Mol. Cells, Vol. 8, No. 6, pp. 678-684
Molecules
and
Cells
© Springer-Verlag 1998
Cadmium Resistance in Transgenic Tobacco Plants Expressing
the Nicotiana glutinosa L. Metallothionein-like Gene
Mi Chung Suh, Doil Choi 1, and Jang Ryol Liu';'
Plant Cell and Molecular Research Unit, Korea Research In stitute of Bioscience and Biotechnology, Taejon 305-600, Korea;
I Plant Protectants Research Unit, Korea Research Institute of Bioscience and Biotechnology, Taejon 305-600, Korea.
(Received on June 3, 1998)
To understand the function of metallothioneins (MTs)
in plants, we introduced the Nicotiana gilltinosa MT
gene into tobacco (N. tabacum) plants via an
Agrobacterium mediated transformation. Full-length
MT cDNA was fused between the cauliflower mosaic
virus 35S (CaMV 35S) promoter and the nopaline
synthase (nos) terminator of the pMBP1 binary vector
in sense orientation. Tobacco leaf discs which were
cocultivated with Agrobacterium carrying the chimeric
MT gene, formed kanamycin-resistant shoots on
medium containing kanamycin. The kanamycinresistant shoots were subsequently rooted on medium
containing 200 j.1M CdS0 4 • Approximately 30 % of
individual transgenic plants developed normally.
Nontransgenic plants promptly underwent leaf
chlorosis, and their growth and development were
inhibited on MS medium containing 50 j.1M CdS0 4 •
Genomic Southern blot analysis showed that the MT
gene was stably integrated into the nuclear genome of
transgenic tobacco plants. The expression level of MT
transcripts was analyzed by RNA gel blot analysis. Selfpollinated seeds obtained from transgenic tobacco
plants showing cadmium tolerance were germinated on
a medium containing 100 j.1M CdS0 4 • PCR analysis
from sensitive and stably resistant T 2 seedlings for
cadmium sulfate confirmed a high correlation between
the phenotypic expression of the MT gene and the
transgenic genotype, indicating that the MT gene is
inherited in the next generation.
Keywords: Me tall o thi o nei n -I i ke Ge ne; N icotiana
glutinosa; Nicotiana tabacum L. ; Transgenic Pl ant.
Introduction
Heavy metals, such as copper and zinc, are essenti al
mi cronutrie nts in ce llul ar metabo li sm and serve as
stru ctural and catalytic comp onents of protein s and
e nzy mes . Ho weve r, th ese a nd oth e r he avy me tal
mi cronutri ents, such as cadmium , lead, mercury, and
ni cke l, are ex tre me ly tox ic to ce ll s at excess
concentrati ons. To balance the concentration of these toxic
metals in cell s, all organisms induce the biosynthesis of
low mo lec ul ar we ig ht, cys te in e-ri ch pro te in s call ed
metall othi o nein s (MT). MTs are prese nt in vari o us
e ukaryo ti c o rgani sms includin g f un gi, in vertebrates ,
in sects, mammals, and pl ants (Hamer, 1986; Steffens,
1990).
Because of their metal-binding activity and inducibility
by heavy-metal ions, pl ant MTs are thought to pl aya role
in metal metabolism and detoxification (Robinson et al. ,
199 1). Recentl y, several MT cDNA cl ones have been
characteri zed from soybean (Kawashim a et al. , 1991 ),
Arabidopsis (Zhou and Gold sbrough, 1994), Brassica
napus (Buchanan-Wollaston, 1994), Vicia f aba (Foley and
Singh, 1994), Sambucus nigra (Coupe et al. , 1995), ri ce
(Hsieh et al. , 1995), and cotton (Hudspeth et al. , 1996).
MT genomic sequences from pea (Evans et ai. , 1990),
maize (de Framond , 199 1), wheat (Kawashima et al. ,
1992), and Arabidopsis (Zhou and Goldsbrough, 1994)
have also been reported. Pl ant MT genes that exist in pl ant
genomes as a multigene famil y are expressed in specific
organ ti ssues such as the root, leaves, and embryos. They
are also diffe renti ally induced by various environmental
stresses, such as heavy metals, heat-shock, plant hormones,
wounding, senescence, and viral infec tion . Little is known,
however, about the biochemical mechanisms involved in
such responses.
':' To whom correspondence should be add ressed.
Tel: 82-42-860-4430; Fax: 82-42-860-4608
E-mail: jriiu @mail.kribb.re. kr
Abbreviati ons: MTs, metallothi one ins.
Mi Chung Suh et ai.
Often , soil is contamina ted by coal mJnln g , fossi l fuel
combustion , application of fertilizers, pesti c ides, or sewage
sludge. The content of heav y me tals in soil , therefore, has
been increas ing s teadily in recent years. Cadmium is
considered o ne of these toxic metals . Because most heavy
me ta ls, including cadmium, can be deposited in soil and
water and can subsequentl y be acc umulated by plants a nd
animals, th e re has been a gradual increase in the c hroni c
ex pos ure of plants and animals to toxic metal s . Such
c hronic exposure can bring a bout significant deleteriou s
co nseque nces to the environment and human health.
A wo und and pathoge n-inducible MT cDNA was
previously iso lated from Nicotiana glutinosa whi le cloning
plant di sease res is tance-res pon se genes by su btractive
hyb ridi zation (C hoi et aI., 1996). We were interested in
unde rstandin g the roles of the wo und and the pathogeninduci bl e MT gene in plants during expos ure to a high
concentration of heav y me ta ls. We introduced the N.
glutin osa MT cDNA into tobacco pl a nt s v ia the
Agrobacterium mediate d tran sformation sys tem. An
overexpression of the MT ge ne conferre d cadm ium
to lerance on transgeni c tobacco plants. Thi s is the first
report s ugges tin g the poss ibility of bioremediation of
heavy metal contaminated soil using th e plant MT gene.
Materials and Methods
Plants and bacteria Tobacco plants (Nicotiana tabacum L. cv.
Samsun NN) were culti vated in a greenhouse under a regime of
16 h of light (25°C) and 8 h of darkness (20°C), and used as plant
material fo r transformation. The E. coli strain HB 10 1, and the A.
tumejaciens strain LB A4404, harborin g pAL4404, were used for
gene manipulat ion and tobacco transformation respectively.
Preparation of plasmid DNA and transformation of
bacteria Pl as mid DNA was iso lated from E. coli and A .
tumejaciens by th e alkalin e lys is meth od as desc ribed by
Sambrook el ai. ( 1989) . Restricti on enzyme di gesti on and ligation
were carried out according to the method of Sambrook et ai.
( 1989) foll owing the manufac turer 's in stru ction s (KOS CO ,
Korea; Promega, USA). DNA was run on an aga rose gel with
ethidium bromide (0.1 mIlL), and the elution of particular DNA
fragmeI1ls from the gel was performed with Jet Sorb (Genomed
Inc, USA). Transformation of recombinant plas mid DNAs into
E. coli was done by the CaCI 2 treatment method (Sa mbrook et al.,
1989). The recombinant plasmid DNAs amplified in E. coli were
transferred into A. tumejaciens by the direct DNA uptake method
(An, 1989) .
Plant transfo rmation and regeneration Transformation of
tobacco plants was carried out as described by Horsch et ai.
(1985). Surface sterili zed young leaves were cut to 0.5 cm 2 sizes
and cocultivated with A. tumejaciens carrying the MT gene in a
liquid MS medium (Mura shi ge and Skoog , 1962). After
coc ulti vation for 2 d, the leaf di scs were washed several times
with MS medium and placed on a selectabl e MS medium
supplemented with 0.1 mg/L a -naphthaleneaceti c ac id , 1 m g/L 6benzylamine, 100 mg/L kanamycin , and 300 m g/L carbenicillin.
679
Kanamycin resistant shoots were directly formed from the cut
edges of the leaf discs. The rooting of kanamyc in resistant shoots
was ca rri ed out in a selecta ble MS medium wit hout a ny
add iti ona l hormones. Some parts of the kanamycin resistant
shoots were also rooted on media containing 50, 100, or 200 11M
cadmium s ulfa te , and 100 m g/ L of ka nam yc in . After
acc limatization, the plantle ts were transplanted to potting soil and
maintained in a greenhouse. The fu lly grown transgenic plants
were se lf-po llinated usin g e nve lopes made of oiled pape r.
Nontransgenic plants whi ch were cultured in the same conditi ons
with transgenic pl ants, were used as control plants.
Seed germination Seeds were asepticall y germin ated on MS
medium containing either 300 mg/L of kanamyc in or 100 11M
cad mium sulfate. Both res istant and sensitive seedlings for
kanamycin and cadmium were then counted. Kanamycin and
cadmium resistant seedlings were moved to soil and maintained
in a greenhouse for ana lys is of the T2 generation .
peR analysis Chromosomal DNA was isolated from the leaves
of TI transgenic plants, and from the seedlings of T2 progeny as
described by Edwards et ai. ( 1991 ). Transgenic plants and
seedlin gs were previou sly checked using NPTII primers, th e
CaMY35S primer, and the antisense primer of MT gene by PCR.
PCR was performed with 1 Ilg of total leaf DNA , 20 pM of each
primer (se nse ; 5 ' GAGGCTATTCGGCTATGACTG3 ' and
an ti sense; 5' ATCGGGAGCGGCGATACCGTA3' for transgeni c
plants, a nd sense; 5 ' TTCAAAGCAAGTGGATTGA 3' and
anti sense; 5' CATCCATCTCTGCTCCG3 ' for seedlin gs), 40 11M
of each deoxy nucleoside triphosphate (dATP, dCTP, dGTP, and
dTTP), 10 mM KCI , 2 mM Tri s, pH 8.3, 0.3 mM MgC I2,
0.0002% gelatin and I unit of Taq DNA polymerase (Korea
Biotech, Korea) in a total volume of 20 Ill. The reaction mi xtures
were covered with mineral oil and placed in a thermal cyc ler
(Perkin Elmer Cetus). After denaturati on of tota l DNA at 95°C
for 5 min , th e te mperature was cycled at 95 °C for I min
(denaturation), at 65 °C for I min (a nnealing), and at n oc for
I min (extension) for 35 cyc les for transgenic pl ants. In the PCR
of seedlings the denaturation and extension conditions were
identical to th ose for transgeni c plants with the exception of using
a temperature of 55°C for annea ling. PCR products were run on
I % agarose gel.
Genomic DNA isolation and Southern h y bridization
Genomic DNA was isolated from the leaves of transgeni c tobacco
plants as desc ribed by Dell aporta et al. ( 1983). Extracted
genomic DNA was di gested with EcoRI and EcoRIIHindIlI ,
electrophoresed on 0.7 % agarose gel in the presence of ethidium
bromide (0. 1 Ilg/ ml) , and blotted onto a Hybond-N Ny lon
membrane (Amersham, USA). The MT cDNA was labeled with
32 p_dCTP using a Prime-a-Gene system (Promega, USA) and was
used in both Southern and Northern hybridi zation procedures as
a probe. The filter was prehybridized and hybridi zed under the
fo llowing conditions: 6X SSC, 5 X Denhardt ' s solution, 0.5 %
SDS , and lOOllg/ml of salmon sperm DNA at 60 °C overn ight.
After rinsing the membrane in I X SSC and 0. 1X SDS at room
te mperature for 15 min , it was washed in 0.5 X SSC and
0.1 X SDS at 60 °C for 2 h. The membrane was exposed to X-ray
film (Kod ak, USA) with two intensifying screens (Dupont, USA)
at - 70 °C.
680
Cadmium Resistance in Transgenic Tobacco Plants
Total RNA Isolation and Northern Blot Analysis Total RNA
was prepared from the leaves of transgenic tobacco plants using
TRIzolTM Reagent (GIBCO/ BRL , USA) followin g the
manufacturer 's instructions. Approximately 20llg of total RNA
was electrophoresed on an aga rose gel containing l7.5 %
formaldehyde, and blotted onto a Hybond-N nylon membrane.
Prehybridi zation , hybridi zation , and washing conditions were
identical to those for Southern hybridization.
Results
Construction of chimeric genes encoding the
metallothionein protein in sense orientation The
metallothionein gene was previously isolated from a
subtractive cDNA library constructed with mRNA from N.
giutinosa plant tissues showing a systemic hypersensiti ve
reaction to TMV The recombinant plasmid carrying the
MT gene was isolated from a KC9-10 clone (Choi et af.,
1996) and digested with BamHI and NsiI. DNA fragments
of approximately 450 bp, including an 18 bp 5' UTR, an
ORF encoding the metallothionein protein , and a 163 bp 3'
UTR were eluted and li gated into the BamHI and PstI sites
of the pBluscript SK( +) vector. T he pMBPI was chosen as
a binary vector used for plant transformation . pMBPl has
a neomycin phosphotransferase expression cassette as a
selectable marker, a 35S promoter of the cauliflower
mosaic virus, and a nopaline synthase terminator as a
foreign gene expression system, and T-DNA right and left
border sequences needed for T-strand integration into the
plant genome. The purified DNA fragments from a
recombinant pBluscript SK( -) vector carrying a fulllength MT gene were cloned in the BamHI and KpnI sites
of pMBPl for overexpression of the MT gene. The
re s ulting s tructure was ca lled pMBP 1-MTS . The
construction of the resultant plasmids is described in
Fig. lA o
Transformation and regeneration of tobacco
plants The recombinant binary vector, pMBP1-MTS ,
was introduced into the A. tumefaciens strain LBA4404
harboring the disarmed plasmid pAL4404 (Matzke and
Matzke, 1986). Tobacco leaf discs were cocultivated with
Agrobacterium carrying the MT gene. Transformed shoots
were directly formed on cutting edges of tobacco leaf discs
on a medium supplemented with 0.1 mg/L NAA , I mg/L
BAP, 100 mg/L kanamycin , and 300 mg/L carbenicillin,
then regenerated in vitro . More than 90 % of the
regenerated tobacco plants with the NPTn gene were
normal in both morphology and growth rate.
The Metallothionein-like gene was stably integrated
into the nuclear genomes Genomic DNA was isolated
from fully grown leaves of a nontransgenic plant and a
transgenic plant. Transgenic plant line #+ 1 showed PCR
bands for the NPTII gene and cadmium resistance. From a
Southern analysis of the genomic DNA, major bands of
approximately 3.2 kb were detected from EcoRI and
EcoRIlHindIII digested genomic DNA of both transgenic
and non transgenic tobacco plants. This result suggests that
the nascent tobacco MT gene, which has a high nucleotide
seq uence homology with the introduced MT gene, was
present in the genome as mUlticopie s in repeated
sequences. Each of the bands, approximately 1.0 kb for
Eco RI and 0.9 kb for EcoRIIHindIII, detected on ly in
transgenic plants represented a foreign MT gene which was
introduced via the Agrobacterium mediated transformation .
These results confirm the stable integration of the foreign
MT gene into the nuclear genomes of the transformed
tobacco plants (Fig. lB).
A
H
BEH
K
E
BEHJ
(Km')
NPTU
500bp
B
234
3.2 kb
,. I
1.0 kb
Fig. 1. A restriction enzyme map of a binary vector carrying the
metallothionein gene, pMBP l-MTS (A) and a genomic Southern
blot analysis for the metallothionein gene from T I transgenic
tobacco plants (B). A. The line below the MT box, labelled
'500 bp' is for the metallothionein gene coding sequence. B,
BamHI ; E, EcoRI ; H, HindIII ; K, KpnI ; LB , T-DNA left border;
RB , T-DNA right border; NPTII, Neomycin phosphotransferase
gene II ; Pnos, Nopaline synthase promoter; Tnos, Nopaline
sy nthase terminator ; P35S ' Cauliflower mosaic virus 35S
promoter. B. Chromosomal DNA was digested with EcoRI or
EcoRIIHindIII, run on an 0.7% agarose gel, blotted onto the
Nytran membrane and hybridized with 32P-labeled BamHIIKpnI
DNA fragment of the metallothionein gene. EcoRI (lane I) and
EcoRIlHindIII (lane 2) digested DNA from un transformed plant
tissues. EcoRI (lane 3) and EcoRIlHindili (lane 4) digested DNA
from MT transgenic tobacco line #+ 1.
Mi Chung Suh et al.
The metallothionein-like gene was highly expressed in
68 1
Total RNA was isolated
from nontransgenic and transgenic tobacco plants at the
same developmental stage, and the same amount was
loaded onto an agarose gel. Northern hybridization showed
s pecific b a nd s for th e MT ge ne tran sc ripts at
approx imately 600 bp (Fig. 2). Although the transcriptional
levels of the MT gene fro m indi vidual tobaco plants varied,
the expression level of the MT gene in transcripts from
transgenic pl ant lines, such as # + 1 (lane 3), # + 5 (l ane 5),
#+6 (lane 6), and #2 -1 (l ane 7), was higher than those of
non transgenic plant lines. This indicates the presence of
ac ti ve transcriptio ns of the introdu ced gene in these
transgenic tobacco plants.
severely growth-retarded transgenic plants increased by
approximately 20 %. At a concentration of 200 ~M CdS0 4 ,
approximately 30 % of the transgenic tobacco plants were
not affected, and growth was normal in all plants (Figs. 3A
a nd 3B ) . Afte r acc lim ati za ti o n , appro x im a te ly 7 0
individu al tran sgenic plants showing either cadmium
tolerance or kanamycin resistance were moved to soil in a
greenh ouse. The developmental growth rate of the T J
tra nsge ni c to bacc o pl ants se lec ted o n MS m edium
supplemented with both cadmium sulfate and kanamycin
was slower than the growth rate of T J transgenic tobacco
pl ants selected on MS medium supplemented with onl y
ka namycin . The growth of the T J transgeni c tobacco pl ants
may have been delayed because they were exposed to
Resistance of transgenic tobacco plants to cadmium
sulfate Th e no n tra nsge ni c to b acco pl a nts w e re
A
the transgenic tobacco plants
prev iously tested for cadmium resistance on a medium
containin g vario us concentra ti ons of cadmium sulfa te .
Control pl ants suffered leaf c hl orosis o n a m edium
containing onl y 10 ~M CdS0 4 , and their growth were
severely retarded at a concentration of 100 ~M CdS0 4 . At
concentrations hi gher than 200 ~M CdS0 4 , non transgenic
plants promptl y turned albino and eventually died (data not
shown). Ninety indi vidu al regenerated shoots having the
N PT II ge ne we re direc tl y r oo te d in MS me di a
supplemented with both 100 mg/L kanamycin and 50, 100,
o r 2 00 ~M of CdS0 4 . A pprox im a te ly 60 % of th e
transgenic plants rooted in the medium containing 50 ~M
CdS0 4 developed normall y. Onl y two pl ants were found to
be severely growth-inhibited. In the medium containing
100 ~M CdS0 4 , th e number of un affected transgenic
pl ants decreased by approximately 20 % and the number of
B
A
1
2
3
4
5
6
7
8
100
9
B
20
a
50
100
200 (flM)
Concentration of CdS04
Fig. 2. Northern blot analysis fo r the metallothionein gene fro m
T J transgeni c to bacco pl ants. Total RNA (20l1gi lane) of
nontransgenic ( 1- 2) and transgenic (3-9) to bacco pl ants was
subjected to electrophoresis on a 1.2% denaturing fo rmaldehyde
gel. The RNA was blotted and probed with 32P-labelled 0.45 kb
BamHVPs tI DNA frag ments of the metallothionein gene (A). and
ribosomal DNA frag ments from petuni a as a contro l (B).
Northern bands indi cate the positi on fo r the nascent and
introduced metallothionein gene transcripts at 0. 6 kb.
Fig. 3. Cadmium resistance of ka namycin resi stant tobacco
shoots after tra nsformat ion. A and B : Nin ety in dividu al
regenerated shoots having NPTII and N. glutinosa MT genes
were directl y rooted on a MS medium containing both 100 mg/L
of kanamycin and 50, 100, or 200 11m CdS0 4 , respecti vely. After
approx imately one month later, the number of indi vidual plants
tested were di vided into three groups: un affected (U) , leaf
chlorosis (C), and leaf chlorosis and growth retardation (G) by
their developmetal phenotypes, and counted.
682
Cadmium Resistance in Transgenic Tobacco Plants
cadmium stress during their root development. However,
th e flowerin g, seed development , and germination
processes of all tran sgenic plants showing cadmium
tolerance were normal.
Inheritance of the MT gene into Progenies To
investigate whether the nptII and MT genes were stably
inherited by the next generation, self-pollinated seeds from
T) transgenic lines # + I , # + 5, #+6, and #2-1 were
germinated on a MS medum containing either 300 mg/L of
kanamycin or 100 11M CdS0 4 . The germination of all
seeds was normal on MS media supplemented with either
300 mg/L of k ana mycin or lOOIlM CdS0 4 , but
kanamycin-sensitive seedlings promptly turned albino and
cadmium-sensitive seedlings were severely inhibited in
their leaf development and root growth. The root length of
sensitive seedlings was markedly shorter with severe leaf
ch lorosis when compared to resi stant seedlings (Fig. 4A).
From the T) transgenic line #1 , 127 kanamycin-resistant
seedlings and 40 kanamycin-sensitive seedlings were
counted on the media containing 300 mg/L kanamycin ,
whereas 115 cadmium-resistant seedlings a nd 39
cadmium-sensitive seed lings were enumerated on the
media s upplemented with 100 11M CdS0 4 . The 3: I
Mendelian pattern of seg regation for kanamycin and
cadmium resistance (data not shown) , indicates that the
nptII and MT genes were stably integrated into the nuclear
genome as a single copy, and inherited by progeny.
The correlation between the phenotypic and genotypic
patterns of T2 seedlings of the T) transgenic line #+ I was
investi gated by isolating DNA fro m the samples and then
performing PCR. Primers specific for the transgenic MT
ge ne were des ign e d to avoid amplification of the
endogenous MT gene. All six of the sensitive seedlings
were negative for the transgenic MT gene. Among the
resistant seedlings, 15 out of 18 (87 %) were positive for
the gene. There is, therefore, a high correlation between the
phenotypi c ex pre ss ion and the tran sge nic genotype
(Fig.4B).
A
M
1 2 3 4 5
6 7 8
9 10 11 12 13
B
M 14 15 16 17 18 19 2021 22 2324 2526
Discussion
In this study we have reported the transformation of wound
and pathogen inducibl e N. glutinosa MT cDNA into
tobacco plants via an Ag roba cterium mediated
transformation system . The introduced MT cDNA is stably
integrated and expressed in the transgenic tobacco genome.
When self-pollinated seeds of the transgeni c tobacco plants
were germinated on a medium supplemented with LOO 11M
CdS0 4 , cadmium sensiti ve and resistant seedlings were
segregated at a 3: 1 ratio , indicating that the cadmium
resi stant character is stably inherited by progeny. PCR
analysis of the cadmium sensitive and resistant seedlings
for the tran sge nic MT gene showed that there was
approximately 87 % correlation between the phenotypic
Fig. 4. Inheritance of transgenic MT gene into progenies. A. The
self-pollin ated seeds were aseptically germ inated on a MS
medium containing I 00 ~M CdS0 4 , and then resistant and
sensitive seed lings for cadmium sulfate were shown . B. PCR
analysis of the cadmium sensitive and resistant seedlings fo r the
transgenic MT gene. M , BRL's 1 kb ladder; 1-3 and 14-16,
cadmium sensitive seedlings; 4--l2 and 17-25 , cadmium resistant
seedlings; 13 and 26, the recombinant plasmid , pMBPI-MTS as
a positive control.
expression and the transgenic genotype. However, three
phenotypically resistant seedlings showed negative results.
Mi Chung Suh et al.
The degree of correl ation between the phenotyp ic
expression and the transgenic genotype may be increased if
seedlings having approximately ten leaves are used, or if
seedlings are grown on media supplemented with CdS0 4 at
a concentration higher than 100 ~M .
When the pea MT gene was introduced into A. thaliana,
the expression of the PsMTA gene caused enhanced Cu
accumulation and a reduction of Fe availability (Evan s
et ai. , 1992). No significant effect on the accumulation of
either Zn or Cd was detected . The inverse correlation
between Cu accumu lation and Fe availability suggests that
the activation of the transcription of MT-like plant genes,
which coincides with a reduction of available Fe, is also
consistent with a role in Cu homeostasis. In this study, the
expression of the N. glutinosa MT gene conferred
cadmium tolerance on transgenic tobacco plants, indicating
that the MT gene in plant cells is probably involved in Cd
detoxification . By analogy to the MTs of animals and
microorganisms, the N. glutinosa MT gene may serve as an
intracellu lar "sink" for excess metal. Cu, Zn , and Cd
accumulation in T2 seedlings will be investigated in the
future. Thi s approach will allow for the investigation of the
dynamic mechani sms of metal homeostasis for enhanced
metal ion efflux.
According to Pan et ai. (1994), mouse MT cDNA was
transformed into tobacco and the expression of the MT
gene conferred cadmium resistance on transgenic plants.
Our results are in accordance with theirs. The use of a plant
derived gene in the creation of transgenic plants, however,
provides additional advantages over the use of an animal or
microorga nism derived gene. For in stance, the gene
regulatory mechanisms and the translational systems such
as codon usage, are very different when animal or
microorganism genes are used in heterologous plant cells
(Perlak et ai., 1991). The MT gene of N. glutinosa, which
is known to have a chelating effect for Cd 2 + , can also be
used as a useful gene in the production of heavy metal
tolerant plants. In addition, based on the fact that metal
ions taken up from growth environments are main ly
accumulated in the roots (Leita et ai., 1993), tissue specific
expression by root-specific promoters should also elevate
the efficiency of foreign gene expression in transgenic
plants. Weeds having a fast growth rate could be subjected
to a genetic transformation for the bioremediation of heavy
metal contaminated areas.
To further examine the function of the MT gene,
transformation of tobacco plants using an antisenseoriented MT gene is now underway. Once generated, these
will be tested for pathogen infection, chemical stresses and
the chelating of metal ions. These studies are likely to be
instrumental in further investigations of the possible role(s)
of MT genes in plants.
Acknowledgments
We thank Drs. J. M . Bae, K. H. Huh, H .
S . Lee, and C. H. Ham for critical reading of manu script.
683
References
An , G. (1987) Binary Ti vectors for plant transformation and
pro moter analysis. Methods in Enzymol. 153, 292-305.
Buchanan- Wollaston , V. ( 1994) Isolatio n of c DNA clones for
genes th at are expressed during leaf senescence in Brassica
napus. Iden tifi cation of a gene encoding a senescence-specifi c
metallothionein-like protein. Plant Physiol. 105, 839-846.
Choi, D. , Kim , H. M ., Yun , H. K. , Park, J. A., Kim , W. T. , and
Bok, S. H . ( 1996) Molecular cloning of a meta ll othionein-like
ge ne from Nicotiana glutinosa L. and its inducti o n by
wounding and tobacco mosaic viru s infection . Plant Physiol.
112, 1-7.
Coupe, S . A. , Tay lor, J. E. , and Rob e rt , 1. A. ( 1995)
Characterization of an mRNA encodin g a metallothi onein-like
protein that accumulates during ethylene-promoted absciss in
of Sambucus nigra L. leaflets. Planta 197, 442-447 .
de Framond, A. J. (1991 ) A metallothi onein-like gene from maize
(Zea may s): c lo nin g and characte ri zation . FEBS Lett. 290 ,
103- 106.
Dellaporta, S . L. , Wood , 1. , and Hi cks, 1. B. (1983) A plant DNA
mini-preparation : Versio n n. Plant Molec. Bioi. Rep. 1, 19-2 1.
Edwards, K. , John stone, c., and Tho mpson, C. ( 199 1) A simple
and rapid method for the preparati on of plant genomi c DNA
for PCR analysis . Nucleic Acids Research 19, 1349.
Evans, I. M ., Gatehouse, L. N. , Gate house, 1. A. , Robin son, N. J .,
and Croy, R. R. (1990) A gene from pea (Piswn sativum L.)
with homology to me ta llothionein genes. FEBS Leu. 262 ,
29-32.
Evans, K. M. , Gatehouse, J. A., Lindsay, W. P. , Shi , 1., Tommey,
A. M. , and Robinson, N. 1. (1992) Expression of the pea
me tallothi o ne inlike gene PSMTA in Escherichia coli a nd
Arabidopsis thaliana and analysis of trace me ta l ion
acc umulation : implications for PSMTA function. Plant Mol.
BioI. 20, 1019- 1028.
Foley, R . c., Singh, K. B . (1994) Iso lation of a Vi cia jaba
me tallothionein-like gene: expression in fo liar tri c homes.
Plant Mol. BioI. 26, 435-444.
Ha me r, D . H. (1985) Meta llothione in . Annu. Rev. Biochem. 55 ,
9 13-951.
Horsch, R. B., Fry, J. E. , Hoffmann , N . L. , Eichholtz, D., Rogers,
S. G., and Fraley, R. T. (1985) A simple and general me th od
for transferring genes into plants. Science 227, 1229- 123 1.
H sie h, H . M ., Liu, W. K., and Hu ang, P. C. (1 995) A nove l stressinducible metallothionein-like gene from rice. Plant Mol. BioI.
28,38 1-389.
Hudspeth , R. L. , Hobbs, S. L. , Anderson , D . M ., Raj asekaran , K. ,
and Grula, J. W. (1996) Characterization and expression of
me tallothionein-like genes in cotton. Plant Mol. BioI. 31 ,
701-705.
Kawas hima , 1. , Inoku c hi , Y. , Chino, M ., Kimura , M. , and
Shimizu, N . (1991) Isolation of a gene for a meth allothi oneinlike protein from soybean. Plant Cell Physiol. 32, 913-916.
Kawas hima, 1. , Inoku c hi , Y. , Chino , M ., Kimura , M ., and
Shimizu , N. (1992) Wh eat Ec metallothionein genes ; like
m a mmali a n Zn + m e t a llothi o ne in ge nes , wheat Zn +
metallothione in genes a re conspicuously ex pressed durin g
embryogenesis. Eur. 1. Biochem. 209, 971-976.
Leita, L. , Denobili , M ., Mondini , c., and Garci a, M . T. B. (1993)
Response of Leguminosae to cad mium expos ure. 1. Plant
Nutirition 16, 2001-2012.
Matzke, A. 1. M . and Matzke, M. A. (1986) A set novel plasmid
de rived vectors for the production of transgeni c plants. Plant
Mol. BioI. 7, 357-365.
Muras hige, T. and Skoog, F. (1962) A revised medium for rapid
growth and bioassays with tobacco tissue cu lture. Physiol.
684
Cadmium Resistance in Transgenic Tobacco Plants
Plant. 15, 473-497 .
Pan, A. , Yang, M ., Tie, F. , Li , L. , Che n, Z., and Ru, B. (1994)
Expression of mouse metallothionein- / gene confers cadmium
resistance in transgeni c tobacco plants. Plant Mol. BioI. 24 ,
34 1-351.
Perl al<, F. J. , Fuchs, R. L. , Dean, D. A. , McPherso n, S. L. , and
Fi schhoff, D. A. ( 199 1) Modification of the codi ng sequence
enhances plant expression of insect control protein genes.
Proc. Natl. A cad. Sci. USA 88, 3324-3328.
Robinson, N. J., Tommey, A. M., Ku ske, c., and Jackson, P. J.
(1993) Plant metallothioneins. Biochem. 1. 295, 1- 10.
Sambrook, J. , Fritsch, E. F. , and Maniatis, T. (1989) Molecular
Cloning: A Lab o ratory Manual , Co ld Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
Steffens, J. C. (1990) The heavy metal-binding pep tides of plants.
Annu. Rev. Plant Physiol. Plant. Mol. BioI. 41, 553- 575 .
Zhou, J. and Goldsbrough, P. B. ( 1994) Functional homo logs of
fungal metallothi one in genes from Arabidopsis. Plant Cell 6,
875-884.
Zhou, J. and Goldsbrough, P. B. ( 1995) Structure, organization
a nd ex pression of the meta ll o thi o ne in ge ne family in
Arabidopsis. Mol. Gen. Genet. 248, 3 18-328.