RESEARCH LETTER
Enhancing beta-carotene production in Saccharomyces
cerevisiae by metabolic engineering
Qian Li1,2, Zhiqiang Sun1,2, Jing Li1,2 & Yansheng Zhang1
1
CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences,
Wuhan, China; and 2University of Chinese Academy of Sciences, Beijing, China
Correspondence: Yansheng Zhang, CAS
Key Laboratory of Plant Germplasm
Enhancement and Specialty Agriculture,
Wuhan Botanical Garden, Chinese Academy
of Sciences, Wuhan, 430074, China.
Tel./fax: +86 27 8761 7026;
e-mail: [email protected]
Received 30 March 2013; revised 28 May
2013; accepted 28 May 2013. Final version
published online 26 June 2013.
DOI: 10.1111/1574-6968.12187
Editor: Derek Jameison
MICROBIOLOGY LETTERS
Keywords
beta-carotene; codon optimization; HMGR
gene; Saccharomyces cerevisiae.
Abstract
Beta-carotene is known to exhibit a number of pharmacological and nutraceutical benefits to human health. Metabolic engineering of beta-carotene biosynthesis in Saccharomyces cerevisiae has been attracting the interest of many
researchers. A previous work has shown that S. cerevisiae successfully integrated
with phytoene synthase (crtYB) and phytoene desaturase (crtI) from Xanthophyllomyces dendrorhous could produce beta-carotene. In the present study, we
achieved around 200% improvement in beta-carotene production in S. cerevisiae
through specific site optimization of crtI and crtYB, in which five codons of crtI
and eight codons of crtYB were rationally mutated. Furthermore, the effects of
the truncated HMG-CoA reductase (tHMG1) from S. cerevisiae and HMG-CoA
reductase (mva) from Staphylococcus aureus on the production of beta-carotene
in S. cerevisiae were also evaluated. Our results indicated that mva from a
prokaryotic organism might be more effective than tHMG1 for beta-carotene
production in S. cerevisiae.
Introduction
Carotenoids are health-promoting metabolites that are
widely biosynthesized in plants, microorganisms, algae,
etc. Beta-carotene, which humans cannot synthesize de
novo, is the precursor of Vitamin A and astaxanthin. It
has been reported that beta-carotene functions as an antioxidant preventing angiocardiopathy, strengthens the
immune system, and decreases the risk of cancer (Bracco
et al., 1981; Buring & Hennekens, 1995; Kritchevsky,
1999). Nowadays, beta-carotene has also gained increasing
attention in food and feed additives (Nelis & De Leenheer, 1991), cosmetics (Anunciato & da Rocha Filho,
2012), and health food and pharmaceutical industries
(Bauernfeind et al., 1970; Johnson, 2002).
Due to its importance, biosynthesis of carotenoid has
aroused many researchers’ interests, with most studies
focusing on the metabolic engineering of carotenoid
biosynthesis (Misawa & Shimada, 1997; Lee & SchmidtDannert, 2002). Saccharomyces cerevisiae is an edible
microorganism which is widely used in fermentation
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
industries. Compared with other heterologous beta-carotene
producing microorganisms such as Escherichia coli (Kim
et al., 2006) and Candida utilis (Miura et al., 1998),
S. cerevisiae is considered to be a safe yeast and has the
advantage of easy genetic manipulation with established
host–vector systems. As a conventional yeast, S. cerevisiae
can produce geranylgeranyl diphosphate, which is the
precursor of carotenoid biosynthesis. Previous studies
have shown that S. cerevisiae integrated with the two
main carotenogenic genes, phytoene synthase (crtYB) and
phytoene desaturase (crtI), from Xanthophyllomyces dendrorhous could produce carotenoids (Verwaal et al., 2007).
Experimental investigation demonstrated that different
species favor distinctive codons in translating nucleotides
into amino acids throughout evolution (Hershberg &
Petrov, 2008; Plotkin & Kudla, 2010). Due to the difference
in the codon usage preference among species, expressions
of foreign enzymes often result in suboptimal performance.
Therefore, codon optimizations have been applied to
improve the productions of many natural products. For
example, the codon-optimized taxadiene synthase cDNA
FEMS Microbiol Lett 345 (2013) 94–101
95
Beta-carotene biosynthesis in S. cerevisiae
directed a 40-fold increase in the production of taxadiene
in yeast (Engels et al., 2008). The original cDNA encoding
tyrosine ammonia lyase (TAL) from Rhodobacter sphaeroides was not utilized in a yeast translation process (Zhang
et al., 2006). However, the TAL enzyme was highly
expressed in S. cerevisiae when the TAL cDNA was
full-length codon optimized, which led to a higher level of
resveratrol production in the yeast cells (Wang et al., 2011).
In the present study, we report an improvement in the
production of carotenoids in S. cerevisiae by specific site
optimizations of crtI and crtYB cDNAs from X. dendrorhous.
The enzyme 3-hydroxy-3-methylglutaryl coenzyme A
reductase (HMGR) has been shown to be a major ratelimiting enzyme in the mevalonate (MVA) pathway in
S. cerevisiae (Britton et al., 1998). Overexpression of
the catalytic domain of the HMGR (namely, truncated
HMG-CoA reductase gene or tHMG1) in yeast cells has
been observed to boost isoprenoid biosynthesis (Donald
et al., 1997; Polakowski et al., 1998). Through in vitro and
in vivo assays of various HMGRs, the HMGR from Staphylococcus aureus, named mva, has been noted to exhibit a
higher activity than tHMG1 from E. coli (Ma et al., 2011).
In the present study, the effects of tHMG1 and mva on
carotenoid production in S. cerevisiae were investigated to
compare their overall performance in S. cerevisiae.
Materials and methods
Cloning and site-directed mutagenesis of crtI
and crtYB
The cDNAs corresponding to crtI (GenBank accession
no. AY177424.1) and crtYB (GenBank accession no.
AY177204.1) were isolated from X. dendrorhous by
RT-PCR, and cloned into the pMD18-T vector to obtain
the constructs pMD18-T-crtI and pMD18-T-crtYB, respectively, for DNA sequencing. To determine the nucleotide
sites whose utilization frequency is < 15% in S. cerevisiae,
the full-length cDNA sequences of crtI and crtYB were
analyzed using a graphical codon usage analyzer (GCUA;
Fuhrmann et al., 2004) with the codon usage table of
S. cerevisiae. Subsequently, five nucleotides of crtI and eight
nucleotides of crtYB were identified to be poor sites (usage
frequency of < 15%) with regard to the translation efficiency in S. cerevisiae. Based on these results, the poor
codon sites of crtI and crtYB were subjected to mutation
to improve their codon usage frequency. All of the sitedirected mutagenesis processes were accomplished by
overlapping extension PCR with primers 5–30, using the
plasmid pMD18-T-crtI or pMD18-T-crtYB as the template
(Kanoksilapatham et al., 2007). The mutated crtI and crtYB
were designated as McrtI and McrtYB, respectively. All the
primers used for the PCR in this study are listed in Table 1.
FEMS Microbiol Lett 345 (2013) 94–101
Plasmid constructions
A DNA cassette for yeast expression was prepared in the
vector PUC19 to obtain the construct pLQ01 (Fig. 1).
The plasmid pLQ01 comprised 680-bp TDH3 gene
promoter and 250-bp CYC1 gene terminator sequences,
which were amplified from the genomic DNA of S. cerevisiae using primers 31–34. The open reading frames
(ORFs) of crtI, crtYB, McrtI and McrtYB were linked to
the TDH3 promoter and CYC1 terminator by inserting
the ORFs into the plasmid pLQ01 at the BamHI/NotI
site. The expression cassette ‘TDH3 promoter-gene-CYC1
terminator’ was then amplified using primers 35–38. The
DNA cassettes ‘TDH3 promoter-crtI-CYC1 terminator’
and ‘TDH3 promoter-McrtI-CYC1 terminator’ were
digested with SpeI and SalI restriction enzymes and introduced into an integrative yeast expression vector pRS406
at SpeI/SalI sites, resulting in the constructs pRS406-crtI
and pRS406-McrtI, respectively. The SalI/XhoI fragment
of ‘TDH3 promoter-crtYB-CYC1 terminator’ was subsequently ligated into pRS406-crtI at the SalI/XhoI site to
obtain the construct pRS406W (Fig. 1). The same
approach was applied to construct pRS406M by excising
the SalI/XhoI fragment of ‘TDH3 promoter-McrtYBCYC1 terminator’ and introducing into pRS406-McrtI.
The ORF of tHMG1 cDNA (NCBI Reference Sequence
NM_001182434.1) was isolated by RT-PCR with primers
39–40 from S. cerevisiae WAT11 strain, and the cDNA corresponding to mva (NCBI Reference Sequence NC_017342.
1) was amplified using primers 41–42 from the genomic
DNA of S. aureus (ATCC25923). The S. aureus strain was
kindly provided by Dr. Qiang Gao (Biological Control of
Arborvirus Vectors, Wuhan Institute of Virology, Chinese
Academy of Sciences). Through overlapping extension PCR
with primers 43–44, the ORF of tHMG1 was linked to the
TDH3 promoter to obtain the fragment ‘TDH3-tHMG1’.
The DNA fragment ‘TDH3-tHMG1’ was then digested and
ligated into a yeast expression vector pESC-HIS (Stratagene)
at the SpeI/BamHI site to obtain the construct pESCHIS-TDH3-tHMG1. Similarly, the ORF of mva was cloned
at the TDH3 promoter by overlapping PCR using primers
45–46, and then ligated into pESC-HIS at the EcoRI/BamHI
site to obtain the pESC-HIS-TDH3-mva vector. In the
constructs pESC-HIS-TDH3-tHMG1 and pESC-HIS-TDH3mva, the endogenous galactose inducing promoters (Gal1
and Gal10) in pESC-HIS were removed (Fig. 1).
Yeast strain construction and cultivation
The integration vectors pRS406, pRS406W, and pRS406M
were linearized with StuI and integrated into the ura3-52
locus of S. cerevisiae WAT11 strain to create the yeast
strains WAT11/pRS406, WAT11/pRS406W, and WAT11/
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
96
Q. Li et al.
Table 1. Primers used in this study
Primer no.
Description
Sequence (5′ to 3′)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
crtI-F
crtI-R
crtYB-F
crtYB-R
crtI-116-F
crtI-116-R
crtI-129-F
crtI-129-R
crtI-161-F
crtI-161-R
crtI-244-F
crtI-244-R
crtI-420-F
crtI-420-R
crtYB-155-F
crtYB-155-R
crtYB-310-F
crtYB-310-R
crtYB-335-F
crtYB-335-R
crtYB-462-F
crtYB-462-R
crtYB-548-F
crtYB-548-R
crtYB-563-F
crtYB-563-R
crtYB-589-F
crtYB-589-R
crtYB-660-F
crtYB-660-R
TDH3p-F
TDH3p-R
CYC1t-F
CYC1t-R
Pr-crtI-Tr-F
Pr-crtI-Tr-R
Pr-crtYB-Tr-F
Pr-crtYB-Tr-R
tHMG1-F
tHMG1-R
mva-F
mva-R
Pr-tHMG1-F
Pr-tHMG1-R
Pr-mva-F
Pr-mva-R
GGCGGATCCATGGGAAAAGAACAAGATCAG
AAAGCGGCCGCTCAGAAAGCAAGAACACCA
GCGGGATCCATGACGGCTCTCGCATATTAC
AAAGCGGCCGCTTACTGCCCTTCCCATCCG
CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
GTGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
GCCGGATCCTTTGTTTGTTTATGTG
TTTGCGGCCGCATCCGCTCTAACCGAAA
GCCGGATCCTTTGTTTGTTTATGTG
GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
GCCGGATCCTTTGTTTGTTTATGTG
GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
GCCGGATCCTTTGTTTGTTTATGTG
CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
GGCGGATCCTTAGGATTTAATGCAGGTGACG
CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
GCGACTAGTCAGTTCGAGTTTATCA
GGCGGATCCTTAGGATTTAATGCAGGTGACG
GCGACTAGTCAGTTCGAGTTTATCA
GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
pRS406M, using the PEG/LiAc method (Gietz & Woods,
2002). The episomal vector pESC-HIS-TDH3-tHMG1 was
transformed into the yeast strain WAT11/pRS406M to
obtain WAT11/pRS406M-tHMG1. Similarly, the strain
WAT11/pRS406M-mva was prepared by transforming the
construct pESC-HIS-TDH3-mva into the yeast strain
WAT11/pRS406M. As the control, the empty vector
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
pESC-HIS was transferred into the yeast strain WAT11/
pRS406M to construct WAT11/pRS406M-HIS. Detailed
information regarding the constructed yeast strains is
presented in Table 2.
The yeast strains were cultured at 250 rpm and 30 °C
in an appropriate yeast liquid medium. The strains
WAT11/pRS406, WAT11/pRS406W, and WAT11/
FEMS Microbiol Lett 345 (2013) 94–101
97
Beta-carotene biosynthesis in S. cerevisiae
Fig. 1. Structure of the vectors. (a) pLQ01
containing a TDH3 promoter and a CYC1
terminator. (b) pRS406. (c) pRS406W carrying
the wild-type genes responsible for carotenoids
expression. (d) pRS406M carrying the
optimized carotenoids expression genes.
(e) pESC-TDH3-tHMG1 holding the catalytic
domain of tHMG1 gene in Saccharomyces
cerevisiae. (f) pESC-TDH3-tHMG1 holding the
mva gene derived from Staphylococcus aureus.
(a)
(b)
(c)
(d)
(e)
(f)
Table 2. Strains and plasmids used in this study
Strain or plasmid
Yeast strains
Relevant features
WAT11
Integrative vector transformants
WAT11/pRS406
WAT11/pRS406W
WAT11/pRS406M
Episomal vector transformants
WAT11/pESC-HIS
WAT11/pRS406MtHMG1
WAT11/pRS406Mmva
Plasmids
pRS406W
pRS406M
pESC-TDH3-tHMG1
pESC-TDH3-mva
FEMS Microbiol Lett 345 (2013) 94–101
MATa (leu2-3,112 trp1-1
can1-100 ura3-1 ade2-1
his3-11,15)
WAT11+ pRS406
WAT11+ pRS406W
WAT11+ pRS406M
WAT11+ pRS406M + pESC-HIS
WAT11+ pRS406M +
pESC-TDH3-tHMG1
WAT11+ pRS406M +
pESC-TDH3-mva
pRS406M were grown in SD-URA medium (amino acid
dropout medium), and the strains WAT11/pRS406MtHMG1, WAT11/pRS406M-mva, and WAT11/pRS406MHIS were grown in SD-HIS-URA medium (amino acid
dropout medium). To monitor the yeast growth, a single
clone from each of the yeast strains was initially cultured
in 5 mL of yeast medium at 30 °C under constant
shaking to an optical density (measured at 600 nm;
OD600) of 0.6. The yeast cultures were then inoculated
into fresh SD medium at a ratio of 1 : 40. Subsequently,
200 lL of the samples were collected at 0, 6, 12, 24, 30,
36, 48, 60, 72, 96, and 120 h to measure OD600.
Extraction and quantification of beta-carotene
pRS406 TDH3-WCrtYB-CYC1,
TDH3-WCrtI-CYC1
pRS406 TDH3-MCrtYB-CYC1,
TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva-CYC1
The yeast cells grown at 30 °C for 72 h in 50 mL of yeast
medium were pelleted by centrifugation at 3500 g for
5 min, washed twice with 0.9% (w/v) NaCl, and lyophilized (Lange & Steinbuchel, 2011). Approximately 100 mg
of the freeze-dried cells were suspended in 2 mL of aceª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
98
Q. Li et al.
Fig. 2. Metabolic pathway of endogenous ergosterol biosynthesis
and exogenous beta-carotene biosynthesis. The solid arrows show the
one-step conversions of biosynthesis, and the dashed arrows show
the several-step conversions. crtYB and crtI are the endogenous betacarotene synthesis genes.
tone/0.2% pyrogallol in methanol (w/v; 80 : 20, v/v), and
1 g of glass beads (diameter, 425–600 lm) was added.
The mixture was shaken for 3 min in a high-throughput
(a)
(b)
(c)
(d)
tissue grinder, and the acetone–methanol fraction was
collected by centrifugation at 6000 g for 5 min. The
extraction was repeated four to five times. The organic
extractions were pooled, evaporated to dryness, and
re-dissolved in 1 mL of acetone for HPLC analysis. To
avoid photo-oxidation, all the extraction procedures were
carried out in darkness.
The HPLC analysis was performed on an LC-20AT
instrument equipped with a binary pump, an autosampler, and a photodiode array detector (Shimadzu, Kyoto,
Japan). An Agilent HC-C18 (2) reversed-phase column
(4.6 9 250 mm, 5 lm) was used with acetonitrile/methanol (50 : 50 v/v) as the mobile phase at a flow rate of
1 mL min 1. The column temperature was set at 25 °C
and the detection wavelength was 450 nm. Beta-carotene
generated from the yeast cultures was quantified based on
a standard calibration curve made with authentic
beta-carotene (Sigma Aldrich GmbH, China) of various
concentrations.
Fig. 3. The low usage codons of (a) crtI and (b) crtYB gene from Xanthophyllomyces dendrorhous, and (c and d) codon usage frequency of
these sites after optimization.
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 345 (2013) 94–101
Beta-carotene biosynthesis in S. cerevisiae
Results and discussion
Codon-optimized crtI and crtYB highly
improved carotenoid production in
S. cerevisiae
Saccharomyces cerevisiae has been routinely used as a
heterologous expression system because it is safe to use,
involves mature fermentation technology, etc. However,
the bias of codon usage is an important restriction factor
for the expression of foreign enzymes in S. cerevisiae. In
the present study, S. cerevisiae integrated with crtI and
crtYB genes from X. dendrorhous was capable of expressing those genes and producing carotenoids (Fig. 2). To
investigate the possibility of improving carotenoid
production in S. cerevisiae, the codon usage of crtI and
crtYB cDNA sequences in S. cerevisiae were examined
using GCUA. As shown in Fig. 3, five codons of crtI and
eight codons of crtYB were found to be poor sites with
less than 15% of usage frequency. Using overlapping
extension PCR, the poor codons were mutated to favorable ones of S. cerevisiae (Fig. 3). The codon-optimized
99
genes, McrtI and McrtYB, were successfully integrated
into the genome of S. cerevisiae. The yeast strain integrated with both wild-type crtI and crtYB genes served as
the control. For the negative control, the empty integrative vector pRS406 was integrated into the genome of the
yeast strain. A representative clone from these transgenic
yeast strains was streaked onto an SD-URA plate and
grown at 30 °C for 5 days. The color of the negative
control strain was white, whereas the strain containing
wild-type crtI and crtYB genes was yellow. Apparently, a
yellow color with more intensity was observed from the
strain integrated with McrtI and McrtYB (Fig. 4a), suggesting an evident improvement in beta-carotene production in this strain. The growth properties of these yeast
strains grown in liquid media were monitored by measuring OD600 through a time course. None of the three
strains showed significant differences in their growth
curves and the cell densities were almost saturated at
72 h, starting from the cells inoculated into the fresh
medium (cf. yeast strains cultivation in Materials and
methods). Therefore, the cells grown for 72 h were harvested for extraction and quantification of beta-carotene.
(a)
(b)
Fig. 4. (a) Colors of different carotenoid-producing Saccharomyces cerevisiae strains on a – URA plate for (a) WAT11/pRS406, (b) WAT11/
pRS406W, and (c) WAT11/pRS406M; on a – URA-HIS plate for (d) WAT11/pRS406M-HIS, (e) WAT11/pRS406M-tHMG1, and (f) WAT11/
pRS406M-mva. (b) The concentrations of beta-carotene produced in the different S. cerevisiae transformants. Values are the mean SE of three
experiments.
FEMS Microbiol Lett 345 (2013) 94–101
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
100
HPLC analysis showed around 200% improvement in the
production of beta-carotene in the yeast strain integrated
with mutated genes when compared with that in the
control yeast bearing wild-type genes. The concentration
of beta-carotene produced by the control strain was about
85.6 lg g 1 dw, whereas the yeast strain containing
mutated genes produced beta-carotene up to a concentration of 251.8 lg g 1 dw (Fig. 4b). The negative control
yeast strain integrated with empty vector pRS406 did not
produce any beta-carotene (data not shown). Surprisingly, only site optimizations resulted in such a distinct
improvement in beta-carotene production, leading to the
expectation that more beta-carotene could be generated
in S. cerevisiae by optimizing the full-length crtI and
crtYB cDNAs. The present study provides another example of the effectiveness of codon optimization for heterologous expressions of foreign metabolic pathways.
Higher beta-carotene production in
S. cerevisiae directed by mva than tHMG1
To compare the overall performance of mva and tHMG1
in S. cerevisiae in vivo, the mva and tHMG1 cDNAs were
cloned at the TDH3 constitutive promoter and separately
overexpressed in the constructed carotenoid-producing
S. cerevisiae. The carotenoid-producing yeast transformed
with the empty vector pESC-HIS served as the control
strain. When the representative clones from these transgenic strains were streaked onto an SD-HIS-URA plate,
a clear difference in yellow-color intensity was observed
(Fig. 4A). The strain harboring either tHMG1 or mva
was much yellower than the control strain, suggesting a
higher content of beta-carotene. To investigate whether
the expression of tHMG1 or mva inhibits the yeast
growth, the cell densities of the three transgenic strains
were evaluated by measuring the OD600 values during a
time course. The yeast growth curves were very similar,
indicating that the expression of tHMG1 or mva had no
or negligible effects on the yeast growth. In addition, the
biomass yields of those strains were also almost saturated at 72 h in culture conditions (data not shown).
After 72 h of growth, the yeast cells were harvested for
the quantification of beta-carotene using HPLC analysis.
The beta-carotene content of the control strain was
found to be 237 lg g 1 dw. When compared with the
control strain, the strain overexpressing tHMG1 exhibited a 30% improvement in the production of beta-carotene (310.8 lg g 1 dw), whereas mva expression directed
around 60% increase in the beta-carotene levels
(390 lg g 1 dw; Fig. 4B). This result indicates that mva
was more efficient than tHMG1 in promoting isoprenoid
biosynthesis in S. cerevisiae. This higher efficacy of mva
than tHMG1 in S. cerevisiae could possibly be related to
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
Q. Li et al.
the higher catalytic efficiency of mva (Ma et al., 2011).
When the codon usage preference analysis was applied
to mva and tHMG1 cDNA sequences using S. cerevisiae
as the host organism, we found that the overall codon
usage frequency of mva was lower than that of tHMG1
(data not shown). Thus, codon-optimized mva can be
expected to further increase isoprenoid biosynthesis in
S. cerevisiae.
In summary, our results strongly suggested that the
codon optimizations of CrtI and CrtYB led to a higher
concentration of beta-carotene produced in S. cerevisiae
strain. Moreover, compared with the tHMG1 expressed,
mva seemed to be better to direct more carbon fluxes
into isoprenoid pathway, which is consistent with a previous biochemical study (Ma et al., 2011). In comparisons
with other reports, the overall beta-carotene yield of the
S. cerevisiae strains in this study was comparable to that
of S. cerevisiae strains engineered by Yamano et al. (1994)
but was more than 10-fold lower relative to the betacarotene yield engineered in S. cerevisiae by Verwaal et al.
(2007). This most likely resulted from the different
number of genes engineered in yeast cells or genotype
differences between S. cerevisiae stains, e.g. S. cerevisiae
CEN. PK contained an unusually high content of ergosterol and fatty acids compared with other S. cerevisiae
strains (Daum et al., 1999).
Acknowledgements
This project was supported by the Grant for One
Hundred Talents Program of the Chinese Academy of
Sciences, China (Project No. Y129441R01).
Authors’ contribution
Q.L., Z.S. and J.L. contributed equally to this work.
References
Anunciato TP & da Rocha Filho PA (2012) Carotenoids and
polyphenols in nutricosmetics, nutraceuticals, and
cosmeceuticals. J Cosmet Dermatol 11: 51–54.
Bauernfeind J, Rubin S, Surmatis J & Ofner A (1970)
Carotenoids and fat-soluble vitamins: contribution to food,
feed and pharmaceuticals. Int Z Vitaminforsch 40: 391.
Bracco U, Loliger J & Viret J (1981) Production and use of
natural antioxidants. J Am Oil Chem Soc 58: 686–690.
Britton G, Liaaen-Jenson S & Pfander H (1998) Carotenoids:
Biosynthesis and Metabolism. Birkhauser Verlag, Basel.
Buring JE & Hennekens CH (1995) Beta-carotene and cancer
chemoprevention. J Cell Biochem 22: 226–230.
Daum G, Tuller G, Nemec T, Hrastnik C, Balliano G, Cattel L,
Milla P, Rocco F, Conzelmann A & Vionnet C (1999)
FEMS Microbiol Lett 345 (2013) 94–101
Beta-carotene biosynthesis in S. cerevisiae
Systematic analysis of yeast strains with possible defects in
lipid metabolism. Yeast 15: 601–614.
Donald K, Hampton RY & Fritz IB (1997) Effects of
overproduction of the catalytic domain of
3-hydroxy-3-methylglutaryl coenzyme A reductase on
squalene synthesis in Saccharomyces cerevisiae. Appl Environ
Microbiol 63: 3341–3344.
Engels B, Dahm P & Jennewein S (2008) Metabolic
engineering of taxadiene biosynthesis in yeast as a first step
towards Taxol (Paclitaxel) production. Metab Eng 10:
201–206.
Fuhrmann M, Hausherr A, Ferbitz L, Schodl T, Heitzer M &
Hegemann P (2004) Monitoring dynamic expression of
nuclear genes in Chlamydomonas reinhardtii by using a
synthetic luciferase reporter gene. Plant Mol Biol 55: 869–881.
Gietz RD & Woods RA (2002) Transformation of yeast by
lithium acetate/single-stranded carrier DNA/polyethylene
glycol method. Methods Enzymol 350: 87–96.
Hershberg R & Petrov DA (2008) Selection on codon bias.
Annu Rev Genet 42: 287–299.
Johnson EJ (2002) The role of carotenoids in human health.
Nutr Clin Care 5: 56–65.
Kanoksilapatham W, Gonzalez JM & Robb FT (2007)
Directed-mutagenesis and deletion generated through an
improved overlapping-extension PCR based procedure.
Silpakorn U Science Tech J 1: 7–12.
Kim SW, Kim JB, Jung WH, Kim JH & Jung JK (2006)
Over-production of beta-carotene from metabolically
engineered Escherichia coli. Biotechnol Lett 28: 897–904.
Kritchevsky SB (1999) Beta-carotene, carotenoids and the
prevention of coronary heart disease. J Nutr 129: 5–8.
Lange N & Steinbuchel A (2011) Beta-carotene production by
Saccharomyces cerevisiae with regard to plasmid stability
and culture media. Appl Microbiol Biotechnol 91:
1611–1622.
Lee P & Schmidt-Dannert C (2002) Metabolic engineering
towards biotechnological production of carotenoids in
microorganisms. Appl Microbiol Biotechnol 60: 1–11.
Ma SM, Garcia DE, Redding-Johanson AM, Friedland GD,
Chan R, Batth TS, Haliburton JR, Chivian D, Keasling JD &
FEMS Microbiol Lett 345 (2013) 94–101
101
Petzold CJ (2011) Optimization of a heterologous
mevalonate pathway through the use of variant HMG-CoA
reductases. Metab Eng 13: 588–597.
Misawa N & Shimada H (1997) Metabolic engineering for the
production of carotenoids in non-carotenogenic bacteria
and yeasts. J Biotechnol 59: 169.
Miura Y, Kondo K, Saito T, Shimada H, Fraser PD & Misawa
N (1998) Production of the carotenoid lycopene,
beta-carotene, and astaxanthin in the food yeast Candida
utilis. Appl Environ Microbiol 64: 1226–1229.
Nelis H & De Leenheer A (1991) Microbial sources of
carotenoid pigments used in foods and feeds. J Appl
Bacteriol 70: 181–191.
Plotkin JB & Kudla G (2010) Synonymous but not the same:
the causes and consequences of codon bias. Nat Rev Genet
12: 32–42.
Polakowski T, Stahl U & Lang C (1998) Overexpression of a
cytosolic hydroxymethylglutaryl-CoA reductase leads to
squalene accumulation in yeast. Appl Microbiol Biotechnol
49: 66–71.
Verwaal R, Wang J, Meijnen J-P, Visser H, Sandmann G, van
den Berg JA & van Ooyen AJ (2007) High-level production
of beta-carotene in Saccharomyces cerevisiae by successive
transformation with carotenogenic genes from
Xanthophyllomyces dendrorhous. Appl Environ Microbiol
73: 4342–4350.
Wang Y, Halls C, Zhang J, Matsuno M, Zhang Y & Yu O
(2011) Stepwise increase of resveratrol biosynthesis in yeast
Saccharomyces cerevisiae by metabolic engineering. Metab
Eng 13: 455–463.
Yamano S, Ishii T, Nakagawa M, Ikenaga H & Misawa N
(1994) Metabolic engineering for production of
beta-carotene and lycopene in Saccharomyces cerevisiae.
Biosci Biotechnol Biochem 58: 1112.
Zhang Y, Li S-Z, Li J, Pan X, Cahoon RE, Jaworski JG, Wang
X, Jez JM, Chen F & Yu O (2006) Using unnatural protein
fusions to engineer resveratrol biosynthesis in yeast and
mammalian cells. J Am Chem Soc 128: 13030–13031.
ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved