seed oil content, wrinkled seed coats, and
impairment in seed germination and seedling establishment (Focks andBenning 1998). The gene
was later shown to code for a transcription factor of the plant specific AP2/EREBP family, which
acts to regulate oil accumulation in seed tissues (Cernac andBenning 2004). Expression studies
suggest that WRI1 primarily regulates genes involved in late glycolysis and fatty acid synthesis
(Figure 1) such as BCCP (a subunit of ACCase), enoyl-ACP reductase, β-ketoacyl-ACP
reductase, fatty acid desaturase 2, plastidial pyruvate kinase, sucrose synthase, pyruvate
dehydrogenase, and acyl-carrier protein (Ruuska et al. 2002;Baud et al. 2007;To et al. 2012).
WRI1 orthologues in Brassica napus and Zea mays have even been shown to regulate many of
the same proteins involved in glycolysis and fatty acid synthesis (Liu et al. 2010;Pouvreau et al.
2011).
18
Currently four WRI genes (WRI1, WRI2, WRI3, and WRI4), all belonging to the
AP2/EREBP family, have been identified in arabidopsis (To et al. 2012). Their exact functions,
however, are not well understood; WRI3 and WRI4 are capable of complementing the wri1
mutant, but mutations in these two genes do not affect seed oil accumulation levels. WRI3 and
WRI4 are expressed more highly in other tissues of the plant, such as flowers, stems and roots,
and are thought to play a role in tissue specific synthesis of fatty acids (To et al. 2012). No
function for WRI2 was discovered in the study (To et al. 2012). A similar phenomenon was seen
in maize, where a duplication event has created two WRI1 genes referred to as ZmWRI1a and
ZmWRI1b (Pouvreau et al. 2011). While the ZmWRI1a gene clearly regulates oil accumulation
in seeds, and the ZmWRI1b gene rescues Arabidopsis wri1 mutants, differential expression
patterns suggest unique roles for the two duplicates of the genes (Pouvreau et al. 2011). Their
protein sequences are more closely related to WRI1 than to any of the other WRI family
members in Arabidopsis; maize does have orthologues to WRI2, WRI3, and WRI4 (Pouvreau et
al. 2011).
Studies have also shown that unlike the other transcription factors mentioned above,
WRI1 homologues likely play a role in directing TAG accumulation outside of the developing
seed. A WRI1 homologue from oil palm has been shown to be highly expressed, compared to
the closely related species date palm (which does not accumulate oil), and coordinately with an
increase in TAG levels (Bourgis et al. 2011). The WRI1 homologue from oil palm has also been
shown to rescue the wri1 mutant phenotype of A. thaliana (Ma et al. 2013). Interestingly the WRI
homologues found in non-seed oil accumulating plants are most closely related to Arabidopsis
WRI1 according to amino acid sequence and not to any of the other family members in
19
Arabidopsis (Bourgis et al. 2011). WRI1 genes play a key role in oil accumulation in a variety of
plant tissues as well as a wide range of plant species.
TAG Production and Function in Various Plant Tissues
The Roles of TAG in Plants
The primary role of TAGs in most plants is as a seed storage compound for energy
through the process of germination. When the seed germinates it utilizes the stored TAG to
provide necessary energy and as a carbon source until the seedling is capable of photosynthesis
(Graham 2008). Storage oil, however, has also been detected in other tissues of plant species and
may play a number of additional roles. For example, mutations in enzymes of the lipid
biosynthesis pathway have been shown to affect pollen performance and tapetum development,
suggesting a role for lipids in these processes (Zheng et al. 2003;Zhang et al. 2009). Recent
studies have also indicated that TAG may be used as a diurnal photosynthetic store in the leaves
of crabapple plants, and evidence suggests it may play a similar role in other plant species (Lin
andOliver 2008).
Various plant species accumulate different levels of oils in different tissues. This project
primarily focuses on non-seed oil accumulation, but below is a description of the oil levels found
in the various plants that accumulate oil in either seed or non-seed tissue that are used in the
transcriptome analysis performed to determine candidates for this project.
TAG in Seed Tissues
While A. thaliana is not an oil crop, it has been utilized for the study of factors
controlling TAG accumulation as it accumulates approximately 35% oil in the seed (Li et al.
20
2006). Arabidopsis is related to the oilseed crop B. napus, which accumulates up to 45% oil by
dry weight (Goering et al. 1965). Ricinus communis (Castor) is another oilseed crop that
produces around 60% oil in its seeds (Canvin 1963). Euonymus alatus and Tropaeolum majus
are not oil crops but both are oilseeds, which accumulate 50% and 10% oil by dry weight,
respectively (Troncoso‐Ponce et al. 2011). While this study primarily focusese on transcription
factors regulating TAG accumulation outside of the seed tissue, it is important to include oil
accumulating seed tissue as well in order to find transcription factors working to control oil
levels solely in non-seed tissues. While overexpression of seed maturation transcription factors
such as LEC1 have been shown to increase oil content in seeds of Zea mays, this can also cause
detrimental side effects in the plant (Shen et al. 2010). However, in the same study
overexpression of ZmWRI1 showed increased oil accumulation without the detrimental effects
associated with ZmLEC1 overexpression such as poor germination and stunted growth. This
suggests that targeted increases in fatty acid synthesis and TAG accumulation can create high
yield oil crops without introducing negative agronomic traits into these plants. Studying oil
accumulation in both seed and non-seed tissues may aid in teasing out the factors that are solely
responsible for regulating oil accumulation.
TAG in Non-seed Tissues
Although the majority of what is currently known about TAG production and control
over the TAG synthesis pathway is derived from studies involving arabidopsis and other oil seed
species, many different plants accumulate TAG in other tissues as well. This includes the
mesocarp of avocado and oil palm, which can accumulate up to 70% and 90% oil by dry weight,
respectively (Platt-Aloia andThomson 1981;Ngando-Ebongue et al. 2012). The tubers of yellow
21
nutsedge (Cyperus esculentus) also accumulate high levels of TAG compared to other roots, with
values between 20-36% oil by dry weight (Linssen et al. 1989). Bayberry plants are known to
produce a unique waxy coating on leaves and fruit which is composed of TAG molecules
(Harlow et al. 1965).
While most of the studies analyzing transcriptional regulation of oil accumulation have
involved seed tissues, recently some insight into control in non-seed tissues has been obtained.
The transcriptome for oil palm mesocarp showed high expression levels of WRI1 homologues,
and subsequent experiments demonstrated that the oil palm WRI1 homologue rescues the
Arabidopsis wri1-1 (Bourgis et al. 2011;Ma et al. 2013). The studies also found that seedspecific transcription factors responsible for regulating WRI1 in the seed are not expressed in
non-seed tissues even when WRI1 is highly expressed. The transcriptome data from these plant
tissues has already aided in discovering what factors allow for increased oil content in these
various tissues, and further analysis should reveal other factors playing a role in regulating oil
content.
Avocado Model
While most of the work done with WRI1 so far has involved either seed tissue or nonseed tissue of more recently developed plant species (Figure 4), the avocado belongs to the group
of basal angiosperm, the ancestors of all flowering plants (Heywood 1993). If the WRI1 gene
serves the same function in avocado mesocarp as it does in the seeds and mesocarp of others, it
would show that this mechanism of TAG regulation has been highly conserved in much of the
plant kingdom. By analyzing the avocado transcriptome data and verification of candidates, we
22
Figure 4. Phylogenetic tree of species for which transcriptome data has been
obtained. Constructed using NCBI Taxonomy Common Tree and visualized
using Archaeopteryx
(https://sites.google.com/site/cmzmasek/home/software/archaeopteryx). The
tree shows the relatively greater age of Persea americana compared to the
other species; it being a basal angiosperm.
may also elucidate what other regulatory elements of TAG accumulation may be conserved
across the plant kingdom.
Human Uses of Plant Oils
Humans have developed a variety of uses for plant oils. The oldest human use of plant
oils is for consumption by both humans and livestock, either by eating whole plants or harvesting
oils directly. However humans have found a variety of other uses for plant oils as well. Today
around 15% of plant oil production is used as industrial feedstock for the production of
surfactants, soaps, detergents, lubricants, solvents, paints, cosmetics and chemical feedstocks
23
(Carlsson 2009). Plant oils have also recently attracted attention as a source of biofuels to help
minimize human use of fossil fuels (Durrett et al. 2008). New interest has also been sparked in
the production of unusual fatty acids as replacements for petroleum products in industrial and
chemical feedstocks (Carlsson 2009). However, these new uses of plant oils could put greater
strains on current production levels, meaning that oil production will need to be increased.
Current interest lies in both increasing the yield of oil crops and increasing oil production from
crops that are not currently considered as oil crops (Carlsson 2009). For either of these
approaches to work, a greater understanding of the regulation of TAG biosynthesis will be
required.
Hypothesis, Rationale, and Specific Aims
Using transcriptome data from a variety of plant species, candidate transcription factors
will be identified that may play a role in TAG synthesis in plants. Transcriptome data from a
variety of plant tissues from various species have been collected, including plants that
accumulate oil in seed or non-seed tissue and also plants that do not accumulate significant levels
of oil (Figure 4). Comparative analysis of transcript levels for about 1500 transcription factors,
across species and tissues, is expected to allow us to identify candidates that are likely
responsible for oil accumulation in seed and non-seed tissues and also those that may be tissuespecific. This study will show that transcriptional regulation of oil biosynthesis, in part, is likely
to be tissue-specific, but WRI1 function is highly conserved across species. To show this, a
comparative approach using in silico analysis will be taken to analyze transcriptome data for 10
different plant species and 14 different tissue types and generate a list of potential candidate
transcription factors responsible for regulating oil accumulation outside of seed tissue. The
24
transcriptome data will also be used to identify WRI-like genes in avocado and examine the
expression levels of these genes in avocado mesocarp to determine if the WRI gene function is
likely conserved in this species. Finally the WRI-like genes expressed in avocado mesocarp and
selected identified candidates will be cloned into entry vectors. These entry vectors will be used
in future experiments to determine if these genes influence oil accumulation in plants.
25
CHAPTER 2
MATERIALS AND METHODS
Plant Material
Avocado fruits of the ‘Hass’ cultivar harvested from California were used for all avocado
tissue samples, which were collected during the mid to late stages of fruit development (Sung
2013;Kilaru 2015). For reverse transcription reactions of avocado genes, RNA previously
extracted from late developmental stage of Hass mesocarp tissue was used.
Arabidopsis Col-2 plants were germinated and grown in soil with 16/8 hour light/dark
cycle at 20 °C and watered regularly. Desired parts of the plant were removed and weighed
before being used for RNA extraction.
Extraction of RNA
Total RNA was extracted from mature arabidopsis siliques. For each extraction, 50-100
mg of tissue sample was ground by stainless steel beads of 3.2 mm diameter using a mini bead
beater (Biospec). RNA was then extracted using the plant mini RNA kit (Qiagen) according to
manufacturer protocols. Extracted RNA was examined using a Nanodrop-1000 to determine
quality and quantity and stored at -80 °C until further use.
Cloning of Avocado WRI Homologues
Avocado gene sequences were obtained from the avocado genome sequence project
(Ibarra-Laclette 2013). Gateway compatible primers were designed based on instructions
provided by Invitrogen. All avocado genes were cloned from late stage mesocarp RNA. Reverse
26
transcription reactions were performed using Gateway primers (Table 1) of the avocado gene and
Table 1. Gene Specific Primers Used for Gateway Cloning
agarose gels were run to determine proper size of the cDNA. The cDNA products were then
cloned into the pENTR/SD/D-TOPO Gateway entry vector from Invitrogen using the Gateway
TOPO cloning reaction. Plasmids were then transformed into OneShot TOP10 chemically
competent E. coli provided by Invitrogen. E. coli were plated on LB kanamycin (50 µg/mL)
plates and allowed to grow overnight. Colony PCR using M13 forward primer with gene specific
reverse or the M13 reverse primer with gene specific forward primer was done to confirm insert
and determine size and direction. Inserts were also confirmed by sequencing using M13 forward
and reverse primers at the ETSU Molecular Biology Core Facility.
27
Construction of WRI Gene Phylogeny
The evolutionary relationship of WRI genes in a monocot (Oryza sativa), dicot (A.
thaliana), basal angiosperm (P. americana) and bryophyte (Physcomitrella patens) was analyzed
by construction of a phylogenetic tree. The protein sequences for four AtWRI genes were
identified from the TAIR database and the avocado WRI-like amino acid sequence data was
provided by the Avocado Genome Sequencing Project (Ibarra-Laclette 2013). The homologues
of AtWRI genes in O. sativa and P. patens were identified using BLASTP (NCBI). In O. sativa,
two sequences that were nearly identical in amino acid sequence to both AtWRI3 and AtWRI4
were referred to as WRI3/4-1 and WRI3/4-2. An AP2 transcription factor from Chlamydomonas
reinhardi was used as the outgroup. A UPGMA tree was constructed with MEGA 6.0 using a
ClustalW alignment of protein sequences (Larkin et al. 2007). The robustness of the tree was
tested by bootstrap analysis with 1,000 replicates.
Accession numbers: AtWRI1 (NP_001030857.1); AtWRI2 (NP_001189729.1); AtWRI3
(NP_563990.1); AtWRI4 (NP_178088.2); OsWRI1 (ABA91302.1); OsWRI2 (BAO57769.1);
OsWRI3/4-1 (NP_001061917.1); OsWRI3/4-2 (BAD10030.1); PpWRI1-like (BAL04570.1);
PpWRI2-like (XP_001765028.1); PpWRI3-like (XP_001770958.1); PpWRI4-like
(XP_001764166.1); CrAP2 (XP_001699213.1).
Data Analysis for Identification of Candidate Transcription Factors
Transcriptome data for a variety of species and tissue types was provided by Dr.
Ohlrogge at Michigan State University (Bourgis et al. 2011;Troncoso‐Ponce et al. 2011). Data
was provided for C. esculentus root tissue, E. guineensis leaf tissue and mesocarp tissue, P.
dactylifera mesocarp tissue, T. majus seed tissue, B. napus seed tissue, A. thaliana seed tissue, E.
28
alatus seed tissue, R. communis seed tissue, Myrica pensylvanica mesocarp tissue, and P.
americana mesocarp tissue. Over 1,500 putative transcription factors were included in the
expression data. The expression profile data for transcription factors were imported to an excel
file which was then read into the R programming suite for analysis. R scripts were written that
allowed for the identification of transcription factor genes that met certain criteria (Appendix A).
Two different criteria, given below, were used to identify the candidates using the R program.
First, since WRI1 has been shown to regulate TAG accumulation in a variety of plants the
first approach used its expression levels as a reference point in the various plants. The
transcriptome data included developmental points for each tissue that coincided with oil
accumulation. The temporal profile for WRI1 orthologues during development was used in each
individual species to identify transcription factors expressed in a similar pattern. WRI1
orthologues were determined by the RNA-seq data. For non-seed oil accumulating plants such as
oil palm and avocado, any transcription factors that showed similar expression levels in non-oil
accumulating plants, such as date palm, were removed. After, genes generated by looking at
individual species were examined and transcription factors that appeared in a multitude of
species were retained.
Second, as a more generalized approach, the average expression level for all genes was
compared between oil accumulating non-seed tissue and all other tissues. The expression levels
of transcription factors for all time points in avocado mesocarp, oil palm mesocarp, and nutsedge
root were compared to the levels in all other tissues. Transcription factors that showed at least 2fold greater expression in oil accumulating non-seed tissues were retained.
All genes found through the initial analysis of the transcriptome were then examined by a
variety of bioinformatics tools. Coexpression analysis was done using ATTED-II
29
(http://atted.jp/) to determine which genes the candidate transcription factors were coexpressed
with in Arabidopsis thaliana. Genes of interest included enzymes of the fatty acid biosynthesis
pathway, enzymes of the TAG assembly pathway, and proteins associated with lipid bodies.
These genes were also examined using the Arabidopsis eFP browser
(http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi) to determine expression levels of the transcription
factors in various tissue types of arabidopsis. Genes of interest here were those highly expressed
in arabidopsis seed tissue, when TAG is accumulating, but not highly expressed in other tissue
types. The eFP browser was also used to determine which tissue to use when extracting RNA
from Arabidopsis.
Cloning of Candidate Genes
Three identified candidates were selected for validation and were isolated from
arabidopsis and cloned into Gateway entry vector. These cloned genes will be cloned into a
binary vector and used in later assays to determine if their expression increases oil accumulation.
These genes were AT2G19810, referred to as C3H after the Cys3His motif found in members of
this transcription factor family; AT1G33060, referred to as NAC014, a member of the large plant
NAC transcription factor family; and AT1G04990, referred to as OZF for the oxidative zinc
finger motif found in this transcription factor.
To produce cDNA of the C3H and OZF candidate genes, primers were designed for the
Gateway system (Table 1), and a reverse transcription reaction was used on arabidopsis RNA
samples. Both genes were cloned from RNA extracted from green siliques. RT-PCR reactions
were run using gene-specific primers designed for Gateway cloning (Table 1) and examined on
agarose gels to determine the product size. The cDNA products were then cloned into the
30
pENTR/SD/D-TOPO gateway plasmid from Invitrogen using the gateway TOPO cloning
reaction. Plasmids were then transformed into OneShot TOP10 chemically competent E. coli
provided by Invitrogen. E. coli were plated on LB kanamycin (50 µg/mL) plates and allowed to
grow overnight. Colony PCR using M13 forward primer with gene specific reverse or the M13
reverse primer with gene specific forward primer was done to confirm insert and determine size
and direction. Inserts were also confirmed by sequencing at the ETSU Molecular Biology Core
Facility (Appendix B), except for the OZF insert, which could not be successfully sequenced.
The pUNI51 plasmid bearing the NAC014 candidate gene was obtained from the
Arabidopsis Biological Resource Center. Gateway primers were used to amplify the NAC014
gene from the pUNI51 plasmid (Table 1). After cDNA of the gene was obtained the cloning
steps were performed as outlined above to obtain expression vectors bearing the NAC014 gene.
31
CHAPTER 3
RESULTS
Identification of Avocado WRI Homologues
A Homolog of AtWRI1 Shows High Expression During Oil Accumulation in Avocado Mesocarp
The avocado transcriptome was generated using Illumina RNA-seq. Data was collected
for five different stages of mesocarp development. The expression levels for WRI1-like were
high in avocado mesocarp, with an average expression level of 253 RPKM during the five
developmental stages examined, which correspond to mid to late stages of fruit development
(Figure 5). During these developmental stages the avocado fruit increases in overall weight and
accumulates lipids in the mesocarp (Sung 2013). Expression levels of PaWRI1-like also shows a
similar pattern to expression of genes it is known to regulate in Arabidopsis (BCCP2, KASII,
pyruvate dehydrogenase components) (Kilaru 2015). Homologues of genes that regulate WRI1 in
arabidopsis, such as the master regulators of seed development, however are not expressed in
avocado mesocarp during oil accumulation (Kilaru 2015). Similar results were also found for oil
palm (Elaeis guineensis) that accumulates high amounts of oil in non-seed tissue (Bourgis,
Kilaru et al. 2011). WRI1 is likely regulated by a separate pathway in avocado mesocarp, but
more research is needed to determine if this mechanism is conserved among different species
that accumulate high levels of oil in the mesocarp tissue.
32
Transcript Levels(RPKM)
420
360
300
240
Wri2
Wri3
Wri1
180
120
60
0
I
II
III
IV
V
Developmental Stage
Figure 5. Expression levels for avocado WRI homologues. Three homologues of the WRI
gene family were identified in avocado and their transcript levels during mesocarp
development were shown, as determined by RNA-seq analysis. RPKM: Reads per kilobase
per million mapped reads.
Homologues of WRI Gene Family Are Also Highly Expressed in Avocado Mesocarp
Recently three WRI paralogues (WRI2, WRI3 and WRI4) were recognized in Arabidopsis,
of which WRI3 and WRI4 compensated for the low fatty acid levels of the wri mutant (To,
Joubès et al. 2012). WRI2, however, did not compensate for the loss of WRI1 in Arabidopsis
thaliana plants. The study suggested that WRI3 and WRI4 might play a role in regulating oil
content outside of seed tissues. Given the high expression levels of WRI3-like in avocado during
oil accumulation in the mesocarp it is possible that WRI3 is playing a role in regulating oil
content in the mesocarp of avocado (Figure 5). Also the relatively high expression levels for the
33
avocado WRI2 homologue suggest that this transcription factor might still function in regulation
of genes associated with TAG accumulation in P. americana (Figure 5). PaWRI2-like and
PaWRI3-like also show coordinated expression with genes of fatty acid synthesis during most of
the developmental periods examined (Kilaru 2015). While a WRI4-like gene was detected in
avocado mesocarp, the levels were extremely low when compared to the other WRI-like genes,
and therefore the gene is not likely playing a role in oil accumulation in mesocarp.
Three Avocado WRI Homologues Were Cloned for Future Validation of Their Role in Oil
Biosynthesis
To further study the functional role of the avocado WRI homologues expressed during
mesocarp development, the genes were cloned into Gateway vector pENTR/SD/D-TOPO
(Invitrogen). Vectors bearing the genes of interest were examined by PCR (Figure 6-8) to
determine if the cloning reaction was successful. A primer designed to anneal to the M13
priming site of the vector was used with a primer designed to adhere to the cDNA insert of the
plasmid to determine orientation.
34
Ladder
WRI1-4
WRI1-5
WRI1-6
1500 bp
1000 bp
Figure 6. Cloning of PaWRI1 into Entry Vector. Agarose gel electrophoresis of PCR
results for entry plasmids bearing WRI1 genes extracted from successful
transformants. Six colonies were tested. Colony WRI1-6 showed a band of the
expected size 1336 bp, indicated by an arrow. A 1000 bp ladder is used for
comparison.
For the entry vector bearing avocado WRI1-like gene, the band expected from the PCR
reaction was 1336 base pairs. Figure 6 shows that a band of approximately that size resulted
from one of the colonies tested with the PCR reaction when run on an agarose gel. This colony,
referred to as WRI1-6, was confirmed by sequencing and utilized for further cloning procedures
(Appendix B).
For the entry vector bearing the avocado WRI2-like gene, the band expected from the
PCR reaction was 1445 base pairs. Five colonies were tested after transformation, one of which
35
produced the expected product size. This colony was referred to as WRI2-1 (Figure 7). WRI2-1
was confirmed by sequencing and utilized for all further cloning experiments (Appendix B).
For the avocado WRI3-like gene, the band expected from the PCR reaction was 1138
Ladder
WRI2-1
1500 bp
1000 bp
Figure 7. Cloning of PaWRI2 into Entry Vector. Agarose gel electrophoresis of PCR results for
entry plasmids bearing WRI2 genes extracted from successful transformants. Colony WRI2-1
showed a band of the expected size, 1445 bp, indicated by an arrow. A 1000 bp ladder is used for
comparison.
36
base pairs. Five colonies were originally tested after transformation, of which one was
demonstrated to be transformed with the plasmid bearing the gene. Figure 8 shows the PCR
reaction run on the extracted plasmid from the colony. The colony was referred to as WRI3-5.
This colony was confirmed by sequencing and used for further cloning procedures (Appendix B).
WRI3-5
Ladder
1500 bp
1000 bp
Figure 8. Cloning of PaWRI3 into Entry Vector. Agarose gel electrophoresis of PCR
results for entry plasmids bearing WRI1 genes extracted from successful
transformants. Colony WRI3-5 showed a band of the expected size, 1138 bp, indicated
by an arrow. A 1000 bp ladder is used for comparison.
37
WRI Phylogeny Shows Multiple Gene Duplications with WRI2 Appearing to be the Oldest Form
of the WRI Gene
Studies of WRI homologues in arabidopsis showed that WRI3 and WRI4 can each rescue
the low fatty acid phenotype of the wri1-1 mutant; WRI2, however, did not compensate for the
loss of WRI1 (To et al. 2012). In avocado mesocarp, the overall expression pattern of WRI1,
WRI2, and WRI3 orthologues was similar to that of genes WRI1 is known to regulate (Maeo et al.
2009) and the pattern of oil accumulation (Kilaru 2015). The high expression levels for avocado
WRI2-like gene during oil accumulation in the mesocarp suggests a possible role for WRI2-like
in regulation of fatty acid synthesis.
To explore the relationship of the WRI family of genes a phylogenetic tree of WRI
proteins from various plant families including dicots, monocots, and a basal angiosperm was
constructed. The tree revealed a possible gene duplication event of WRI early in land plant
evolution, as the WRI2 proteins formed a monophyletic group and separated from all other WRI
genes (Figure 9). Other WRI genes formed three distinct groups with a clade of WRI genes
belonging exclusively to P. patens, a bryophyte, separated from a monophyletic group of WRI1
homologues and a third group consisting of WRI3 and WRI4 genes (Figure 9). The tree
constructed for the WRI genes of various species suggests that the PaWRI2-like and AtWRI2 are
older than the other WRI genes and have also diverged a great deal from each other. The high
expression levels for PaWRI2-like in avocado mesocarp that were not previously reported in any
other oil-rich tissues, along with PaWRI1-like and PaWRI3-like but not PaWRI4-like, suggest
that perhaps, the AtWRI2 may have lost its function in oil biosynthesis while the PaWRI2-like
retained this function. Although AtWRI2 did not complement the wri1-1 mutant,
complementation studies with PaWRI2-like are planned in future studies. Based on the gene
38
Figure 9. Phylogentic analysis of the WRI family of genes. Four monophyletic groups
are present. One contains higher plant WRI3/4 genes. The second contains higher plant
WRI1 genes. A third group consists of the WRI1, WRI3, and WRI4 genes within moss.
Finally, all WRI2 genes from all examined species belong to a single monophyletic
group. Arrows indicate likely gene duplication events. Scale represents number of
nucleotide changes per site.
expression data, it is predicted that the avocado WRI2 homologue may play an additional role in
TAG accumulation in this basal angiosperm species.
39
Identification of Transcription Factors That May Play a Role in Oil Accumulation
Transcription Factors That Were Differentially Expressed Between Oil-rich Seed and Non-seed
Tissues were Identified
Currently the only known transcriptional regulator of oil biosynthesis in plants is the WRI
gene family. Because WRI1 has been associated with oil accumulation across species and tissue
types, genes that showed similar expression patterns to WRI1 expression in multiple oil
accumulating tissues would likely be associated with oil accumulation as well. This analysis of
the transcriptome data revealed candidate transcription factors likely associated with oil
accumulation (Table 2). The top ten transcription factors were chosen based on high expression
levels in non-seed tissues that accumulate oil, especially compared to tissues that do not
accumulate oil (Table 2). Transcription factors were anywhere from 2-12 times more highly
expressed in oil accumulating non-seed tissue compared to non-oil accumulating tissue, and 2-10
times more highly expressed in oil accumulating non-seed tissue than oil accumulating seed
tissues. Candidates also showed high expression in at least one non-seed tissue type that
accumulates high amounts of oil. The genes listed in Table 2 were identified by both criteria
previously described.
40
Table 2. Candidate Transcription Factors Identified by Transcriptome Analysis
At = A. thaliana, Ce = C. esculentus, Eg = E. guineensis, Pa = P. americana
Three Transcriptions Factors Were Selected for Cloning and Future Validation of Their Role in
Oil Biosynthesis
A C3H transcription factor homologue of AT2G19810 (C3H) showed 12 times higher
expression levels in non-seed oil accumulating tissue compared to tissue that does not
accumulate oil. Specifically, the C3H gene was highly expressed in the mesocarp of avocado and
oil palm and also in the roots of nutsedge. It was also highly expressed in seed tissues that
accumulate oil. However, the transcript levels in the non-seed oil accumulating tissue were on
average higher by two-fold compared to oil-rich seed tissues (Table 2).
A NAC014 transcription factor homologue of AT1G33060 was also highly expressed in
non-seed tissues that accumulate oil compared to other tissue types, being nearly 10 times higher
41
than tissue that do not accumulate oil, and over 6 times higher compared to oil accumulating
seed tissue (Table 2). Its highest expression level was shown to be in avocado mesocarp (Table
2).
An OZF transcription factor, homologue of AT1G04990 (OZF), was the third candidate
chosen for further examination in expression studies. While its average expression in oil
accumulating tissue is not as great as the other two compared to other tissue types, just 2 times
higher than non-oil accumulating tissue, coexpression analysis with the ATTED-II database
revealed that in Arabidopsis the transcription factor is coexpressed with a variety of enzymes
involved in fatty acid synthesis (Table 2). Since WRI1 exerts its control over fatty acid
accumulation by regulating similar genes (Maeo et al. 2009), this candidate was chosen for
further examination.
Cloning of Candidates for Validation of Their Role in Oil Biosynthesis
To further study the functional role of selected, identified transcription factors expressed
during oil accumulation in a variety of plants, the genes were cloned from arabidopsis siliques or
from provided vectors into Gateway vector pENTR/SD/D-TOPO (Invitrogen). Vectors bearing
the genes of interest were examined by PCR to determine if the cloning reaction was successful.
A primer designed to anneal to the M13 priming site of the vector was used with a primer
designed to adhere to the cDNA insert of the plasmid.
The entry vector bearing the C3H candidate was expected to produce a band of 1369 bp
after the PCR reaction. Multiple colonies were tested after transformation, and one was
demonstrated to bear the plasmid with the gene of interest. This colony was referred to as C3H-1
42
and a product of the expected size was produced when the PCR reaction was run on plasmids
extracted from these E. coli. (Figure 10) This colony was confirmed by sequencing then used for
further cloning experiments (Appendix B).
For the entry vector bearing the NAC014 candidate, a band of 2113 base pairs was
Ladder
C3H -1
1500 bp
1000 bp
Figure 10. Cloning of C3H into Entry Vector. Agarose gel electrophoresis of PCR
results for entry plasmids bearing C3H genes extracted from successful transformants.
Colony C3H-1 showed a band of the expected size, 1369 bp indicated by an arrow. A
1000 bp ladder is used for comparison.
expected when the PCR was run. Multiple colonies were tested and two were shown to produce
bands of the correct size. Of these two, only one referred to as NAC014-4 was confirmed by
43
sequencing and chosen to be used in further cloning experiments. Figure 11 shows the PCR
product of plasmids extracted from this colony.
The entry vector bearing the OZF candidate was expected to produce a band of 1238 base
pairs. Of the five colonies examined one produced a band of the expected size, and was referred
to as OZF-3. Figure 12 shows the results of PCR run on plasmids extracted from OZF-3.
NAC014-4
Ladder
2500 bp
2000 bp
Figure 11. Cloning of NAC014-4 into Entry Vector. Agarose gel electrophoresis of PCR
results for entry plasmids bearing NAC014 genes extracted from successful transformants.
Colony NAC014-4 showed a band of the expected size, 2113 bp, indicated by an arrow. A
1000 bp ladder is used for comparison.
44
Ladder
OZF-3
1500 bp
1000 bp
Figure 12 . Cloning of OZF into Entry Vector. Agarose gel electrophoresis of PCR results for entry
plasmids bearing OZF genes extracted from successful transformants. Colony WRI2-1 showed a
band of the expected size, 1238 bp, indicated by an arrow. A 1000 bp ladder is used for comparison.
Attempts to sequence the OZF colony using the M13 primers failed. This colony was used for
further cloning procedures.
45
CHAPTER 4
DISCUSSION
Three WRINKLED Homologues are Highly Expressed in Avocado Mesocarp Tissue
In the transcriptome data for avocado mesocarp tissue it was found that three different
WRINKLED genes, WRI1, WRI2, and WRI3, were highly expressed. Given that these genes are
expressed in mesocarp tissue during the time of TAG accumulation and WRI genes have been
previously associated with oil accumulation (To et al. 2012) it is thought that these three WRI
genes are likely to regulate TAG accumulation in avocado mesocarp tissue. A fourth WRI gene,
WRI4, was found in the avocado transcriptome data, but showed near zero expression levels. It is
possible that this WRI4 is either not functional, or may play a role in regulation of TAG in other
tissues of avocado, as WRI3 and WRI4 appear to do in Arabidopsis (To et al. 2012).
The WRINKLED Gene Family Appears to Have Undergone Multiple Duplications and Likely
has Conserved Function
A phylogenetic analysis of the WRINKLED gene family in various plant species suggests
that the gene has likely been duplicated in multiple lineages of the plant family, but has played a
similar role in most of these lineages. The early split of the WRI2 family from the remainder of
the WRINKLED genes (Figure 9) and the likely role WRI2 plays in regulating oil accumulation
in avocado suggest that the WRINKLED gene family has been a transcriptional regulator of oil
accumulation since before the development of vascular plants. Though duplication appears to
have allowed some of the family members to lose function, such as the WRI2 of Arabidopsis,
some member of the WRI family likely plays a role in oil accumulation in most plants, as every
46
studied species has a WRI gene that appears to function in regulating fatty acid synthesis (Liu et
al. 2010;Pouvreau et al. 2011;Ma et al. 2013). The high expression of WRI gene family members
in avocado mesocarp tissue during oil accumulation suggest that they play a similar role in this
basal angiosperm.
Three WRINKLED Genes Highly Expressed in Avocado Mesocarp Cloned into Gateway Cloning
System
For future confirmation studies of the three highly expressed WRINKLED genes found in
avocado mesocarp the genes were cloned into Gateway entry vectors (Invitrogen) for further
study. Generation of E. coli bearing entry vectors containing these genes was successful (Figures
6, 7, 8).
Transcription Factor Candidates Identified that May Play a Role in TAG Accumulation
The transcriptome data provided from the various species included over 1500
transcription factor genes overall. Through analysis of expression levels in various tissue types,
ten transcription factors were identified that may play a role in regulating the genes associated
with TAG accumulation in plants. These ten candidates are most highly expressed in non-seed
tissues that accumulate high levels of oil such as avocado mesocarp, oil palm mesocarp, and
yellow nutsedge root (Table 2). The ten identified putative transcription factors are from a
variety of transcription factor families, and have not been well studied and have currently
unknown functions. These candidates will need to be examined to determine if their expression
does affect TAG levels in various plant tissues.
47
Three Candidate Transcription Factors Cloned into Gateway Cloning System
Three of the identified candidates were chosen to be cloned into the Gateway cloning
system (Invitrogen) for further study. These three genes were chosen because of their
comparatively high expression or due to their coexpression with genes associated with TAG
accumulation in plants (Table 2). The generation of E. coli bearing these candidate genes in the
Gateway cloning system was successful (Figures 10, 11, 12).
48
CHAPTER 5
CONCLUSIONS AND FUTURE DIRECTIONS
This study was undertaken due to the lack of understanding of transcriptional regulation
of TAG assembly, particularly in non-seed tissues. By analyzing non-seed tissues that
accumulate high amounts of TAG, the genes responsible for this regulation may be successfully
identified and verified. This work has been used to identify ten genes that have not been
previously associated with TAG accumulation, but may play a role in regulating TAG levels in
non-seed tissue. Future studies will use this information to examine how expression of these
candidate genes affects oil levels in plant tissues. All genes cloned in this study will likely first
be examined in a tobacco transient expression assay to determine if they increase oil
accumulation in that system.
Along with identifying new candidates that may play a role in TAG accumulation, this
study also examined orthologues of the WRI gene family in avocado. The WRI gene family is
known to regulate genes of fatty acid synthesis and promote TAG accumulation in a variety of
plant species and tissue types (Focks andBenning 1998;Pouvreau et al. 2011;Ma et al. 2013). The
expression profile of the WRI homologues found in avocado suggests that the genes play a
similar role in this species as well. Phylogenetic analysis of WRI genes from a variety of species
suggests that these genes are functionally conserved in terms of regulating fatty acid synthesis
and TAG accumulation. The three WRI genes most highly expressed in avocado mesocarp tissue
have been cloned and future analysis may demonstrate that they promote TAG accumulation in
various plant tissues. This analysis could confirm an evolutionary conserved target for increasing
oil content in a wide variety of plant species.
49
Plant oils are a valuable commodity and utilized by humans in a variety of applications.
As demand rises so will the need to increase production of this valuable resource. The work here
can be applied to further understanding of the regulation of TAG accumulation, which in turn
can lead to better production of TAG in plants.
50
REFERENCES
Banilas G, Karampelias M, Makariti I, Kourti A, Hatzopoulos P (2011). "The olive DGAT2 gene
is developmentally regulated and shares overlapping but distinct expression
patterns with DGAT1." Journal of Experimental Botany 62(2): 521-532.
Baud S, Lepiniec L (2009). "Regulation of de novo fatty acid synthesis in maturing oilseeds of
Arabidopsis." Plant Physiology and Biochemistry 47(6): 448-455.
Baud S, Mendoza M S, To A, Harscoët E, Lepiniec L, Dubreucq B (2007). "WRINKLED1
specifies the regulatory action of LEAFY COTYLEDON2 towards fatty acid
metabolism during seed maturation in Arabidopsis." The Plant Journal 50(5): 825838.
Baud S, Wuillème S, To A, Rochat C, Lepiniec L (2009). "Role of WRINKLED1 in the
transcriptional regulation of glycolytic and fatty acid biosynthetic genes in
Arabidopsis." The Plant Journal 60(6): 933-947.
Bourgis F, Kilaru A, Cao X, Ngando-Ebongue G-F, Drira N, Ohlrogge J B, Arondel V (2011).
"Comparative transcriptome and metabolite analysis of oil palm and date palm
mesocarp that differ dramatically in carbon partitioning." Proceedings of the
National Academy of Sciences 108(30): 12527-12532.
Canvin D T (1963). "Formation of oil in the seed of ricinus communis L." Canadian Journal of
Biochemistry and Physiology 41(9): 1879-1885.
Carlsson A S (2009). "Plant oils as feedstock alternatives to petroleum – A short survey of
potential oil crop platforms." Biochimie 91(6): 665-670.
Cernac A, Benning C (2004). "WRINKLED1 encodes an AP2/EREB domain protein involved in
the control of storage compound biosynthesis in Arabidopsis." The Plant Journal
40(4): 575-585.
Clough R, Matthis A, Barnum S, Jaworski J (1992). "Purification and characterization of 3ketoacyl-acyl carrier protein synthase III from spinach. A condensing enzyme
51
utilizing acetyl-coenzyme A to initiate fatty acid synthesis." Journal of Biological
Chemistry 267(29): 20992-20998.
Dahlqvist A, Ståhl U, Lenman M, Banas A, Lee M, Sandager L, Ronne H, Stymne S (2000).
"Phospholipid:diacylglycerol acyltransferase: An enzyme that catalyzes the acylCoA-independent formation of triacylglycerol in yeast and plants." Proceedings
of the National Academy of Sciences 97(12): 6487-6492.
Durrett T P, Benning C, Ohlrogge J (2008). "Plant triacylglycerols as feedstocks for the
production of biofuels." The Plant Journal 54(4): 593-607.
Dussert S, Guerin C, Andersson M, Joët T, Tranbarger T J, Pizot M, Sarah G, Omore A, DurandGasselin T, Morcillo F (2013). "Comparative transcriptome analysis of three oil
palm fruit and seed tissues that differ in oil content and fatty acid composition."
Plant Physiology 162(3): 1337-1358.
Focks N, Benning C (1998). "wrinkled1: A Novel, Low-Seed-Oil Mutant of Arabidopsis with a
Deficiency in the Seed-Specific Regulation of Carbohydrate Metabolism." Plant
Physiology 118(1): 91-101.
Goering K, Eslick R, Brelsford D (1965). "A search for high erucic acid containing oils in the
Cruciferae." Economic Botany 19(3): 251-256.
Harlow R, Litchfield C, Fu H-C, Reiser R (1965). "The triglyceride composition of Myrica
carolinensis fruit coat fat (bayberry tallow)." Journal of the American Oil
Chemists Society 42(9): 747-750.
Harwood J L (1996). "Recent advances in the biosynthesis of plant fatty acids." Biochimica et
Biophysica Acta (BBA) - Lipids and Lipid Metabolism 1301(1–2): 7-56.
Harwood J L (2005). Fatty acid biosynthesis. Plant Lipids: Biology, utilisation and Manipulation.
D. J. Murphy. Boca Raton, FL, Blackwell Publishing Ltd. First: 27.
52
Hellyer A, Leadlay P F, Slabas A R (1992). "Induction, purification and characterisation of acylACP thioesterase from developing seeds of oil seed rape (Brassica napus)." Plant
Molecular Biology 20(5): 763-780.
Heywood V H (1993). Flowering Plants of the World. London, BT Batsford Ltd.
Horn P J, James C N, Gidda S K, Kilaru A, Dyer J M, Mullen R T, Ohlrogge J B, Chapman K D
(2013). "Identification of a new class of lipid droplet-associated proteins in
plants." Plant Physiology 162(4): 1926-1936.
Hsieh K, Huang A H C (2004). "Endoplasmic Reticulum, Oleosins, and Oils in Seeds and
Tapetum Cells." Plant Physiology 136(3): 3427-3434.
Ibarra-Laclette E (2013). AVOCADO GENOME SEQUENCING PROJECT. Plant and Animal
Genome XXI Conference, San Diego, CA, Plant and Animal Genome.
Jako C, Kumar A, Wei Y, Zou J, Barton D L, Giblin E M, Covello P S, Taylor D C (2001).
"Seed-Specific Over-Expression of an Arabidopsis cDNA Encoding a
Diacylglycerol Acyltransferase Enhances Seed Oil Content and Seed Weight."
Plant Physiology 126(2): 861-874.
Jaworski J G, Post‐Beittenmiller D, Ohlrogge J B (1993). "Acetyl‐acyl carrier protein is not a
major intermediate in fatty acid biosynthesis in spinach." European Journal of
Biochemistry 213(3): 981-987.
Johnston M L, Luethy M H, Miernyk J A, Randall D D (1997). "Cloning and molecular analyses
of the Arabidopsis thaliana plastid pyruvate dehydrogenase subunits." Biochimica
et Biophysica Acta (BBA)-Bioenergetics 1321(3): 200-206.
Kagaya Y, Toyoshima R, Okuda R, Usui H, Yamamoto A, Hattori T (2005). "LEAFY
COTYLEDON1 controls seed storage protein genes through its regulation of
FUSCA3 and ABSCISIC ACID INSENSITIVE3." Plant and Cell Physiology
46(3): 399-406.
53
Kannangara C G, Stumpf P (1972). "Fat metabolism in higher plants: LIV. A procaryotic type
acetyl CoA carboxylase in spinach chloroplasts." Archives of Biochemistry and
Biophysics 152(1): 83-91.
Kilaru A (2015). Comparative Transcriptomics Identifies Key Steps in Storage Oil Biosynthesis
in Plant Tissues. Plant and Animal Genome XXIII Conference, San Diego, CA,
Plant and Animal Genome.
Larkin M A, Blackshields G, Brown N P, Chenna R, McGettigan P A, McWilliam H, Valentin F,
Wallace I M, Wilm A, Lopez R, Thompson J D, Gibson T J, Higgins D G (2007).
"Clustal W and Clustal X version 2.0." Bioinformatics 23(21): 2947-2948.
Leprince O, Van Aelst A C, Pritchard H W, Murphy D J (1997). "Oleosins prevent oil-body
coalescence during seed imbibition as suggested by a low-temperature scanning
electron microscope study of desiccation-tolerant and-sensitive oilseeds." Planta
204(1): 109-119.
Li Y, Beisson F, Pollard M, Ohlrogge J (2006). "Oil content of Arabidopsis seeds: the influence
of seed anatomy, light and plant-to-plant variation." Phytochemistry 67(9): 904915.
Lin W, Oliver D J (2008). "Role of triacylglycerols in leaves." Plant Science 175(3): 233-237.
Linssen J P H, Cozijnsen J L, Pilnik W (1989). "Chufa (Cyperus esculentus): A new source of
dietary fibre." Journal of the Science of Food and Agriculture 49(3): 291-296.
Liu J, Hua W, Zhan G, Wei F, Wang X, Liu G, Wang H (2010). "Increasing seed mass and oil
content in transgenic Arabidopsis by the overexpression of wri1-like gene
from Brassica napus." Plant Physiology and Biochemistry 48(1): 9-15.
Lotan T, Ohto M-a, Yee K M, West M A L, Lo R, Kwong R W, Yamagishi K, Fischer R L,
Goldberg R B, Harada J J (1998). "Arabidopsis LEAFY COTYLEDON1 Is
Sufficient to Induce Embryo Development in Vegetative Cells." Cell 93(7): 11951205.
54
Ma W, Kong Q, Arondel V, Kilaru A, Bates P D, Thrower N A, Benning C, Ohlrogge J B
(2013). "WRINKLED1, A Ubiquitous Regulator in Oil Accumulating Tissues
from Arabidopsis Embryos to Oil Palm Mesocarp." PloS One 8(7): e68887.
Maeo K, Tokuda T, Ayame A, Mitsui N, Kawai T, Tsukagoshi H, Ishiguro S, Nakamura K
(2009). "An AP2‐type transcription factor, WRINKLED1, of Arabidopsis thaliana
binds to the AW‐box sequence conserved among proximal upstream regions of
genes involved in fatty acid synthesis." The Plant Journal 60(3): 476-487.
Meinke D W, Franzmann L H, Nickle T C, Yeung E C (1994). "Leafy cotyledon mutants of
Arabidopsis." The Plant Cell Online 6(8): 1049-1064.
Mooney B P, Miernyk J A, Randall D D (1999). "Cloning and Characterization of the
DihydrolipoamideS-Acetyltransferase Subunit of the Plastid Pyruvate
Dehydrogenase Complex (E2) from Arabidopsis." Plant Physiology 120(2): 443452.
Mu J, Tan H, Zheng Q, Fu F, Liang Y, Zhang J, Yang X, Wang T, Chong K, Wang X-J (2008).
"LEAFY COTYLEDON1 is a key regulator of fatty acid biosynthesis in
Arabidopsis." Plant Physiology 148(2): 1042-1054.
Murphy D J (2012). "The dynamic roles of intracellular lipid droplets: from archaea to
mammals." Protoplasma 249(3): 541-585.
Ngando-Ebongue G F, Ajambang W N, Koona P, Firman B L, Arondel V (2012). Oil Palm.
Technological Innovations in Major World Oil Crops, Volume 1. S. K. Gupta,
Springer New York: 165-200.
Peng F, Weselake R (2011). "Gene coexpression clusters and putative regulatory elements
underlying seed storage reserve accumulation in Arabidopsis." BMC Genomics
12(1): 286.
Pierrugues O, Brutesco C, Oshiro J, Gouy M, Deveaux Y, Carman G M, Thuriaux P, Kazmaier
M (2001). "Lipid phosphate phosphatases in Arabidopsis Regulation of the
55
AtLPP1 gene in response to stress." Journal of Biological Chemistry 276(23):
20300-20308.
Platt-Aloia K, Thomson W (1981). "Ultrastructure of the mesocarp of mature avocado fruit and
changes associated with ripening." Annals of Botany 48(4): 451-466.
Pouvreau B, Baud S, Vernoud V, Morin V, Py C, Gendrot G, Pichon J-P, Rouster J, Paul W,
Rogowsky P M (2011). "Duplicate maize Wrinkled1 transcription factors activate
target genes involved in seed oil biosynthesis." Plant Physiology 156(2): 674-686.
Ramli U, Baker D, Quant P, Harwood J (2002). "Control analysis of lipid biosynthesis in tissue
cultures from oil crops shows that flux control is shared between fatty acid
synthesis and lipid assembly." Biochem.J 364: 393-401.
Reverdatto S, Beilinson V, Nielsen N C (1999). "A multisubunit acetyl coenzyme A carboxylase
from soybean." Plant Physiology 119(3): 961-978.
Routaboul J-M, Benning C, Bechtold N, Caboche M, Lepiniec L (1999). "The TAG1 locus of
Arabidopsis encodes for a diacylglycerol acyltransferase." Plant Physiology and
Biochemistry 37(11): 831-840.
Ruuska S A, Girke T, Benning C, Ohlrogge J B (2002). "Contrapuntal networks of gene
expression during Arabidopsis seed filling." The Plant Cell Online 14(6): 11911206.
Santos‐Mendoza M, Dubreucq B, Baud S, Parcy F, Caboche M, Lepiniec L (2008). "Deciphering
gene regulatory networks that control seed development and maturation in
Arabidopsis." The Plant Journal 54(4): 608-620.
Shen B, Allen W B, Zheng P, Li C, Glassman K, Ranch J, Nubel D, Tarczynski M C (2010).
"Expression of ZmLEC1 and ZmWRI1 increases seed oil production in maize."
Plant Physiology 153(3): 980-987.
Siggaard-Andersen M, Kauppinen S, von Wettstein-Knowles P (1991). "Primary structure of a
cerulenin-binding beta-ketoacyl-[acyl carrier protein] synthase from barley
56
chloroplasts." Proceedings of the National Academy of Sciences 88(10): 41144118.
Slabas A, Cottingham I, Austin A, Hellyer A, Safford R, Smith C (1990). "Immunological
detection of NADH-specific enoyl-ACP reductase from rape seed (Brassica
napus)—induction, relationship of α and β polypeptides, mRNA translation and
interaction with ACP." Biochimica et Biophysica Acta (BBA)-Protein Structure
and Molecular Enzymology 1039(2): 181-188.
Stobart K, Mancha M, Lenman M, Dahlqvist A, Stymne S (1997). "Triacylglycerols are
synthesised and utilized by transacylation reactions in microsomal preparations of
developing safflower (Carthamus tinctorius L.) seeds." Planta 203(1): 58-66.
Sung H-J (2013). Identification of Acyltransferases Associated with Triacylglycerol Biosynthesis
in Avocado, East Tennessee State University.
To A, Joubès J, Barthole G, Lécureuil A, Scagnelli A, Jasinski S, Lepiniec L, Baud S (2012).
"WRINKLED transcription factors orchestrate tissue-specific regulation of fatty
acid biosynthesis in Arabidopsis." The Plant Cell Online 24(12): 5007-5023.
To A, Valon C, Savino G, Guilleminot J, Devic M, Giraudat J, Parcy F (2006). "A network of
local and redundant gene regulation governs Arabidopsis seed maturation." The
Plant Cell Online 18(7): 1642-1651.
Troncoso-Ponce M A, Kilaru A, Cao X, Durrett T P, Fan J, Jensen J K, Thrower N A, Pauly M,
Wilkerson C, Ohlrogge J B (2011). "Comparative deep transcriptional profiling of
four developing oilseeds." The Plant Journal 68(6): 1014-1027.
Troncoso‐Ponce M A, Kilaru A, Cao X, Durrett T P, Fan J, Jensen J K, Thrower N A, Pauly M,
Wilkerson C, Ohlrogge J B (2011). "Comparative deep transcriptional profiling of
four developing oilseeds." The Plant Journal 68(6): 1014-1027.
Tzen J T, Huang A H (1992). "Surface structure and properties of plant seed oil bodies." The
Journal of Cell Biology 117(2): 327-335.
57
Weselake R J (2009). 6 Storage lipids. Plant Lipids: Biology, Utilisation and Manipulation. Boca
Raton, FL, Blackwell Publishing Ltd.: 162.
Weselake R J, Shah S, Tang M, Quant P A, Snyder C L, Furukawa-Stoffer T L, Zhu W, Taylor
D C, Zou J, Kumar A (2008). "Metabolic control analysis is helpful for informed
genetic manipulation of oilseed rape (Brassica napus) to increase seed oil
content." Journal of Experimental Botany 59(13): 3543-3549.
Weselake R J, Taylor D C, Rahman M H, Shah S, Laroche A, McVetty P B E, Harwood J L
(2009). "Increasing the flow of carbon into seed oil." Biotechnology Advances
27(6): 866-878.
West M A L, Yee K M, Danao J, Zimmerman J L, Fischer R L, Goldberg R B, Harada J J
(1994). "LEAFY COTYLEDON1 is an essential regulator of late embryogenesis
and cotyledon identity in Arabidopsis." The Plant Cell Online 6(12): 1731-1745.
Xu J, Francis T, Mietkiewska E, Giblin E M, Barton D L, Zhang Y, Zhang M, Taylor D C
(2008). "Cloning and characterization of an acyl-CoA-dependent diacylglycerol
acyltransferase 1 (DGAT1) gene from Tropaeolum majus, and a study of the
functional motifs of the DGAT protein using site-directed mutagenesis to modify
enzyme activity and oil content." Plant Biotechnology Journal 6(8): 799-818.
Yamamoto A, Kagaya Y, Usui H, Hobo T, Takeda S, Hattori T (2010). "Diverse Roles and
Mechanisms of Gene Regulation by the Arabidopsis Seed Maturation Master
Regulator FUS3 Revealed by Microarray Analysis." Plant and Cell Physiology
51(12): 2031-2046.
Yatsu L Y, Jacks T J (1972). "Spherosome membranes half unit-membranes." Plant Physiology
49(6): 937-943.
Zhang M, Fan J, Taylor D C, Ohlrogge J B (2009). "DGAT1 and PDAT1 Acyltransferases Have
Overlapping Functions in Arabidopsis Triacylglycerol Biosynthesis and Are
Essential for Normal Pollen and Seed Development." The Plant Cell Online
21(12): 3885-3901.
58
Zheng Z, Xia Q, Dauk M, Shen W, Selvaraj G, Zou J (2003). "Arabidopsis AtGPAT1, a Member
of the Membrane-Bound Glycerol-3-Phosphate Acyltransferase Gene Family, Is
Essential for Tapetum Differentiation and Male Fertility." The Plant Cell Online
15(8): 1872-1887.
Zhou X-R, Shrestha P, Yin F, Petrie J R, Singh S P (2013). "AtDGAT2 is a functional acyl-CoA:
diacylglycerol acyltransferase and displays different acyl-CoA substrate
preferences than AtDGAT1." FEBS letters 587(15): 2371-2376.
Zou J, Katavic V, Giblin E M, Barton D L, MacKenzie S L, Keller W A, Hu X, Taylor D C
(1997). "Modification of seed oil content and acyl composition in the brassicaceae
by expression of a yeast sn-2 acyltransferase gene." The Plant Cell Online 9(6):
909-923.
Zou J, Wei Y, Jako C, Kumar A, Selvaraj G, Taylor D C (1999). "The Arabidopsis thaliana
TAG1 mutant has a mutation in a diacylglycerol acyltransferase gene." The Plant
Journal 19(6): 645-653.
59
APPENDICES
Appendix A:
R Scripts Used in Analyzing Transcriptome Data
# IDdecreasingGenes
# Gives list of genes that are decreasing for
# a given input list of genes with expression data
# Calls decreasing(geneRow)
IDdecreasingGenes <- function(expressionData) {
geneNumber <- 1494
toReturn <- c()
for (i in 1:geneNumber) {
if (decreasing(expressionData[i,])) {
toReturn <- append(toReturn,i)
}
}
return(toReturn)
}
60
#IDincreasingGenes
# Gives list of genes that are increasing for
# a given input list of genes with expression data
# Calls increasing(geneRow)
IDincreasingGenes <- function(expressionData) {
geneNumber <- 1494
toReturn <- c()
for (i in 1:geneNumber) {
if (increasing(expressionData[i,])) {
toReturn <- append(toReturn,i)
}
}
return(toReturn)
}
61
#IDmeetsThresholdGenes
# Gives list of genes that meet a given
# threshold value given input list of genes
# with expression data
# Calls meetsThreshold(geneRow, threshold)
IDmeetsThresholdGenes <- function(expressionData, threshold) {
geneNumber <- 1494
toReturn <- c()
for (i in 1:geneNumber) {
if (meetsThreshold(expressionData[i,], threshold)) {
toReturn <- append(toReturn,i)
}
}
return(toReturn)
}
62
#IdentifyCandidates
# Checks genes to see if they are more highly expressed in
# Nonseed oil accumulating tissue compared to other tissues
IdentifyCandidates <- function(OilNonSeedAvg, OilSeedAvg, NonOilAvg) {
geneNumber <- 1346
toReturn <- c()
for (i in 1:geneNumber) { #expressed over 5, approx x2 OilNonSeedAvg Avg EST
if (OilNonSeedAvg[i] > 5 && OilNonSeedAvg[i] > OilSeedAvg[i]*2 &&
OilNonSeedAvg[i] > NonOilAvg[i]*2){
toReturn <- append(toReturn, i)
}
}
return(toReturn)
}
63
#decreasing
# Determines if a given gene is decreasing
# over time, also checks to see if gene
# meets certain threshold value
decreasing <- function(geneRow) {
allowance <- 2
threshHold <- 10
threshHoldMet <- FALSE
for (i in 1:(length(geneRow)-1)) {
j <- i+1
before <- geneRow[i]
after <- geneRow[j]
if (!threshHoldMet) {
threshHoldMet <- before >= threshHold
}
if (is.na(before) || (before < after && abs(before-after) > allowance)) {
return(FALSE)
}
}
return(threshHoldMet)
}
64
#increasing
# Determines if a given gene is increasing
# over time, also checks to see if gene
# meets certain threshold value
increasing <- function(geneRow) {
allowance <- 2
threshHold <- 10
threshHoldMet <- FALSE
for (i in 1:(length(geneRow)-1)) {
j <- i+1
before <- geneRow[i]
after <- geneRow[j]
if (!threshHoldMet) {
threshHoldMet <- this >= threshHold
}
if (is.na(before) || (before > after && abs(before-after) > allowance)) {
return(FALSE)
}
}
return(threshHoldMet)
}
65
#meetsThreshold
# Determines if a given gene meets a given
# threshold value of expression
meetsThreshold <- function(geneRow, threshold) {
for (i in seq_along(geneRow)) {
if (is.na(geneRow[i])) {
return(FALSE)
}
if (geneRow[i] >= threshold) {
return(TRUE)
}
}
return(FALSE)
}
66
Appendix B:
Entry Clone Sequences Obtained from Molecular Biology Core Facility
The following sequences were obtained at the ETSU Molecular Biology Core Facility.
Underlined portions are sequences of the inserted gene. Portions that are not underlined are part
of the original vector.
>Core.Facility.Wri1-6-M13F
ATAGACCTGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAA
CAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCC
GCGGCCGCCTTGTTTAACTTTAAGAAGGAGCCCTTCACCATGGACACATCTTCTCCC
CTCTCCAATTCAATCTCATCTTCCTCCTCCTCCACCACCACCACCTCCTCTTCTTCTTC
TTCTTCACCTCTTTCTCAACCCACCAAAACAAAGATCAAACGCACTAGAAGGAATCT
CAACCCTCAGAAGAGCCAGTTTGGTGCCAACCCTGGAAGAAGAAGTTCTGTGTATA
GAGGTGTTACTAGGCATAGATGGACAGGAAGGTATGAGGCCCACCTTTGGGACAAG
AGCAGTTGGAACCCTGTTCAAAACAAGAAAGGAAGACAAGTCTATTTGGGAGCCTA
TGATGATGAAGAGGCTGCTGCTCATACATATGACCTTGCTGCTCTCAAATATTGGGG
CCCTGATACCATCTTGAATTTCCCTCTGAATACATATGCAAAAGAGTTTGAGGAGAT
GCAAATGGTGTCTAAGGAAGAGTACTTGGCTTCTTTAAGGAGAAGAAGTAGTGGGT
TTTCCAGAGGAGTTTCTAAATACCGTGGGGGTGGCAAGGCATCATCACAACGGACG
GTGGGAGGCTAGGATGGGTCGAGTCTTTGGAAATAAAATCTCTCCTGGGACATCAGT
CTCANANGAGCAGCTCAGCAATACATGCTCTATAAATCGGAGGCTATCAGTACCAA
CTCGATTAGCATTACTTAAATCACCACCCCACCCCACCCCCCAACCCCGCCCCTCAA
GAACTACTATGTGCCCACCTCAATTANCTCCGAACNCTGNCTCATAATAACTGACTT
GACCCCTAAAATTCCGAACCTGTTGCCACNATCCACTCGGGCATTTCNAACTAA
>Core.Facility.Wri1-6-M13R
TTAATACTACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTCTATTTT
GACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGC
CAACTTTGTACAAGAAAGCTGGGTCGGCGCGCCCACCCTTCTAAGAACATATGCTGA
TGGGAAGCGGATAGGAAATAGAGTCAACAGAAGCATTCATATTCTCAACTATCAAC
CCACATTCACCACCCTCTTCAATATCATTCAGGAAATCGCCCTCAAACCCGCCTGAA
TTCTCAAAAATGCCATCATCCAATTTCATCTCATTTCCCTCACCTTCATGGATGCCTG
TAGTAGTGGGACCAGTGGGAAAACCACCCTCAGCTCCATCAAAAAGGAACTCTATA
TTGTCTTCAAAGCCAGTGCCATTGAACAGGTCATGTAATTCAATGGATTTGTCGAGG
GCGATATCGGGAACCGGAATGGAGTTGAAGGTGGGGCCCATGCAGAGGTTCCAGGG
CTGATCTGTGAGGGGGTCCATGATCGCAGTTTGATCGATGGGACCGGAGTTTTCGGG
GATTTGAATCTGAGGTGGGGCCACATGATGAGGTTCCTGGAAGGGGGCGGAGGGTT
GTGGGGGTTGAGGTGGGGGTT
67
>Core.Facility.Wri2-1-M13F
TAAGACGCTGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCA
ACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTC
CGCGGCCGCCTTGTTTAACTTTAAGAAGGAGCCCTTCACCATGGCTTCTTCTCCTTCG
TCGGAAGAAAGTATATGTTGAACTGATCTCATTCTTCCTATGTGTTGTGCTTAGGGA
AAGTCCTGTTGGCTGGATTAGATTTGTCCAGAATGCAGAGTCTGGCGACGGGTCGAT
GTTGCTGCAATTTGTCAGCAATGGAGCTGATAAGAAAGGGCCCAAAGGGTATGACG
TTTTTTGAAGAGGCATTTCACCCAAGCTTAATCCAACTCCGGAACTCTCACTCCCAC
CAACACTTGACAATTTCAGAACCGTCTTTTCATGGCCTATATTGTTTGTGTGCTCACC
ATCTTGGGCTTCTGATGCTTTCTCTTGCATTTTCTTGAAGGCAGCAGACTGTGCCAAT
ATGCGACAGGCAGACATAGCTGATGCAAAAGGTTTCCCTTTACAAGACAGGCCTAG
AGAAGGCAGCTGATATGGCTCAGTATGTTGCGAGGGCCATTCAAATGTTTTGAGTTC
ACTGCCTGCATCTGAAATACCATGTGTTTCATCAGAGGATTTAGTGATAGGAA
>Core.Facility.Wri2-1-M13R
CCTGTATCTACTCACTATAGGGGATATCAGCTGGATGGCAATAATGATTTCATTTTG
ACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCC
AACTTTGTACAAGAAAGCTGGGTCGGCGCGCCCACCCTTCACCATGGCTTCTTCTCC
TTCGTCGTCGGGATCCTCCTGTGCTGAAGATCGAAGCTGCTGCAGCTACTGGTGGTG
GTGGTGGAGGAAGTGGAGGAGGAGGAGGTGGANAGGAG
>Core.Facility.Wri3-5-M13F
TAAGACTCGTGGGCCCCGACATAGATTGAATGTTTTATAGTTTTGACTGGATGAGGT
TGTACCTGGTGTCGGTTTTGGCAAACAAATTTGGAATTGGAAGCCATTGGCTTTTTTT
TTAATTAAATTGGCCCCAACCTTTTGGTTAACCAAAAAAAAGGCCAAGGGGCCTTCC
CGCCGGGGCCCGCCCTTGGGTTTTTAAACCTTTTAAAGGAAAGGGAGGCCCCTTTCA
ACCCATGGGGGGAAAATCATCAAAAACCCAAACAAACAAACAGCAAGTGGACAAC
AATTAAGCAAAGTTCGACCTAACAAAGGGTGAAAAAAGAAAACGAAGAAAAAAAA
GCCGTTGCCCAAAGGAAGAAATTCCACCCCCAACCACCAAACCGTTAAAGCCTTCC
CCATTCCTTAACAAGGAAGGGGTTGGTTTCCACCAAAGGGGGCAATTCCGAATTGG
GGAACCAGGGGGAAGGAATTATTGGAAAAGCCCTCCATTTTTGTGGGGGGAATTAA
AAAAATTTGGCTGGGGAAATGAAGAACCCCAAAAAACCAAAGAAAAGGGGAAAGA
ACAAAGTTTCTAACTTTGGGGTTGCCCTTATTGAATTGAATTGAAAAACTGGGCAAG
CCTGGCACCACCGCCATTATTGAAACTTGGGGCAAGCCACCCTGAAAAGTAACTGG
GGGGAACAGGGGGCACCTAATTCCTCCAACCTTTTCCCTGCCATTCTACATATGAGG
GAAAGAACTGAAAGAAATGGAAGGACAATCAAAAGAAGAATACATTGGATCCTTG
AGAAGGAAAAGTAGTGGCTTTTCCAGGGGTGTATCAAAGTACAGAGGTGTTGCAAG
GCATCATCACAATGGAAGATGGGAAGCTCGCATTGGAAGAGTGTTTGGGACAAATA
CCTTATCTGGAACTATGCACCCAGAAGAGCAGCAAGCTACGACTGCNCATGAGAAG
GACTACCGTACATCACGACGTCTCATCTGCCGTCACTATCACTACACTACACACACA
CACATGATGCGCTCCCTCACGAA
68
>Core.Facility.Wri3-5-M13R
CCATGTATCTACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTCATT
TTGACTGATAGTGACCTGTTCGTTGCACAAATTGATAAGCATGCTTTCTTATAAATG
GCCCACCTTTGTACCAAGAAAGGCCGGGGTTCGGCGCGCCCCACCCCTTCCTTAAGT
TCCCCACTCGCCCCTCCGAACCCAAGGGCGCTGCAAACAAGTCCAGATCGCCAAAA
ATAACGTCATCCCCCACGCCGGGATTCTCGCACTCAAAGTACGTCTGTATGTCGTCC
GGAAAGCTGCACCGCGGCGGGTTGTCTGCTTCCGGCGTCGTCGACGGGGAGTCCAC
CGCCGACGTCCTCTCCAACATCTCCTTGAATTTCGTCGACTGCAGCAGTAGGTTGAG
GGCGCCGCCGCCGGCACGGGGCAGAGGGACCCCGTCTCCGCCGCCTGAGCTATGGT
GGTGGACGAAGCCCAGCCCTATATCAGAATTTGGGCTAGTGCTAGTGCTAGGGCTA
GGGCTAGGGTTAGGGTTTTGGTCAGTGTTGGAATTAGGGTTTTGTGAGCCGGGGCGA
AGCCATTTGATGTAACGGCTCAATCGAATTCGTAACGGCGTAAGTCCCTGTACTCAT
GCCGCATGTCTAAGCGTGCTGCTCTCTGGTGCTAGTCCAAAAGATGTCCACCCTCAG
CACTCTTCTGAACGCCCGATACCCGACAATCCAG
>Core.Facility.AtC3H-1-M13F
TATGACTTGGTCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAA
CAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCC
GCGGCCGCCTTGTTTAACTTTAAGAAGGAGCCCTTCACCATGCGAACCCCCATGTCA
GACACTCAGCATGTACAGAGCTCTTTGGTGTCGATTCGATCTTCCGACAAAATCGAA
GATGCCTTTAGGAAGATGAAAGTAAATGAGACCGGCGTGGAGGAACTGAATCCGTA
TCCAGATCGTCCCGGTGAAAGAGATTGCCAATTCTATTTAAGAACTGGTCTCTGTGG
CTATGGAAGCAGTTGCCGTTACAATCATCCTACTCATCTTCCACAGGATGTTGCTTAT
TACAAGGAGGAGCTCCCTGAGAGAATTGGACAGCCGGATTGTGAGTATTTTCTGAA
GACAGGAGCTTGTAAGTACGGCCCAACTTGTAAATATCATCATCCAAAGGACAGGA
ACGGTGCACAACCTGTAATGTTCAATGTTATCGGTTTACCTATGCGTCTGGGTGAGA
AGCCATGTCCATATTACCTGCGAACGGGAACTTGCAGATTCGGAGTTGCTTGCAAAT
TCCACCATCCTCAACCTGATAATGGACATTCTACTGCATATGGAATGTCTAGCTTTCC
TGCTGCAGATTTACGATATGCTAGTGGGTTAACAATGATGTCTACATATGGAACTTT
GCCTCGTTCGCAAGTTCCCCAGTCTANGTGCCANTCCTGGTTCAACCTCCCAGGCTTT
TACCCTCCTCAGGCGTGGGCCCTACATTGCCGCATTCACCCCAGTGTCAAATGTTAA
AATACCCTATTACTCGGATNATTTCACTCANGGCATGCGGGTGGCATAAACCGGGGT
TGTTAAAATATATGACACACAAATTTTGTTTTATTAACCG
69
>Core.Facility.AtC3H-1-M13R
ATGNTAATACTACCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTCATTT
TGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATG
CCAACTTTGTACAAGAAAGCTGGGTCGGCGCGCCCACCCTTTCATGGTGATGACGCA
TCCTCAGACAAATCCTGCACTTCTCCATTGTCTGGTTTCTCAGTCTCTGAGCTTTCTTT
CTTCACATCAGGTTTACCATTAGAAAGAGACTTTGAATCAGAGCGGTTTGGTGTTGG
TGAGATCCTCTGATGGGTTGTAACAGGTGAAGCAAAAGGAGTAGGCAGAGAAGTAG
CCATGGTCAGGCCCGGATATGGCAGCATAGGGTGGTCGAATTTGCAGTTTGGTCCAA
ACTTGCAGAATCCATAAGACCTGAAGTTACCACAAGCTGGTTGTCCAGGTCTCGCTG
GAAGAACAAAAGGGTTTATAAGACTTGGTGGTGGTTGTGAAATCCTTACTCCGGGAT
GGCTGTATTTGCAATCGTCTCCGTATTTACATGTCCCGGTGTTCATAAAAAACCGAC
ATTCTGGTTGGTCAGAACTTTCTGACAAACCACGGTTCAATGCCACAGCCATGGCCA
TGGGATGCACTACTACCGGAGTAATAAGGTTGATTCTCACATTGTACATGGAGTTAG
ATCAACCATGTAAGGGCCACCCTGAGGAGGTAAAANCCTTGAAGGGTAACCAAATT
GCACTGGACNGGACTCGGAA
>Core.Facility.NAC014-4-M13F
TCTGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT
GATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGCGGCC
GCCTTGTTTAACTTTAAGAAGGAGCCCTTCACCATGAACCAAATAAAAAACAAAACT
TTACCGGAGATGACGACGGAGCAAGCTTTGTTGTCTATGGAAGCTTTACCTTTAGGT
TTCAGATTCAGACCAACGGATGAAGAACTCATCAATCATTACCTAAGGTTAAAAATC
AACGGCCGTGATTTAGAGGTTAGAGTCATCCCTGAGATCGATGTTTGCAAGTGGGAA
CCATGGGACTTACCTGGGCTATCGGTGATAAAGACAGATGATCAAGAATGGTTCTTT
TTTTTGTCCTCGTGATCGAAAGTATCCGAGTGGTCATCGTTCTAATAGAGCTACTGAT
ATTGGTTACTGGAAAGCTACTGGGAAAGATCGAACTATTAAGTCTAAGAAGATGAT
TATTGGTATGAAGAAGACTCTTGTTTTCTATCGTGGAAGAGCTCCTAGAGGAGAGCG
TACTAATGGATTATGCATGAGTATCGTGCTACAGACAAGGAACTAGATGGTACTGG
ACCTGGTCAGAATCCGTATGTTTTGTGTCGCTGGGTCCACAAAGCCTAGGATAGTTT
GTGAATCCTGCACACCTGTGAAGGATATAAGAGAAAGTTAATTTTAACTCCACCCAC
CACCACTAGATGCTCTCTGATGACCATTCTTCTGAAATGGTCAAGAACAGCTCATTG
GGTGTCTTCCTCAAATAATCAGATACCCTAAAGGTGTTAAGTACAGGGCAAATTTAT
TGTACTGAAGTTCAGGGGATACAAAATCTCTGTATATCCCCCGACCTTCCTGTG
70
>Core.Facility.NAC014-4-M13R
TAATCTACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAA
CTTTGTACAAGAAAGCTGGGTCGGCGCGCCCACCCTTTCAAGTAAACATGCCTTTGA
AGGAATCTAATTGATGAAACAAGAAGCTACATTTCGCATCTCTTGACTCTTTCCATA
TTTCTACTAAAACAACTATCACCGCCACTATTATCACCACACTACTAAACTGCACCA
AGCTCTTCTTCTGTTTCTGCCATGATGATGATGATGATATATCTTCTTTTTCCTGCATT
TCACACTTCCTATGGCTTGCTTCTCCTTCTCTGCCATTTGAGTTTCTTTTTGTATTGTT
TAGGGTTATGAGAGGCTTCCTCAATCTCGTCTGCAGGCGGATTCTCCTCTGAGCAGT
CCCCTGAGCACTTAAATTAGCCGGTTCTTCCTCTACGACCTTGGACATGGCAGATTG
TACTTCATCTTCTTCTTCATAGTTGTCCGCATCTCTCTCTTTCTTGTTGGTAACTGGCG
TCAATGGCTGTTCGATCTGCAGCCGAATTCTTCTAGGAGCAGTGCCTTGGTCCACAA
CAGAGTCCAGATCTCTCTGATTCTCTCGAGACAGCCTGAACTCAAAATTGTACTGGA
CTATTGTCGTCACATGCTTGCTCAAGGATACTGTCAGGCTATACATATGTAAATGAT
GATGCTCGTAGCGATAGCATTGCCAAACGTGTATAAGGCGTAGGTCAAGACCGGTG
AAATAACTCTCTCCCTGCAACGTCTGTCCGACACTTAACCAATGCTGACAATTCGGT
ACCGACCTCCAGTCTATCCACCACAACCTTGAAAGGTCTATACCCTGT
71
VITA
PARKER DABBS
Education:
B.A. Biological Sciences, Vanderbilt University, Nashville,
Tennessee 2012
M.S. Biology, East Tennessee State University, Johnson
City, Tennessee 2015
Professional Experience:
Graduate Assistant, East Tennessee State University, College
of Arts and Sciences, 2013-2014
Research Assistant, East Tennessee State University, College
of Arts and Sciences, 2014
Publications:
Kilaru A, Cao X, Dabbs P, Sung HJ, Rahman M, Thrower N,
Zynda G, Podicheti R, Ibarra-Laclette E, Herrera-Estrella
L, Mockaitis K, and Ohlrogge J (2014) Transcriptome
analysis of triacylglycerol biosynthesis in a basal
angiosperm (in review)
Honors and Awards:
James H. Quillen Scholarship
Sigma Xi-GIAR
Fraley Memorial Research Award
ETSU-Graduate Council Research Award
72