Biology of Blood and Marrow Transplantation 11:890-902 (2005) 䊚 2005 American Society for Blood and Marrow Transplantation 1083-8791/05/1111-0006$30.00/0 doi:10.1016/j.bbmt.2005.07.008 Cytomegalovirus Immune Reconstitution Occurs in Recipients of Allogeneic Hematopoietic Cell Transplants Irrespective of Detectable Cytomegalovirus Infection Ghislaine Gallez-Hawkins,1 Lia Thao,1 Simon F. Lacey,2 Joybelle Martinez,2 Xiuli Li,1 Anne E. Franck,1 Norma A. Lomeli,3 Jeff Longmate,3 Don J. Diamond,2 Ricardo Spielberger,4 Stephen J. Forman,4 John A. Zaia1 1 Division of Virology, 2Laboratory of Vaccine Research, and 3Division of Information Sciences, Beckman Research Institute, and 4Department of Hematology and Bone Marrow Transplantation, City of Hope National Medical Center, Duarte, California Correspondence and reprint requests: John A. Zaia, MD, Beckman Research Institute of the City of Hope, Division of Virology, 1500 E. Duarte Rd., Duarte, CA 91010 (e-mail: [email protected]). Received June 6, 2005; accepted July 13, 2005 ABSTRACT The question of when immune reconstitution of cytomegalovirus (CMV)–specific CD8 T cells occurs after hematopoietic cell transplantation and, more specifically, to which CMV targets this immunity is likely to be directed remains poorly understood. The dependence of immune reconstitution on CMV reactivation is even less clear. To better understand these events, 44 CMV-seropositive HLA-A*0201 subjects were followed up at approximately days 40, 90, 120, 150, 180, and 360 after hematopoietic cell transplantation for CMV immunity as measured by 2 types of assays: (1) an HLA-A*0201 tetramer-binding assay for both CMV pp65 (pp65) and immediate-early 1 (IE-1) or (2) intracellular cytokine interferon ␥ responses induced by pp65 or IE-1– derived peptides. To verify the reliability of IE-1–specific assays relative to the pp65-based assays, a pilot study first compared the development of IE-1–specific immunity in a subgroup by using multiple HLA-A*0201–restricted peptides, and then these recipients were followed up for 1 year for immunologic function and for CMV infection. The IE-1–specific response occurred to each of the 3 HLA-A*0201–restricted peptides studied (IE-1-256, -297, and -316), and there was no predominant IE peptide response. However, the immunodominant HLA-A*0201–restricted pp65 peptide was recognized significantly more frequently than these IE-1 peptides. When this was compared with the occurrence of CMV infection, the overall immune reactivity, as measured by the mean or median number of CD8ⴙ T cells reactive to either pp65 or IE-1 peptides by intracellular cytokine or tetramer binding assay, was not significantly different in those with and without CMV infection. For patients who demonstrated reconstituted immunity to CMV at 1 year, all were reconstituted by 6 months, and the timing of the first observed immune reactivity to either of the pp65 or the IE peptides was not different in those with and without detectable CMV infection. © 2005 American Society for Blood and Marrow Transplantation KEY WORDS Cytomegalovirus ● Hematopoietic cell transplantation Immune reconstitution ● Tetramer INTRODUCTION Quantitative assessment of HLA-restricted T-lymphocyte recognition of specific antigens currently analyzes cells by using methods that can enumerate the binding of recombinant HLA-peptide antigen complexes or the specific induction of intracellular cyto890 ● Intracellular cytokine responses ● kines (ICCs). These methods have been applied to the analysis of risk for cytomegalovirus (CMV) complications after allogeneic hematopoietic cell transplantation (HCT; see review [1]). Because CMV seems to encode more than 200 polypeptides, the immune response to CMV is complex and involves multiple protein targets, and the peptide sequences of the HLA- CMV ICC and Tetramer Binding specific restriction elements are known for only a few of the CMV proteins [2]. The most abundant viral protein, CMV pp65, is the apparent immunodominant target of the immune response [3-5], and most analyses of the protein-specific immune response after HCT have focused on CMV pp65. For CMV pp65, the immune response in HCT recipients has been well described [5-9]. In HLA-A*0201– restricted responses, the pp65-495 (NLVPMVATV) peptide is known to induce a CMV pp65 protein– specific ICC response [4,5,10], and when this peptide is used to fold recombinant tetrameric major histocompatibility complex molecules, a remarkable number of T cells can often be enumerated [8,11-14]. The cellular immune response to the CMV pp65 protein is therefore robust and has been used to characterize the immune response to CMV in other HLA contexts, such as B7, A1, and B35 [2,8]. By using the binding of CMV pp65–specific HLApeptide complexes to CD8 cells as a measure of CD8 immunity, it has been reported that levels reaching 10 ⫻ 106 CD8 tet⫹ cells per liter are associated with protection from CMV disease in HCT recipients [15] and that use of ganciclovir for treatment of CMV infection is significantly less if there are ⱖ2 ⫻ 106 CD8 tet⫹ cells per liter [14]. Few targets of CMV immunity have been used in these assessments, and, because of the potential for CMV to selectively escape from immune detection, it has been suggested that the apparent immunodominance of CMV pp65 might lead to overinterpretation of this protein as an important target of protective immunity [16]. Rather, immunity to other CMV proteins, especially those made at immediate early times after infection, might be protective. A recent report in CMV-seropositive heart/lung transplant recipients indicated that immunity to CMV IE-1 and not to CMV pp65 was more protective [17]. Less is known about the immune response to CMV IE-1, which is one of the first proteins expressed after virus reactivation. CMV IE-1 is clearly a target of T-cell immunity after CMV infection, and an early report [18], confirmed by others [19], described the IE-1-316 (VLEETSVML)–specific peptide response in cells from 6 of 18 HLA-A*0201 subjects by using an interferon (IFN)–␥ enzyme-linked immunospot assay. The IE-1-315 peptide and some of its variants [19,20] and IE-1-354 [21] have been reported to trigger cytotoxic responses as well. In the primary immune response to CMV infection in infants, it is known that IE-1-316 –specific responses are a major component of cellular immune reactivity [22]. In addition, we have reported that, using transgenic HLA-A*0201 mice immunized with CMV IE-1 DNA, there is CMV IE-1–specific cytotoxic T-lymphocyte recognition of several peptides, including IE-1-297, IE-1-316, and IE-1-256 [23]. BB&MT The purpose of this study was to describe the onset and durability of CMV immune reconstitution in allogeneic HCT as measured by T-cell immune recognition of CMV pp65 and CMV IE-1 and to assess the effect of CMV reactivation on quantitative measures of such cellular immunity. We found that, as anticipated, the CMV pp65 response was significantly more robust than the CMV IE-1 responses, but in certain recipients, IE-1 responses were higher than pp65-specific responses. Contrary to conventional wisdom, however, the onset of detectable CMV immunity was not dependent on documented CMV viremia or DNA-emia, and there was no statistically significant difference between CMV immunity to CMV pp65 and CMV IE-1 in those with and without detectable CMV reactivation. This indicates that occult CMV reactivation is sufficient to induce reconstitution of immunity in HCT recipients. PATIENTS AND METHODS Study Patients Allogeneic HCT recipients, including related sibling donors and recipients of unrelated donor transplants at risk for CMV infection because of donor and/or recipient CMV seropositivity, were enrolled at the City of Hope Comprehensive Cancer Center with the approval of the institutional review board. During 2001 to 2004, 44 recipients were studied. Within this group, a pilot subgroup of 11 consecutive HLA-A*0201 subjects and their donors, when available, was evaluated for comparative responses to IE-1 peptides and the CMV pp65-495 peptide; this was done with frozen, density-gradient purified leukocytes. After this, a group of 33 consecutive HLA-A*0201 subjects were analyzed for evidence of immunity to IE-1 and CMV pp65 by using fresh whole blood samples. Donor samples (unrelated donors not included) were drawn before the administration of granulocyte colony-stimulating factor and later at the time of cell harvest. Recipient blood samples were collected at day 40, 90, 120, 150, 180, and 360 after transplantation for ICC and tetramer-binding assays, and the CMV reactivation was monitored at day 21 after HCT and twice weekly until day 100 by using a shell vial assay and quantitative polymerase chain reaction (PCR). After day 100, CMV was monitored in patients at high risk because of graft-versus-host disease (GVHD) or immunosuppressive medication. Subjects with reactivation of CMV infection as determined by 1 positive shell vial sample (CMV blood culture [BC]) or 2 consecutive positive PCR assays (CMV PCR) were treated with preemptive ganciclovir for 6 weeks as previously described [24]. For the purpose of analysis, recipients were placed into a CMV group, meaning that they had at least 1 positive CMV blood shell vial culture or 1 PCR-positive plasma test, or into a no-CMV group, meaning that 891 G. Gallez-Hawkins et al. these conditions were not met despite frequent viral surveillance. All patients underwent ⱖ90% of the scheduled viral and immunologic surveillance. of the assay was 200 gc/mL of plasma. No PCR inhibition was detected in samples when the EXO gene was introduced into the PCR mixture, as described by Limaye et al. [26]. Transplantation Protocol The HCT protocol was essentially performed as described by Bensinger et al. [25], but the conditioning regimen was modified according to patient age and diagnosis. Briefly, the disease-specific conditioning regimens consisted of high-dose chemotherapy with or without total body irradiation and were administered before transplantation. Most recipients received peripheral blood stem cells collected after treatment of the donor with subcutaneous granulocyte colony-stimulating factor (16 g/kg/d for 4 days). For some recipients, marrow was used for transplantation and was collected from the donor by standard techniques on the day of infusion. Isolation and Preservation of Peripheral Blood Mononuclear Cells Peripheral blood mononuclear cells from heparintreated whole blood were isolated by using Histopaque1077 (Sigma, St. Louis, MO) density gradients, washed with 1⫻ phosphate-buffered saline (PBS), and cryopreserved in aliquots of 3 to 5 ⫻ 106 cells per milliliter in 90% fetal bovine serum (HyClone, Logan, UT) and 10% dimethyl sulfoxide (American Type Culture Collection, Manassas, VA). The plasma was collected by centrifugation, filtered through a 0.45-m Acrodisc (Pall Corp., Ann Arbor, MI), and stored at ⫺20°C until DNA extraction. Quantitative PCR Quantitative PCR was performed with DNA extracted from 200-L plasma samples by using the QIAamp DNA Blood Minikit (Qiagen, Valencia CA) and resuspended in 200 L of elution buffer. A glycoprotein B (gB) CMV DNA sequence was amplified by using 1 picomole of the forward primer 5=CTGGCCAGGCCCAAGAC-3=, 1 picomole of the reverse primer 5=CGGCCATTTACAACAAACCG3=, and 1 picomole of the probe 5=-FAM-CCCATGAAACGCGCGGCA-TAMRA (Applied Biosystems, Foster City, CA) in a 30-L reaction that contained the TaqMan Universal PCR Master Mix (Applied Biosystems) and 10 L of extracted DNA. The PCR cycles were set according to the manufacturer’s protocol: 2 minutes at 50°C and 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C, and the data were collected and analyzed on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). Serial dilutions (100-106 genome copies [gc]) of the plasmid containing the amplified sequence (pDCMVgB) were used for determination of a standard curve. The sensitivity 892 Peptides Peptides were synthesized at the City of Hope peptide-synthesis core facility (IE-1 peptides) or in the laboratory of D.J.D. (pp65-495 and human immunodeficiency virus [HIV]– 468) by using an ABI 432A (PE Biosystems, Foster City, CA) or a Pioneer (Perseptive Biosystems Inc., Framingham, MA) peptide synthesizer and standard Fmoc protocols with purification to 90% by high-performance liquid chromatography. They were dissolved in 10% dimethyl sulfoxide/water to a concentration of 5 mmol/L and used at a final concentration of 25 mol/L for T-cell stimulation. The following peptides were used: IE-1-256 (ILDEERDKV), IE-1-297 (TMYGGISLL), IE-1316 (VLEETSVML), pp65-495 (NLVPMVATV; as a positive control), and HIV-468 (ILKEPVHGV; as a negative control). IFN-␥ ICC Detection For the first group of 11 subjects, frozen samples from each patient were thawed at 37°C and washed with cold RPMI with 10% fetal bovine serum, and aliquots of approximately 1 ⫻ 106 peripheral blood lymphocytes (PBLs) were stimulated with individual peptides (pp65-495, IE-1-256, IE-1-297, and IE-1316) in separate tubes or an IE-1 peptide mixture in 1 tube, as indicated in the experiment. The positive stimulation control was phytohemagglutinin (Remel, Lenexa, KS), and the negative control was HIV peptide. The ICC assay was adapted from Dunn et al. [27] for frozen cells. After 1 hour of incubation at 37°C in 5% carbon dioxide, 1 L (stock 5 mg/mL) of brefeldin A (Sigma), a cytokine secretion inhibitor, was added to the cells and further incubated overnight. When fresh blood samples were used for the second group of 33 subjects, 200 L of whole blood was treated as described previously but was incubated at 37°C for only 4 hours. Samples were then washed with 1⫻ PBS and 0.5% bovine serum albumin (Sigma) and stained with 5 L of anti-CD8 conjugated to streptavidin-phycoerythrin (CD8-PE; Pharmingen, San Diego, CA) for 20 minutes in the dark. The cells were fixed and permeabilized for 20 minutes by using the Cytofix/Cytoperm Kit (Pharmingen) and stained with 1 L of anti–IFN-␥ conjugated with streptavidinallophycocyanin (APC) for 30 minutes at 4°C in the dark. Samples were washed twice with 1⫻ Cytofix Wash Solution (BD Biosciences, Pharmingen, San Jose, CA) and analyzed with the fluorescence-activated cell sorter (FACS) FACSCalibur (Becton Dickinson, San Jose, CA). The lymphocytes were gated on BB&MT Table 1. Demographics of the 11 Allogeneic Stem Cell Transplant Subjects Patient No. Diagnosis CMV Serostatus (Donor/Recipient) ⴙ 53 ALL Phⴙ D /R 65 76 CML ALL 81 ⴙ Hematopoietic Stem Cell Source HLA CMV PCR (Genome Copies/mL)* CMV BC Antiviral Treatment Grade of GVHD (Months after HCT) A0101 A0201 neg neg No Dⴙ/Rⴚ Dⴙ/Rⴙ UD BM UD BM A0201 A0201 A1101 A6901 neg neg neg neg No No Pre–B-ALL Dⴙ/Rⴙ Sibling PBSC A0206 A2402 neg neg No 91 ALL Dⴙ/Rⴙ Sibling PBSC A0201 A2601 neg neg No 98 CML Dⴙ/Rⴙ Sibling PBSC A0205 A1101 neg neg No 54 Biphenotypic leukemia Dⴚ/Rⴙ UD BM A0101 A0201 1416-10,234 (37) Yes (69) GCV 70 AML Dⴙ/Rⴙ Sibling PBSC A0203 A0206 4755-12,331 (41) Yes (41) GCV 93 ALL Dⴚ/Rⴙ Sibling PBSC A0201 A3001 202-1838 (39) Yes (55) GCV GVHD III: gut and liver (2) 94 Hodgkin disease CML Dⴙ/Rⴙ UD PBSC A0201 A0301 Yes (50) GCV Dⴙ/Rⴙ Sibling PBSC A0201 A6803 neg No GVHD: gut and liver (2) None 105 neg 205 (72) GVHD of the mouth (1-8) None GVHD II: skin and gut (1); liver (5); skin and eyes (5) GVHD: liver (4) GVHD II: gut (1); liver (4) GVHD: mouth (1); liver (4) CMV colitis; GVHD III: gut (1); mouth, eyes (10) GVHD II: gut (1); stomatitis (2) CSA: 0-6 mo MMF: day 28 to 6 wk PSE 3 d; FK506 0-3 mo; PSE 6-7; MMF 6-9 Clinical Outcome Alive Alive Dead: multiorgan failure (20 mo) CSA 4-5 mo; MMF 4-5 mo; PSE 4-12 mo CSA 0-1 mo Alive PSE 15 d; CSA 15 d Alive PSE 3 d; MMF 1-4 mo Alive CSA 0-15 mo; PSE 1-6 mo; MMF 812 mo CSA 2-3 mo; MMF 2-3 mo; PSE 2-3 mo CSA 2-3 mo; MMF 2-3 mo Alive Alive Alive Alive Alive ALL indicates acute lymphoblastic leukemia; CML, chronic myelocytic leukemia; AML, acute myelogenous leukemia; UD, unrelated donor; PBSC, peripheral blood stem cells; BM, bone marrow; GCV, ganciclovir; BC, blood culture; GVHD, graft-versus-host disease; CSA, cyclosporine; PSE, prednisone; MMF, mycophenolate mofetil; FK506, tacrolimus; Ph⫹, philadelphia chromosome positive; neg, the result was negative for CMV infection. *Number of days after HCT to first positivity are shown in parentheses. 893 CMV ICC and Tetramer Binding Sibling PBSC Medication >1 mg/kg/d G. Gallez-Hawkins et al. the basis of forward and side scatter, and a minimum of 50 000 events were analyzed per sample. The reported data are the values obtained after subtraction of background levels observed with HIV peptide stimulation (range, 0%-0.5%). On the basis of analysis of CMV-negative donors, a limit of detection of 1 ⫻ 105 cells per liter was established. HLA-A*0201 Tetramer Binding The HLA-A*0201 tetramers were prepared as described previously [8] by using the individual CMV peptides to fold the HLA-A*0201 heavy chain and 2-microglobulin, which were then biotinylated and conjugated with streptavidin-APC (Pharmingen). The samples from each patient were thawed at 37°C, washed with 1⫻ PBS with 0.5% bovine serum albumin, and transferred into polystyrene round-bottomed FACS tubes (Becton Dickinson). Aliquots were then individually labeled with 0.5 to 1 g of tetpp65495, tetIE1-297, and tetIE1-316 and incubated for 1 hour on ice in the dark. The samples were washed and stained with 5 L of anti-CD8 conjugated to streptavidin-phycoerythrin, incubated for 20 minutes, washed again, and, finally, analyzed by FACS. A European multicenter evaluation of this method has been established and validated as a reproducible routine diagnostic assay for the enumeration of antigenspecific CD8 T cells [28]. Statistical Analyses Data were analyzed with GraphPad Prism software (GraphPad Software, Inc., San Diego, CA). The Mann-Whitney U test was used to derive P values for comparing data between groups. RESULTS Clinical Course of CMV Infection for 1 Year after HCT Among the initial 11 recipients studied (Table 1) to establish whether we could readily detect reconstitution of cellular immunity to CMV IE-1, 5 subjects (patients 54, 78, 93, 94, and 105) had at least 1 CMVpositive blood sample by shell vial or had a qualifying CMV DNA quantitative PCR–positive assay in blood plasma. In addition, subject 54 had disease diagnosed as CMV colitis by biopsy. CMV positivity in blood was determined in 4 of 5 subjects for each assay. Of note, patient 54’s donor and the donor for patient 93 were CMV seronegative: this may have explained the prolonged CMV infection detected in these recipients. Six of these subjects had no detectable CMV infection (no-CMV group). GVHD grade II or less occurred in 2 subject in the CMV group and in 6 subjects in the no-CMV group, and GVHD grade greater than II occurred in 2 sub894 jects in the CMV group and in 0 subjects in the no-CMV group. Thus, as anticipated, GVHD was more severe in the CMV group, and the exposure to prednisone therapy at a dose of ⱖ1 mg/kg/d was greater in this group (Table 1). Ganciclovir was used only in the CMV group, but there was a clinical decision not to treat patient 105, who was CMV positive by quantitative PCR only. The overall survival (5/6 versus 5/5) and disease relapse (none) rates for these subjects at 1 year after HCT were the same, and GVHD grade III and CMV reactivation were the main clinical parameters that differentiated the 2 groups. Frequency of IFN-␥ Response to CMV Peptide Stimulation in the Pilot CMV Group and No-CMV Group To evaluate the immune reactivity to CMV in HLA-A*0201 subjects, cryopreserved PBLs were stimulated with peptides derived from CMV pp65 and CMV IE-1 proteins. To ensure the functionality of the stimulated cells, only the samples that responded to phytohemagglutinin stimulation were reported. During the year of observation, the percentage of specimens obtained from subjects in the 2 groups was the same (80% and 77.7%), and all specimens were analyzed for reactivity to pp65-495, IE-1-256, IE-1297, and IE-1-316 peptide stimulation. Figure 1 describes the overall frequency of IFN-␥–positive T-cell specimens in the 2 groups. The CMV group had a higher overall frequency of positive specimens reactive to pp65-495, IE-1-256, IE-1-297, and IE-1-316 peptide stimulation. It was noted that the immune reconstitution to CMV after HCT was characterized by recognition directed to multiple IE-1 peptides in all subjects of the CMV group but that the response to IE-1 peptides in the no-CMV group was generally negative or low. Kinetics of ICC/IFN-␥–Positive Cells after HCT in the CMV Group and No-CMV Group To better understand the occurrence of immune reactivity to these antigens, blood samples were collected at days 40, 90, 120, 150, 180, and 360 after HCT, and the results were expressed as the total number of IFN-␥–reactive cells ⫻ 105 per liter (Figure 2). The IFN-␥–positive cells in the CMV group stimulated with pp65-495 peptide (Figure 2A) peaked at day 120 and 150 after HCT, reaching median levels of 2.75 ⫻ 107 cells per liter, and peptide-responsive cells were still present at 1 year (day 360 median, 3.12 ⫻ 107 cells per liter). The levels of pp65-495–specific IFN-␥–positive cells in the no-CMV group reached a peak (median, 1.8 ⫻ 106 cells per liter) at day 150 and decreased to 3.0 ⫻ 105 cells per liter after 1 year (Figure 2C). With the CMV ICC and Tetramer Binding Figure 1. ICC/IFN-␥–positive samples expressed as a percentage of all samples tested in patients with CMV reactivation or without CMV reactivation (no-CMV group). After overnight stimulation with individual CMV peptides (pp65-495, IE-1-256, IE-1-297, and IE-1-316), samples were analyzed for IFN-␥ by using an intracellular cytokine (ICC) assay as described in “Patients and Methods.” The detection limit was 0.01% of CD8⫹/IFN-␥–positive cells or 1 ⫻ 105 cells per liter after subtraction of background data by using an HIV peptide. nonparametric Mann-Whitney 2-tailed test, there was no significant difference by using the mean ICC level of each subject and the highest peak reached between those with and without CMV infection (compare Figure 2A and C; P ⫽ .08). The IFN-␥–positive cells stimulated with IE-1256, IE-1-297, and IE-1-316 were reported as the sum of the total number of cells ⫻ 105/L for the evaluation of the response to CMV IE-1, as shown in Figure 2B and D. As indicated by the difference in the y-axis range, the levels of CMV IE-1/IFN␥–positive responsive cells were a log lower than the CMV pp65–specific levels and did not seem to increase until late after HCT. The median CMV IE-1 immune response in the CMV group was 3.8 ⫻ 106 cells per liter at 1 year (Figure 2B) compared with 4 ⫻ 105 cells per liter in the no-CMV group (Figure 2D). The level of ICC response to CMV pp65 as compared with IE-1 peptides was significantly different (Mann-Whitney test; P ⫽ .03) in the CMV reactivation group, but there was no such difference in the no-CMV group. In summary, a detectable number of T cells were reactive to CMV pp65 and IE-1 in the CMV group, but because the sampling was small, there was no significant difference between the CMV infection group and the no-CMV group. For this reason, a larger cohort of subjects was analyzed (see below). Relationship between CMV Reactivation by PCR and Levels of CMV-Reactive Cells by ICC in the CMV Reactivation Group The question of what effect CMV reactivation has on CMV immune reconstitution was addressed by comparing the timing to the 2 events. CMV BB&MT reactivation started at a median of 55 days after HCT, and, as shown in Figure 3, the immune responses after this infection varied for individual recipients, with no predictable expansion of T cells reactive to any specific CMV peptide or peptides of pp65 or IE-1. To summarize the observations in this group of subjects, the presence of an ICC response to pp65-495 did not automatically imply reactivity to CMV IE-1 peptides (Figure 3; subjects 54 and 105), nor did the absence of a brisk response to CMV pp65 mean that there would not be a robust CMV IE-1 response (Figure 3; subjects 70 and 94). Despite the administration of immunosuppressive drugs, there was evidence of a high level of pp65-495–reactive CD8 cells in the presence of prolonged CMV infection (Figure 3; subject 93). The prolonged CMV infection was also found in subject 54, and the low levels of CD8 responses to pp65 or IE-1 corresponded to heightened immunosuppression with prednisone and mycophenolate mofetil (Table 1). Of note, there was a simultaneous response to all 3 IE-1 peptides within the same sample in all subjects at some time after CMV infection, but this was never observed in the noCMV group (data not shown). Assessment of the Immune Response by Tetramer-Binding Assay HLA-A*0201 tetramers labeled with the APC molecule were prepared with pp65-495, IE-1-297, and IE-1-316 peptides, and the binding of these tetramers was evaluated on the same samples tested for IFN-␥ ICC (Figure 4). The CMV reactivation group was defined by high levels of CD8⫹/tetpp65495 cells that appeared at day 120 after HCT (median, 6.36 ⫻ 107 cells per liter) and was maintained throughout the year (day 360 median, 8.23 ⫻ 107 cells per liter; Figure 4A). In contrast, the number of cells binding to CD8⫹/tetIE-1-297 and CD8⫹/ tetIE-1-316, expressed as a sum, steadily increased to a median of 3.7 ⫻ 106 cells per liter at day 360 (Figure 4B). Of note, the median levels of CD8⫹/ tetpp65-495 and CD8⫹/tetIE-1 at day 40 after HCT in the CMV reactivation group were similar (median, 5 ⫻ 106 and 7.4 ⫻ 106 cells per liter, respectively). However, upon CMV reactivation, the immune cells specific for CMV pp65 increased to 7.58 ⫻ 107 cells per liter by day 150, whereas the cells specific to CMV IE-1 decreased to 1.8 ⫻ 106 cells per liter. Of note, the no-CMV group developed a peak median CD8⫹/tetpp65-495 cell count at a later time (median, 2.28 ⫻ 107 cells per liter at day 180; this decreased to 4 ⫻ 105 cells per liter by 1 year; Figure 4C). Although higher at day 40 in the CMV reactivation group, the levels of CD8⫹/ tetIE-1 remained the same in both groups (Figure 4B and 4D) throughout subsequent observation in 895 G. Gallez-Hawkins et al. Figure 2. Levels of CMV-specific CD8⫹/IFN-␥–positive cells at various times after HCT. CMV peptide–specific CD8⫹ cells were stimulated in the CMV-reactivation group (A and B) and in the no-CMV group (C and D). A and C, Cells stimulated with pp65-495. B and D, Sum of cells stimulated with IE-1-256, IE-1-297, and IE-1-316. The number of IFN-␥–positive cells, expressed as x times 1 ⫻ 105 cells per liter, is shown after subtraction of background data by using HIV peptide stimulation. The median value was calculated at each time point and is shown on the graph as a continuous line. the year after transplantation. The tetramer-binding data therefore indicate that the CMV-specific CD8⫹ immune cells are present in reasonably high quantity in HCT subjects during hematopoietic reconstitution whether or not there is detectable CMV reactivation. Further Evaluation of pp65 and IE-1 Peptide Pools in HLA-A*0201 Subjects On the basis of this experience indicating that ICC-positive cells could be observed after stimulation with individual IE-1 peptides, the follow-up protocol used fresh whole blood cells from HCT subjects stimulated with an IE-1 mixture of these peptides specific for HLA-A*0201: namely, CMV IE-1-256, IE-1-297, and IE-1-316 and the pp65495 peptide. Figure 5 shows the results of 23 subjects with CMV reactivation (Figure 5A and C) and of 10 subjects (Figures 5B and D) in the no-CMV 896 group followed up for 1 year. IFN-␥ responsiveness to CMV pp65 peptide (Figures 5A and B) and to IE-1 (Figure 5C and D) was compared between groups. With use of a contingency table (Fisher exact test) to test whether CMV reactivation was predictive for the presence of either CMV pp65– reactive or CMV IE-1–reactive cells at any time after transplantation, there were no significant differences between groups. The CMV group displayed more CMV pp65–reactive T cells (compare Figure 5A and B) and CMV IE-1–reactive T cells (compare Figure 5C and D), but these levels were not significantly different. Time to First Evidence of CD8 IFN-␥–Positive CMV-Specific T Cells after HCT We next asked whether there was a difference in the time to first demonstration of immune reconsti- CMV ICC and Tetramer Binding Figure 3. CMV immunity and CMV infection. CMV reactivation is shown for each individual (patients 54, 70, 93, 94, and 105) as a bold line at the top of the graph showing the time to PCR positivity after HCT. The number of pp65-495–specific /IFN-␥–positive cells is shown in (A), and IE-1–specific peptides consisting of IE-1-256, IE-1-297, and IE-1-316 stimulation are shown in (B). The number of IFN-␥–positive cells, expressed as x times 1 ⫻ 105 cells per liter (y-axis), is shown after subtraction of background data by using HIV peptide stimulation. The time after HCT for each subject is on the x-axis, and, when available, the number of cells is shown for the donor before and after granulocyte colony-stimulating factor treatment (PreG and PostG, respectively). tution in the CMV and no-CMV groups. For this, we defined immune reconstitution as the first observation of at least 1 ⫻ 105/L CD8 IFN-␥ responsive to pp65495 peptide (Figure 6A) or to IE-1 peptide mixture (Figure 6B). There was no difference between subjects with and without CMV infection in the time to first evidence of T-cell immunity by either pp65 or IE-1 BB&MT responses. An important observation is that the time to immune reconstitution was at least as early and complete in subjects with no detectable CMV infection as in the subjects in whom CMV reactivation was seen. One hundred percent immune reconstitution was never attained in the subjects who had documented CMV infection. In all recipients, however, if 897 G. Gallez-Hawkins et al. Figure 4. Time course of tetramer-positive T cells after HCT. The number of tetramer-positive cells specific to pp65-495 (A and C) and the sum of tetramer-positive cells specific to IE-1-297 and IE-1-316 (B and D) are shown. The left panels (A and B) represent results for subjects with documented CMV reactivation, and the right panels (C and D) represent results in subjects with no documented CMV infection. The number of IFN-␥–positive cells is shown as x times 1 ⫻ 105 cells per liter, and the median value is calculated at each time point and shown on the graph as a continuous line. immune reconstitution was to occur during the first year after HCT, then it was present by 6 months. DISCUSSION In this work, the evaluation of CMV immunity in HCT HLA-A*0201 subjects relied on 2 assays (the ICC/IFN-␥ and tetramer-binding assays) and on reactivity to 2 major CMV proteins (CMV pp65 and CMV IE-1). This is the first comparative study that used both of these antigens to characterize the time of CMV immune reconstitution after HCT. The tetramer-binding assay has been widely used because it permits the quantification of cytotoxic T lymphocytes in a simple assay by using flow cytometry [8,11, 13,14,18,29-39]. It is useful for measuring cellular immune responses to CMV pp65 because it targets 898 mainly 1 immunodominant epitope, the pp65-495 of the HLA-A*0201 allele. Other epitopes encompassing CMV pp65 have been described for other HLA alleles, thus suggesting that CMV pp65 is a major target for immune responses [5]. In contrast, the CMV IE-1 protein presents multiple peptides in the same HLA context and therefore requires multiple tetramer reagents. This places added requirements on the tetramer technology for determining the immune status of an individual, but multiplex tetramer reagents have been developed to address this. Our report shows that the median value of CD8⫹/tet⫹ cells binding to tetpp65-495 in subjects with documented CMV infection after HCT, expressed as the concentration of cells per microliter, was 10-fold higher than that in patients with no such CMV infection. Also, the pp65495 peptide–specific response was consistently higher CMV ICC and Tetramer Binding Figure 5. Levels of CMV-specific CD8⫹/IFN-␥–positive cells at various times after HCT. An ICC assay on fresh blood from 33 HLA-A*0201 subjects stimulated with CMV-pp65 peptide (A and B) or a mixture of IE-1–specific peptides (CMV IE-1-256, -297, and -316; C and D) is shown. A and C, Number of cells obtained in recipients with detectable CMV reactivation (23 subjects). B and D, Results from those with no detectable CMV infection (10 subjects). than the IE-1–specific response. Of note, when compared with the ICC assay at peak time, only 43% of pp65-495-tet⫹ cells were expressing IFN-␥ (compare Figure 2A and Figure 4A); this suggests that more than half of the tet⫹ cells were not functional and agrees with the results of others [1,32,37]. During CMV reactivation, the CMV IE-1 protein is the first protein to be expressed in infected cells, and, therefore, it should be part of the immune response during immune reconstitution. By using the peptides uncovered with the HLA-A*0201 transgenic mouse model, namely, the CMV IE-1-256, -297, and -316 peptides [23], PBLs from HCT recipients were stimulated and tested by ICC/IFN-␥ assay at various times up to 1 year after HCT. After detectable CMV reactivation, all 3 CMV IE-1 peptides stimulated Figure 6. Percentage of HCT recipients with CMV-specific T-cell immune reconstitution. The cumulative incidence of IFN-␥–positive cells stimulated with pp65 (A) or a mixture of IE-1 peptides (B) is shown at the indicated times after HCT. The recipients with detectable CMV infection (CMV group) are shown as a continuous line, and those with no detectable CMV infection (no CMV) are shown as a hatched line. The log-rank test showed no significant differences between the 2 curves in (A) and (B). BB&MT 899 G. Gallez-Hawkins et al. PBLs in all 5 subjects at some time between day 40 and day 360 after HCT. There was no indication that one peptide use was more prominent than the others in the CMV reactivation group; therefore, a CMV IE-1 peptide mixture was used in the follow-up study of 33 subjects to determine the detection of immune cellular reactivity. Moreover, in the HLA-A*0201 context, the immune response in the CMV reactivation group to CMV IE-1 was always lower than that to CMV pp65. The highest median value was observed at day 360 (Figure 2B), thus suggesting that there may be additional antigenic stimulation and expansion after CMV reactivation. The CMV IE-1 ICC cell count was still low at day 180 even though the median time to the first day of CMV reactivation was day 55 after HCT. The pp65 response increased briskly between days 100 and 180 after HCT and remained high at 1 year, especially after CMV infection. In the no-CMV group, there was a low-level tet⫹ response to both pp65-495 and IE-1 during the same period, and this population of T cells never expanded, remaining at very low levels at 1 year. It is likely that exposure to CMV antigen is required for these CD8 expansions and that, in the no-CMV group, if there was an initial CMV reactivation state, it was then limited, never reached detectable levels in blood, and was never sufficient to lead to expansion of CD8-specific cells. Nevertheless, on the basis of these immunologic observations, it seems that many allogeneic HCT recipients at risk for CMV undergo occult CMV reactivation even when there is no documented infection. The fact that the patients with no detectable CMV infection had the earlier and the most complete immune reconstitution to CMV suggests a previously unrecognized phenomenon of subclinical CMV reactivation that is shown only by the occurrence of CMV-reactive T cells. The question is why there is a reduced response to CMV IE-1 compared with pp65. The immune system may not be exposed as much to the IE protein during the reactivation process as it would be during a primary infection. Indeed, in congenital and postnatal CMV infection, IE-1–specific responses dominated by 1 year of age, regardless of the specificity of initial responses [22]. This response to the CMV IE-1 gene is a typical response to a primary infection and is in contrast to what is seen in adults with chronic infection. In HLA-A*0201 HCT subjects, although the response to CMV pp65 always predominates, the response to CMV IE-1 was detectable and present in the CMV group. It is noteworthy that 3 subjects in the CMV reactivation group showed ICC positivity to all 3 CMV IE-1 peptides simultaneously at day 360, but this was never seen in the no-CMV group. These results show for the first time a multipeptidic IE-1– specific immune response within the same blood sam900 ples. By tetramer-binding assay, we know that CD8 cells are directed toward IE-1-297 and IE-1-316 in equal numbers in both the CMV reactivation and no-CMV groups, and when they are shown combined in Figure 4B and D, there is still no significant difference between groups. Therefore, although the number of CMV IE-1 immune cells is small, they are present in sufficient number and seem to respond to documented or occult CMV reactivation. It remains to be determined whether this response contributes to protection from progressive infection. The CMV-specific T-cell immunity observed in the recipients with no CMV infection could have been passively transferred in the graft, and this would account for the increased numbers of T cells at day 40. In this relatively small study, the percentage of recipients with ⱖ1 ⫻ 105 IFN-␥ CD8 cells at this early time after HCT was not significantly different. However, of note, the number of immune subjects in the no-CMV group continued to increase despite the absence of detectable CMV infection. This suggests that the transfer of CMV-reactive T cells might protect from detectable CMV infection, perhaps by control of virus replication after reactivation, and this justifies attempts to augment the transfer of such cells at the time of HCT to test such a hypothesis. The manipulation of donor cells either by in vitro expansion or by in vivo stimulation with a vaccine may prevent CMV reactivation through such adoptive immune therapy. ACKNOWLEDGMENTS The authors thank Brenda Williams and the staff of the General Clinical Research Center for sample preparation; Allison Sano, Kathryn Patane, and the staff of the bone marrow transplantation unit for their work in patient recruitment and obtaining samples; and Drs. Mark Davis and Pat Roth for providing the HLA-A*0201 and 2-microglobulin expression constructs obtained under a material transfer agreement with Beckman-Coulter. Finally, we thank Wengang Chen in the pathology department for his construct pDCMV-gB that was used in the quantitative CMV PCR. This study was supported in part by US Public Health Service grant nos. RO1 AI58148 (J.A.Z.), PO1 CA 30206 (S.J.F.), and RO1 AI43267 and CA77544 (D.J.D); by grant nos. 6122-01 (S.F.L.) and 6116-98 (D.J.D) from the Leukemia and Lymphoma Society; and by grant no. MO1 RR-43 from the General Clinical Research Center branch of the National Center for Research Resources, National Institutes of Health. REFERENCES 1. Lacey SF, Diamond DJ, Zaia JA. Assessment of cellular immunity to human cytomegalovirus in recipients of allogeneic stem cell transplants. Biol Blood Marrow Transplant. 2004;10:433-447. CMV ICC and Tetramer Binding 2. Elkington R, Walker S, Crough T, et al. Ex vivo profiling of CD8⫹-T-cell responses to human cytomegalovirus reveals broad and multispecific reactivities in healthy virus carriers. J Virol. 2003;77:5226-5240. 3. Greenberg PD, Reusser P, Goodrich JM, Riddell SR. Development of a treatment regimen for human cytomegalovirus (CMV) infection in bone marrow transplantation recipients by adoptive transfer of donor-derived CMV-specific T cell clones expanded in vitro. Ann N Y Acad Sci. 1991;636:184-195. 4. Wills MR, Carmichael AJ, Mynard K, et al. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J Virol. 1996; 70:7569-7579. 5. Diamond DJ, York J, Sun JY, Wright CL, Forman SJ. Development of a candidate HLA A*0201 restricted peptide-based vaccine against human cytomegalovirus infection. Blood. 1997; 90:1751-1767. 6. Solache A, Morgan CL, Dodi AI, et al. Identification of three HLA-A*0201-restricted cytotoxic T cell epitopes in the cytomegalovirus protein pp65 that are conserved between eight strains of the virus. J Immunol. 1999;163:5512-5518. 7. Engstrand M, Lidehall AK, Totterman TH, Herrman B, Eriksson BM, Korsgren O. Cellular responses to cytomegalovirus in immunosuppressed patients: circulating CD8⫹ T cells recognizing CMVpp65 are present but display functional impairment. Clin Exp Immunol. 2003;132:96-104. 8. Lacey SF, Gallez-Hawkins G, Crooks M, et al. Characterization of cytotoxic function of CMV-pp65-specific CD8⫹ T-lymphocytes identified by HLA tetramers in recipients and donors of stem-cell transplants. Transplantation. 2002;74:722-732. 9. Mohty M, Mohty AM, Blaise D, et al. Cytomegalovirus-specific immune recovery following allogeneic HLA-identical sibling transplantation with reduced-intensity preparative regimen. Bone Marrow Transplant. 2004;33:839-846. 10. Gallez-Hawkins G, Lomeli NA, Li X, et al. Kinase-deficient CMVpp65 triggers a CMVpp65 specific T-cell immune response in HLA-A*0201.Kb transgenic mice after DNA immunization. Scand J Immunol. 2002;55:592-598. 11. Aubert G, Hassan-Walker AF, Madrigal JA, et al. Cytomegalovirus-specific cellular immune responses and viremia in recipients of allogeneic stem cell transplants. J Infect Dis. 2001; 184:955-963. 12. Chen FE, Aubert G, Travers P, Dodi IA, Madrigal JA. HLA tetramers and anti-CMV immune responses: from epitope to immunotherapy. Cytotherapy. 2002;4:41-48. 13. Engstrand M, Tournay C, Peyrat MA, et al. Characterization of CMVpp65-specific CD8⫹ T lymphocytes using MHC tetramers in kidney transplant patients and healthy participants. Transplantation. 2000;69:2243-2250. 14. Gratama JW, van Esser JW, Lamers CH, et al. Tetramer-based quantification of cytomegalovirus (CMV)-specific CD8⫹ T lymphocytes in T-cell-depleted stem cell grafts and after transplantation may identify patients at risk for progressive CMV infection. Blood. 2001;98:1358-1364. 15. Cwynarski K, Ainsworth J, Cobbold M, et al. Direct visualization of cytomegalovirus-specific T-cell reconstitution after allogeneic stem cell transplantation. Blood. 2001;97:1232-1240. 16. Manley TJ, Luy L, Jones T, Boeckh M, Mutimer H, Riddell SR. Immune evasion proteins of human cytomegalovirus do not prevent a diverse CD8⫹ cytotoxic T-cell response in natural infection. Blood. 2004;104:1075-1082. BB&MT 17. Bunde T, Kirchner A, Hoffmeister B, et al. Protection from cytomegalovirus after transplantation is correlated with immediate early 1-specific CD8 T cells. J Exp Med. 2005;201:10311036. 18. Khan N, Cobbold M, Keenan R, Moss PA. Comparative analysis of CD8⫹ T cell responses against human cytomegalovirus proteins pp65 and immediate early 1 shows similarities in precursor frequency, oligoclonality, and phenotype. J Infect Dis. 2002;185:1025-1034. 19. Prod’homme V, Retiere C, Imbert-Marcille BM, Bonneville M, Hallet MM. Modulation of HLA-A*0201-restricted T cell responses by natural polymorphism in the IE1(315-324) epitope of human cytomegalovirus. J Immunol. 2003;170:2030-2036. 20. Retiere C, Prod’homme V, Imbert-Marcille BM, Bonneville M, Vie H, Hallet MM. Generation of cytomegalovirus-specific human T-lymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine specificity of the antiviral response. J Virol. 2000;74:3948-3952. 21. Frankenberg N, Pepperl-Klindworth S, Meyer RG, Plachter B. Identification of a conserved HLA-A2-restricted decapeptide from the IE1 protein (pUL123) of human cytomegalovirus. Virology. 2002;295:208-216. 22. Gibson L, Piccinini G, Lilleri D, et al. Human cytomegalovirus proteins pp65 and immediate early protein 1 are common targets for CD8⫹ T cell responses in children with congenital or postnatal human cytomegalovirus infection. J Immunol. 2004;172:2256-2264. 23. Gallez-Hawkins G, Villacres MC, Li X, Sanborn MC, Lomeli NA, Zaia JA. Use of transgenic HLA A*0201/Kb and HHD II mice to evaluate frequency of cytomegalovirus IE1-derived peptide usage in eliciting human CD8 cytokine response. J Virol. 2003;77:4457-4462. 24. Zaia JA, Schmidt GM, Chao NJ, et al. Preemptive ganciclovir administration based solely on asymptomatic pulmonary cytomegalovirus infection in allogeneic bone marrow transplant recipients: long-term follow-up. Biol Blood Marrow Transplant. 1995;1:88-93. 25. Bensinger WI, Martin PJ, Storer B, et al. Transplantation of bone marrow as compared with peripheral-blood cells from HLA-identical relatives in patients with hematologic cancers. N Engl J Med. 2001;344:175-181. 26. Limaye AP, Huang ML, Leisenring W, Stensland L, Corey L, Boeckh M. Cytomegalovirus (CMV) DNA load in plasma for the diagnosis of CMV disease before engraftment in hematopoietic stem-cell transplant recipients. J Infect Dis. 2001;183: 377-382. 27. Dunn HS, Haney DJ, Ghanekar SA, Stepick-Biek P, Lewis DB, Maecker HT. Dynamics of CD4 and CD8 T cell responses to cytomegalovirus in healthy human donors. J Infect Dis. 2002; 186:15-22. 28. Heijnen IA, Barnett D, Arroz MJ, et al. Enumeration of antigen-specific CD8⫹ T lymphocytes by single-platform, HLA tetramer-based flow cytometry: a European multicenter evaluation. Cytometry B Clin Cytom. 2004;62:1-13. 29. Hebart H, Rauser G, Stevanovic S, et al. A CTL epitope from human cytomegalovirus IE1 defined by combining prediction of HLA binding and proteasomal processing is the target of dominant immune responses in patients after allogeneic stem cell transplantation. Exp Hematol. 2003;31:966-973. 30. Komatsu H, Sierro S, Cuero A, Klenerman P. Population 901 G. Gallez-Hawkins et al. 31. 32. 33. 34. 35. 902 analysis of antiviral T cell responses using MHC class I-peptide tetramers. Clin Exp Immunol. 2003;134:9-12. Villacres MC, Lacey SF, Auge C, Longmate J, Leedom JM, Diamond DJ. Relevance of peptide avidity to the T cell receptor for cytomegalovirus-specific ex vivo CD8 T cell cytotoxicity. J Infect Dis. 2003;188:908-918. Ouyang Q, Wagner WM, Wikby A, et al. Large numbers of dysfunctional CD8⫹ T lymphocytes bearing receptors for a single dominant CMV epitope in the very old. J Clin Immunol. 2003;23:247-257. Gratama J, Cornelissen J. Clinical utility of tetramer-based immune monitoring in allogeneic stem cell transplantation. BioDrugs. 2003;17:325-338. La Rosa C, Wang Z, Brewer JC, et al. Preclinical development of an adjuvant-free peptide vaccine with activity against CMV pp65 in HLA transgenic mice. Blood. 2002;100:3681-3689. Foster AE, Gottlieb DJ, Sartor M, Hertzberg MS, Bradstock KF. Cytomegalovirus-specific CD4⫹ and CD8⫹ T-cells fol- 36. 37. 38. 39. low a similar reconstitution pattern after allogeneic stem cell transplantation. Biol Blood Marrow Transplant. 2002;8:501-511. Villacres MC, Lacey SF, La Rosa C, et al. Human immunodeficiency virus-infected patients receiving highly active antiretroviral therapy maintain activated CD8⫹ T cell subsets as a strong adaptive immune response to cytomegalovirus. J Infect Dis. 2001;184:256-267.1 He XS, Rehermann B, Boisvert J, et al. Direct functional analysis of epitope-specific CD8⫹ T cells in peripheral blood. Viral Immunol. 2001;14:59-69. Szmania S, Galloway A, Bruorton M, et al. Isolation and expansion of cytomegalovirus-specific cytotoxic T lymphocytes to clinical scale from a single blood draw using dendritic cells and HLA-tetramers. Blood. 2001;98:505-512. Gandhi MK, Wills MR, Okecha G, et al. Late diversification in the clonal composition of human cytomegalovirus-specific CD8⫹ T cells following allogeneic hemopoietic stem cell transplantation. Blood. 2003;102:3427-3438.
© Copyright 2026 Paperzz