Microbiology Roadmap: Helping you Navigate
On the Road
As you read this chapter, ask yourself…
How is the genetic material of a prokaryote organized?
How is the information in the DNA transferred to guide cellular processes?
How is prokaryotic DNA replicated?
How is the information encoded in prokaryotic DNA converted to functional proteins?
How does metabolic regulation in prokaryotes occur?
What are DNA mutations?
What are some of the most common types of DNA mutations and how do they potentially arise?
What are some common mutagens that can induce mutations?
Road Stop (Overview of genetic processes)
Define the following terms:
Heredity____________________________________________________________________________
Chromosome________________________________________________________________________
Supercoiling_________________________________________________________________________
Gene_______________________________________________________________________________
Locus______________________________________________________________________________
Alleles______________________________________________________________________________
Mutation____________________________________________________________________________
Replication___________________________________________________________________________
Transcription_________________________________________________________________________
Translation__________________________________________________________________________
Template____________________________________________________________________________
Reverse transcription__________________________________________________________________
Road Stop (The transfer of information from DNA to protein)
The diagram below shows what has been dubbed ‘the central dogma of molecular biology’ by Francis Crick, the codiscoverer of the structure of DNA. Although deceptively simple, the figure describes information flow in the cell and,
therefore governs the cell’s complexity. After reviewing Figure 7.3 in the text, answer the following questions.
1
1
2
3
4
(1) What is the proper term to describe the process that occurs at each of these four steps? Explain what is
occurring at each step.
(2) Step 4 occurs in only a few types of microbes. According to the text, what types of agents perform this process?
(3) According to this diagram, is there any way for information to flow from a specific protein back to the gene
encoding that protein? Later in the text we will learn about antibiotics and antibiotic resistance, understanding
the answer to this question will greatly help your understanding of the mechanisms by which antibiotic
resistance do and do not arise.
Road Stop (DNA replication)
Define the following terms:
Antiparallel
Origin of replication
Replication fork
Helicase
DNA polymerase
Leading strand
Lagging strand
Discontinuous replication
Okazaki fragments
RNA primer
DNA ligase
Semi-conservative replication
See it in action! (DNA replication in a prokaryote)
Log into your WileyPlus course to view an animation about DNA replication in prokaryotic cells. For more information,
see also Figure 7.4 in the text.
(1) Explain the role of each of the following in DNA replication: helicase, RNA primer, DNA polymerase, ligase
(2) What does it mean that DNA is antiparallel?
(3) DNA replication only proceeds in one direction. What direction is that? Explain how this relates to the
requirement that DNA synthesis has both a leading and lagging strand. You may find it helpful to draw a
replication bubble with two replication forks and the orientation of the DNA clearly indicated. Draw the new
strand being synthesized in the correct direction. What happens at the leading strand (going into the replication
fork)? What happens at the lagging strand (going away from the replication fork)?
2
(4) DNA replication is said to be semi-conservative. What does this mean?
Road Stop (Protein synthesis)
Define the following terms:
Messenger RNA_________________________________________________________________________
Ribosomal RNA_________________________________________________________________________
Transfer RNA___________________________________________________________________________
RNA polymerase________________________________________________________________________
Promoter sequence______________________________________________________________________
Exons vs introns (eukaryotic transcription) ___________________________________________________
Ribosome______________________________________________________________________________
Codons________________________________________________________________________________
Start codons____________________________________________________________________________
Terminator (stop codon) __________________________________________________________________
Genetic code____________________________________________________________________________
anticodons______________________________________________________________________________
See it in action! (Protein synthesis in a prokaryote)
Log into your WileyPlus course to view an animation about protein synthesis in prokaryotic cells. Prior to viewing this
animation, you may want to review Table 7.1 in the text, describing the properties of the different kinds of RNA.
Transcription
(1) Where does transcription in prokaryotes occur? Where does transcription in eukaryotes occur? (Need help? see
pg 184 in the text)
(2) A protein is encoded for by a stretch of nucleotides called a gene. In order for a gene to direct the synthesis of a
protein, however, it must first be transcribed into RNA. What type of RNA is ‘read’ to synthesize a protein?
What enzyme is responsible for synthesizing this RNA and how does that enzyme know where to start the
synthesis of the RNA?
(3) The following is a portion of DNA that will be transcribed into RNA. Indicate the sequence and label the 5’ and
3’ ends of the newly synthesized RNA strand.
3- AAGTGCTAACTGTACTATTTTTTTAAAAAGTACT -5
(DNA seq)
Translation
(1) Where does translation in prokaryotes occur? Where does translation in eukaryotes occur? (Need help? see pg
184 in the text)
(2) Using Figure 7.8 in the text, indicate the sequence of the polypeptide that would be synthesized from the given
mRNA. Make sure that you have ‘established the right reading frame’—that is, where would the ribosome start
to translate this transcript?
5- GGCUAUGUUGACAGUGUCGCCAGUUUCGUGAGUUACA -3
3
(3) Which type of RNA is responsible for delivering the specific amino acids to the ribosome to be ‘stitched together’
into the growing polypeptide?
(4) What is a stop codon?
Road Stop (Regulation of metabolism)
Define the following terms:
Feedback inhibition (end-product inhibition) ____________________________________________________
Enzyme inhibition__________________________________________________________________________
Enzyme repression_________________________________________________________________________
Operon__________________________________________________________________________________
Constitutive enzymes_______________________________________________________________________
Inducible enzymes_________________________________________________________________________
Inducer__________________________________________________________________________________
Regulatory sites___________________________________________________________________________
Repressor________________________________________________________________________________
Attenuation______________________________________________________________________________
Catabolite repression_______________________________________________________________________
Road Stop (The Regulation of Metabolism)
Bacteria, and most other organisms, are parsimonious by nature. That is, they are frugal with their energy and
materials. Because of this, bacteria have developed methods for efficiently turning on and off genes. We previously
have discussed feedback inhibition in terms of metabolism (chapter 5); feedback inhibition arises when the end-product
of a pathway binds in an allosteric fashion to an enzyme early in the pathway, thus halting the pathway prior to the
commitment of materials and energy by the cell (see figure 7.13). This is post-translational regulation—meaning that it
controls the formation of an end-product after the enzymes in the pathway have already been made. Your text
discusses other forms of regulation, such as the ability to turn on (induce) or turn off (repress) the transcription of a
gene or operon when the proteins that are encoded are not needed. In these examples, the enzymes for synthesizing or
breaking down a particular substrate are not even made unless needed. The most well-characterized example of a
regulated operon is the lac operon, which encodes enzymes responsible for the breakdown of lactose (Figure 7.14 and
the animation on WileyPlus). Note that only the regulation of the operon with respect to lactose is shown in the
following figure. This operon is actually influenced by levels of glucose, as well—cells are more efficient at using glucose
and as long as this substrate is around, the lac operon will be off, even in the presence of lactose. This is known as
catabolite repression.
4
(1) The lac operon, as shown in this figure, has two important regulatory sites, the promoter and the operator.
What binds to the promoter? What binds to the operator?
(2) In order for the regulation of the lac operon to function, the lac repressor protein must be constitutivelyexpressed. What does ‘constitutive’ mean?
(3) When the operator is bound, is the lac operon on or off? Why?
5
(4) What happens at the lac operator when lactose is present?
(5) When lactose is present, is the lac operon on or off? Why?
(6) Fill out the following table:
Lactose present
Lactose absent
Is the lac repressor made?
Is the lac operator bound by repressor?
Can the lac promoter bound by RNA polymerase
Is the lac operon on?
Are the enzymes for the utilization of lactose synthesized?
Road Stop (Mutations)
Define the following terms:
Mutation_______________________________________________________________________________
Genotype vs phenotype____________________________________________________________________
Point mutations__________________________________________________________________________
Frameshift mutations_____________________________________________________________________
‘silent’ mutation_________________________________________________________________________
Spontaneous mutations___________________________________________________________________
Induced mutations________________________________________________________________________
Mutagens_______________________________________________________________________________
Polymerase chain reaction (in Applications, pg 204) _____________________________________________
At a crossroads: Point mutations vs Frameshift mutations
Now that we understand the genetic code and how proteins are made, we are prepared to better understand how
mutations can have an effect on normal cell processes. While there are other types of mutations, we will concern
ourselves with the two most common—point shift mutations and frameshift mutations. Look at Figure 7.16, Figure 7.17
and Table 7.3. Log into your WileyPlus course to view an animation about these two types of mutations.
(1) What is a point mutation?
(2) Using figure 7.8 and tryptophan and valine as examples, explain how a point mutation in the DNA could have a
dramatic effect on the sequence of a protein, or may not have an effect on the sequence of a protein at all.
(3) What is a frameshift mutation?
(4) Which is more likely to have a significant effect on the synthesis of a protein, a single point mutation or a single
frameshift mutation within the coding sequence? Why?
Reaching Your Destination: Compass Checklist Questions
After reading this chapter, you should be able to answer the following checklist questions.
6
(1) What is the central dogma of molecular biology?
Need help? Look at page 183 and look at Figure 7.3.
(2) How is prokaryotic DNA replicated?
Need help? Look at pages 183-184 and view the animation on WileyPlus.
(3) What is transcription?
Need help? Look at pages 184-188; pay particular attention to the types of RNA that can be synthesized and
what their roles in protein synthesis are.
(4) What is translation?
Need help? Read the text on pages 188-191 and view the animation on WileyPlus.
(5) What is the genetic code and how does it drive the transfer of information from DNA to the proteins?
Need help? See pages 188 and Figure 7.8.
(6) How is metabolism regulated?
Need help? See page 192.
(7) How is the lac operon regulated by a combination of repression and induction?
Need help? See pages 192-194 and view the animation on WileyPlus.
(8) What are point mutations and frameshift mutations and how do they potentially effect the sequence of
proteins?
Need help? See pages 196-198, Figures 7.16 and 7.17 and the animation on WileyPlus.
(9) What are some of the more common mutagens capable of inducing mutations in prokaryotes?
Need help? See pages 198-200.
Self Quiz
How much did you learn on your journey? Perform a self-diagnostic.
(1) True or False, in certain microbial agents information in the cell can flow both from DNA to RNA and from RNA
to DNA.
(2) Which of the following enzymes is used more frequently on the lagging strand and little or not at all on the
leading strand during DNA replication:
a. DNA polymerase
b. Helicase
c. Ligase
d. All of the above are equally important on both strands
(3) Which of the following RNA molecules serve as the template for protein synthesis?
a. mRNA
b. tRNA
c. rRNA
d. None of the above (DNA serves as the template for protein synthesis)
(4) True or False, transcription and translation in prokaryotic cells cannot occur simultaneously because the RNA
must move out of the nucleus prior to being translated.
(5) The reading frame (start) of protein synthesis in bacteria always begins with:
a. UGG (encoding tryptophan)
b. AGU or AGC (both encoding serine)
c. AUG (encoding methionine)
d. UGA (encoding the ‘start’ signal)
7
(6) When lactose is present (and glucose is absent), which of the following is not true about the lac operon?
a. The RNA polymerase binds to the promoter
b. The repressor is being made
c. The three genes of the lac operon are being expressed
d. The repressor binds to the operator
(7) Which of the following is a ‘stop’ codon?
a. UGA
b. UAG
c. UAA
d. All of the above are ‘stop’ codons
(8) In this sequence, the top strand is the original sequence and the bottom strand has a mutation.
5’- AUGGUACCGGCCUUAGGAAGGUGC -3’
5’- AUGGUACCCGGCCUUAGGAAGGUGC -3’
This type of mutation is best described as (you may need to use Figure 7.8 in the text):
a. Point mutation (silent)
b. Point mutation
c. Frameshift mutation (insertion)
d. Frameshift mutation (deletion)
Off the Map
The polymerase chain reaction, or PCR, ranks among one of the most significant technological achievements in all of
biology. For more insight into what PCR is and what it can be used for, read Applications and view the accompanying
figure on pages 204 and 205 in the text. Additionally, log onto WileyPlus and view the polymerase chain reaction
animation.
PCR was first developed by Kary Mullis. For his efforts, he was awarded the share of the Nobel Prize in Chemistry in
1993. In his Nobel Prize lecture, Dr. Mullis attempted to offer a rare insight into the personal and scientific
circumstances that surrounded his discovery. During the course of this semester, you will cover, and hopefully learn,
vast amounts of information. In the crush of the material, it is easy to forget that every piece of information, while
perhaps not as revolutionary as the development of PCR, was the product of very hard work by individuals just like you
and I. Dr. Mullis tried to bring a sense of the personality behind the science to his lecture.
After you have familiarized yourself with the process of PCR using the associated material in the text, go to
http://www.nobelprize.org/nobel_prizes/chemistry/laureates/1993/mullis-lecture.html to read how Dr. Mullis
discovered the process that revolutionized molecular biology and increased our understanding of the very nature of life.
As you read the essay, consider the following questions:
8
(1) Given the heightened concern with safety and security in today’s society, how might Dr. Mullis’ childhood life
have been different? How do you think that might have affected his willingness to try something that had never
been done before as he developed PCR?
(2) Throughout the lecture, there is a strong thread that suggests that his personal life, particularly his relationships,
affected his professional development. Can you point to one of two instances where his development of PCR
was fueled by what was going on in his personal life?
(3) Dr. Mullis mentions that his friend suggested that he quit the company for which he worked and patent the idea
for PCR himself in order to preserve the profits. Do you think his decision to stay was a good one or a bad one?
Why? (Keep in mind that he has won the Nobel Prize, which comes with a cash reward, and earns money off of
the licensing—so he has been well recompensed, but perhaps not like he would have been if he were the sole
owner of the patent.) Would you have the same thoughts about his decision were he making them now, 30
years later?
(4) What was one thing that surprised you about the lecture?
(5) They say that hindsight is 20/20. One of the interesting things about his lecture is that Dr. Mullis has a very
strong narrative that leads from his life as a young boy to his discovery of an amazing technological innovation; it
is almost as if the invention of PCR was just a logical conclusion of his childhood. If you won the Nobel Prize
today for having achieved all you have thus far achieved, or if you win it in the near future shortly after reaching
your career goals, are there narrative points in your life that connect to that achievement? This could be
consideration only, not a written answer, but note that this kind of exercise could help you significantly in your
essays and interviews as you progress toward achieving your career goals. Also, keep in mind that his narrative
points were as much about his development as a person as they were about his development as a professional—
his lecture would suggest that the two were inseparably intertwined in his ability to invent PCR.
9