Bacteria found in antibiotic-polluted
lakes can transfer their resistance to
model bacteria for human pathogens
Master thesis in Medicine
Ida Nilsson
Supervisors:
Carl-Fredrik Flach & D G Joakim Larsson
Department of Physiology and Endocrinology
Institute of Neuroscience and Physiology
The Sahlgrenska Academy
Programme in Medicine
Gothenburg, Sweden 2012
Abstract
Introduction – Antibiotic resistance is today a problem of great concern, a development
which is strongly promoted when bacteria are exposed to antibiotics. The resistance can be
due to mutations in pre-existing bacterial DNA or due to horizontal transfer of genes. The
environment in Patancheru, India, and surrounding areas are highly contaminated with
antibiotics due to pollution from drug manufacturing, and a large variety of bacterial
antibiotic-resistance genes have been found in sediment samples from these areas, especially
genes conferring resistance to quinolones and sulfonamides. Aim – The aim was to
investigate whether antibiotic-resistance genes borne by environmental bacteria from two
antibiotic-contaminated lakes were transferable to other bacteria, including model bacteria for
human pathogens. Material and methods – Analysis of phenotypic resistance was performed
by culturing on selective medium. Plasmid capture was achieved by filter mating using green
fluorescent protein (gfp)-tagged recipient bacteria. For plasmid extraction, anion-exchange
columns were used and antibiotic susceptibility was determined by Etests®.
Results - Phenotypic ciprofloxacin- and sulphamethoxazole-resistance in environmental
bacteria were shown to be considerably higher in the sediment from two Indian lakes than in
two Swedish control lakes. Plasmids carrying sulphamethoxazole-resistance were transferable
to E. coli from bacteria in the Indian samples, P. putida and A. baylyi gained ciprofloxacinresistance as well as resistance to several other classes of antibiotics when incubated together
with the same environmental bacteria. Conclusions - The antibiotic resistance-genes found in
sediment from the polluted areas around Patancheru are transmissible to other bacteria,
including model organisms for human pathogens. The pollution thus poses a risk for
development of antibiotic-resistant human pathogens. Key words – antibiotic resistance,
antibiotic-pollution, transconjugants, plasmid capture, sediment samples.
2
Contents
Abstract ...................................................................................................................................... 2
1
Introduction ......................................................................................................................... 4
2
Aim ..................................................................................................................................... 8
3
Material and methods .......................................................................................................... 8
3.1
Sediment samples and recipient bacteria ..................................................................... 8
3.2 Analysis of phenotypic ciprofloxacin- and sulfamethoxazole-resistance in sediment
samples ................................................................................................................................... 8
3.3
Capture of plasmids containing sulfamethoxazole or ciprofloxacin resistance genes 9
3.4
Plasmid isolation........................................................................................................ 11
3.5
Digestion of plasmid DNA ........................................................................................ 12
3.6
Purification of total DNA .......................................................................................... 12
3.7
Detection of the gfp-construct by PCR...................................................................... 12
3.8 Matrix-assisted laser desorption/ionization – time of flight mass spectometry
(MALDI-TOF MS) ............................................................................................................... 13
3.9
4
Antibiotic susceptibility testing ................................................................................. 13
Results ............................................................................................................................... 14
4.1 Analysis of phenotypic ciprofloxacin- and sulfamethoxazole-resistance in sediment
samples ................................................................................................................................. 14
5
6
4.2
Capture of plasmids containing sulfamethoxazole or ciprofloxacin resistance genes
15
4.3
Plasmid isolation........................................................................................................ 18
4.4
Detection of gfp-construct by PCR ........................................................................... 20
4.5
Antibiotic susceptibility testing ................................................................................. 22
4.6
MALDI-TOF MS ...................................................................................................... 24
Discussion ......................................................................................................................... 25
5.1
Methodological considerations .................................................................................. 29
5.2
Future studies ............................................................................................................. 31
Conclusions and implications ........................................................................................... 32
Populärvetenskaplig sammanfattning ...................................................................................... 33
Acknowledgements .................................................................................................................. 36
References ................................................................................................................................ 36
3
1
Introduction
Antibiotic resistant bacteria are today a growing problem for human health. When exposed to
antibiotics bacteria can gain resistance either by random mutations in their preexisting DNA,
including their chromosome(s), or by horizontal gene-transfer, e.g. via acquisition of plasmids
or other mobile genetic elements (MGEs), from surrounding bacteria [1]. Plasmids are
circular, double stranded, often mobile DNA elements that bacteria carry in addition to the
chromosomal DNA. Plasmids vary very much in size and can contain 5-100 genes that are not
essential to the bacterium’s survival during normal conditions, e.g. antibiotic resistance genes,
as they can be lost without harming the bacterium. The plasmids often carry resistance genes
to several classes of antibiotics. Conjugation is the process where plasmids are transferred
from one bacterium to another and requires cell-to-cell contact; the receiver of the plasmid is
called a transconjugant. The conjugative plasmid itself carries genes that help bring the
bacteria together. Plasmids are most often transferrable to closely related, but still diverse,
bacteria [2]. An obvious way of exposing bacteria to antibiotics is antibiotic treatment of
infectious disease in humans; the major cause of the accelerating problem with antibioticresistant strains is most likely the wide use (and misuse) of antibiotics. Data from Goossens et
al [3] and the European Centre for Disease Prevention and Control (ECDC) network shows
that countries with higher prescription of quinolone antibiotics, in general, also observe higher
frequencies of quinolone resistant E. coli and P. aeruginosa (Fig. 1a and 1b).
4
Outpatients use of Quinolones in 2002
DDD per 1000 inh. per day
4
3,5
3
2,5
2
1,5
1
0,5
0
Percentage of Fluoroquinolone-resistant
E. coli and P. aeruginosa isoltaes in 2010
50%
40%
30%
20%
10%
0%
Italy
Spain
Portugal
Pseudomonas aeruginosa
United
Kingdom
Denmark
Fig. 1a. Prescription
of quinolones,
counted as defined
daily doses per 1000
inhabitants per day, to
outpatients in six
European countries.
H. Goossens et al,
Outpatients antibiotic
use in Europe and
association with
resistance, The
Lancet, 2005
Fig. 1b. Percentage
of quinolone
resistant Escherichia
coli and
Pseudomonas
aeruginosa isolates
in six European
countries. Data
submitted by
TESSy, The
European
Surveillance System
(the ECDC website).
Norway
Escherichia coli
Furthermore, the use and misuse of antibiotics in medicine as well as in veterinary medicine
and in animal husbandry, is a problem since it also leads to environmental emission of the
drugs, which might select for environmental bacteria harboring antibiotic resistance [4, 5].
Monitoring of the pharmaceutical pollution, especially to the aquatic environment, is
5
generally done by sampling effluent water from waste water treatment plants (WWTPs)
treating household and hospital waste water [6]. For example in South-East Queensland,
Australia, the emissions of for example ciprofloxacin (a quinolone antibiotic) from WWTP
measured 0.08-14.5 µg/l [7]. In recent years emissions of drugs from the actual manufacturers
have started to raise high concerns as well since emission of active substances is not
controlled [8]. In general little is known about such pollution, but effluent samples from a
New York WWTP revealed emissions of for example 1,700 µg/l of oxycodone (narcotic
analgesic) and 3,800 µg/l of metaxalone (muscle relaxant) [9].
However, the majority of the generic drugs used today are produced in low-income countries
such as India. In 2007 Larsson et al revealed that effluent water samples from a WWTP in
Patancheru, near Hyderabad in India, treating water from 90 medical industries in the area,
contained extraordinary high concentrations of several different types of drugs including
antibiotics. For example, concentrations of ciprofloxacin, enrofloxacin and norfloxacin
(fluoroquinolone antibiotics) were found to be as high as 31,000 µg/L, 780-900 µg/L and 390420 µg/L respectively [10]. The concentration of ciprofloxacin in this effluent water even
exceeds the concentration seen in blood plasma of treated patients. In addition, by using
metagenomic sequencing, a recent study found very high levels of antibiotic resistance-genes
in sediment samples from the river receiving the effluent water from the Patancheru WWTP
compared to Swedish control sites. The genes primarily found was the sul2-gene conferring
resistance to sulfonamides as well as various qnr-genes conferring resistance to quinolones
[11]. The sul2-gene has predominantly been found on plasmids [12].
Qnr-genes are, as the sul-genes, often located to plasmids [13]. The qnr-genes confer lowmoderate level of quinolone resistance in comparison to mutations in the bacterial
chromosome, e.g. specific point mutations in genes encoding quinolone target enzymes,
which can give resistance to moderate-high level of quinolones [14, 15]. Although qnr-genes
6
only bring a lower level of quinolone-resistance, they can increase the resistance by 4 to 128
times in transconjugants and further increase already existing resistance caused by effluxpumps, deficiencies in outer membrane porins, or chromosomal mutations [14, 16].
Moreover, Martinez-Martinez et. al. showed that quinolone-resistant mutants were obtained
over 100 times more frequently from bacteria carrying a qnr-containing plasmid than from
bacteria without, thus the qnr-gene facilitate selection of higher quinolone-resistance [17].
Although prior studies have shown that environments in Patancheru and surrounding areas
contain high levels of genes conferring antibiotic resistance, little is known about the
phenotypic resistance and its transferability. However, there is a potential risk that the
antibiotic pollution in the area promotes selection of bacteria carrying antibiotic resistance
genes. Such increased development of antibiotic resistant bacteria might eventually lead to
increased antibiotic resistance in human pathogens by horizontal gene transfer; either if the
pathogens meet the resistant bacteria in the environment or if the environmental bacteria
encounter the pathogens inside the human body. Today’s international travelling habits
among the Earth’s population could quickly spread any of these resistant bacteria from India
to other parts of the world [18].
Because of the major clinical problem with antibiotic-resistant bacteria worldwide, it lies in
our interest to consider every way of such strains to evolve and to investigate the
transferability of their genes. In this study we have therefore applied exogenous plasmid
capture (conjugation) by mixing sediment samples from Patancheru, as well as sediment from
Swedish control sites, with gfp-marked recipients in order to study transferability of antibiotic
resistance genes.
7
2
Aim
The aim was to investigate whether antibiotic-resistance genes borne by environmental
bacteria from two antibiotic-contaminated lakes were transferable to other bacteria, including
model bacteria for human pathogens.
3
3.1
Material and methods
Sediment samples and recipient bacteria
Sediment samples used were collected from the Indian lakes Kazipally lake (17°34’25.32”N
78°21’21.54”E) and Azanikunta tank (17°33’9.9”N 78°19’59.4”E) January 31st 2012,
Patancheru, India. Comparative sediment samples were collected from the Swedish lakes
Härlandatjärn (57°42’27.036”N 12°2’50.28”) March 6th 2012, and Axlemosse
(57°40’06.58”N 11°56’55.52”E), April 10th 2012, Gothenburg, Sweden.
The following rifampicin- and kanamycin-resistant strains were kindly provided by Professor
Kornelia Smalla and used as recipients in plasmid capture experiments: Pseudomonas putida
UWCl (γ-subclass of Proteobacteria), Agrobacterium tumefaciens UBAPF2 (α-subclass of
Proteobacteria), Escherichia coli CV601 (γ-subclass of Proteobacteria) and Acinetobacter
baylyi BD413 (γ-subclass of Proteobacteria). All strains have been gfp-tagged by introduction
of the mini-transposon vector pAG508 [19], and are therefore emitting a green fluorescent
signal when exposed to UV-light.
3.2
Analysis of phenotypic ciprofloxacin- and sulfamethoxazole-resistance in sediment
samples
To study the phenotypic ciprofloxacin- and sulfamethoxazole-resistance of the environmental
bacteria in the different sediment samples, the sediment samples were prepared as follows; 1
gram of sediment was mixed with 9 ml of saline (0.85 % NaCl) in a 50 ml Falcon tube by
vortexing for 2.5 minutes. The tubes were left for sedimentation during 1.5 minutes. 200 µl
8
were sampled from the upper part of the liquid and were used to prepare serial dilutions in
saline.
60 µl of every dilution was plated on a R2A plate (Oxoid, Basingstoke, UK) containing
cycloheximide (100 µg/ml, Sigma-Aldrich, St. Louis, USA) and ciprofloxacin (0,2 µg/ml,
AppliChem GmbH, Darmstadt, Germany), on a Mueller-Hinton (Oxoid, Hampshire, UK)
agar plate containing cycloheximide (100 µg/ml) and sulfamethoxazole (100 µg/ml, SigmaAldrich), and on a R2A plate containing cycloheximide (100 µg/ml). The plates were allowed
to dry before incubation at 28° C overnight.
3.3
Capture of plasmids containing sulfamethoxazole or ciprofloxacin resistance genes
The recipient bacteria were pre-cultured on Luria-Bertani agar (LBA; Tryptone (Lab M,
Lancashire, UK), Yeast Extract (Scharlau, Barcelona, Spain), Sodium-Chloride (Fischer
Scientific, Gothenburg, Sweden), Agar (Scharlau)) plates containing kanamycin (50 µg/ml,
Sigma-Aldrich) and rifampicin (50 µg/ml, Sigma-Aldrich) for 2-3 days at 28° C. One colony
from the pre-cultured plates was transferred to a 50 ml Falcon tube with 3 ml LB broth
(Tryptone (Lab M), Yeast Extract (Scharlau), Sodium-Chloride (Fischer Scientific))
containing rifampicin (50 µg/ml) and kanamycin (50 µg/ml). The tubes were incubated over
night at 28° C at 50 rpm.
The following day the sediment samples and the recipient bacteria were prepared for the
plasmid capture experiment. Two grams of sediment were transferred to a sterile E-flask
containing 10 ml 0.1 × Tryptic Soy Broth (TSB, Lab M). The flasks were incubated at 28° C
at 50 rpm for 2 hours. After incubation, the flasks were left for 1.5-2 minutes to allow
sedimentation of large particles. 6-7 ml of the upper part of the liquid were then transferred to
a 50 ml Falcon tube and centrifuged at 4,000 × g for 5 minutes. The supernatant was removed
9
and the pellet was washed three times in 0.1 × TSB before the resuspension in 600-700 µl 0.1
× TSB.
The recipient bacteria were collected from 1 ml of the overnight culture by centrifugation (5
min at 4,000 × g). The supernatant was removed and the pellet resuspended in 1 ml LB broth.
This was repeated three times.
To allow mating between recipient bacteria and the sediment’s environmental bacteria 100 µl
of each bacterial preparation were mixed in an Eppendorf tube. 100 µl were also sampled
from the receiver bacterium and donor broths for controls. The tubes were centrifuged (5 min
at 4,000 × g) and the supernatant removed before resuspending the pellet in 100 µl 1 × TSB.
The mixture was applied onto an 0.22 µm (pore size) filter (Milipore Corporation, Bedford,
USA), placed on a Tryptone-Glucose-Yeast (TGY, Scharlau) agar plate containing
cycloheximide (100µg/ml), and was incubated at 28° C. Controls with only recipient bacteria
or sediment bacteria were also prepared.
The following day the filters were transferred to 50 ml Falcon tubes containing 10 ml saline.
The tubes were vortexed for 1 minute to detach the bacteria from the filter. The resulting
suspension of bacteria is termed the 10-2 dilution. To select for transconjugants 100 µl of
serial dilutions (10-2, 10-3 and 10-4) were plated on TGY agar plates containing rifampicin (50
µg/ml), kanamycin (50 µg/ml), cycloheximide (100 µg/ml) and ciprofloxacin (0,2 µg/ml) and,
in the experiment where E. coli was used as recipient, also on Mueller-Hinton agar plates
containing rifampicin (50 µg/ml), kanamycin (50 µg/ml), cycloheximide (100 µg/ml) and
sulfamethoxazole (100 µg/ml). The plates were incubated at 28° C for two to three days.
The number of recipient bacteria in the different samples (mixture samples or samples
containing recipients alone) were determined by applying three 20 µl drops of the 10-5(not for
E.coli), 10-6, 10-7, 10-8 and 10-9 (only for E.coli) dilutions on a quarter of a TGY agar plate
10
containing rifampicin (50 µg/ml) kanamycin (50 µg/ml) and cycloheximide (100 µg/ml). The
drops were allowed to dry before incubation of the plates at 28° C. Colony counts were
determined after 1-3 days.
Suspected transconjugant colonies from the selection plates were transferred to new agar
plates containing rifampicin (50 µg/ml), kanamycin (50 µg/ml), and ciprofloxacin (0,2 µg/ml)
or sulfamethoxazole (100 µg/ml), and incubated at 28° C for two to three days before used for
further analyses or preparation of glycerol stocks for -70° C storage.
3.4
Plasmid isolation
For the extraction of plasmid DNA, one loop of freshly grown bacteria was resuspended in 1
ml saline and centrifuged (7 min at 1,400 × g, room temperature). After removing the
supernatant the pellet was resuspended in 600 µl buffer P1 (50 mM Tris-Cl pH 8,0/10 mM
EDTA + 100 µg/ml RNAseA), mixed with 600 µl buffer P2 (0,2N NaOH / 1 % SDS) and
incubated for 5 minutes at room temperature. 600 µl of pre-cooled buffer P3 (3M K-acetate
pH 5.5) was added to the mixture and the sample was incubated on ice for 15 minutes before
centrifugation (10 min at 16,100 × g, 4° C). The supernatant was transferred to a new
Eppendorf tube. The previous centrifugation was repeated twice. The plasmid purification
was performed with the QIAGEN® Plasmid Mini Kit 100 (QIAGEN® AB, Sollentuna,
Sweden) according to the manufacturer’s protocol; the supernatant was loaded on to an anionexchange column and was allowed to flow through by gravity. The column was washed with
4 ml buffer QC (1.0 MNaCl, 50 mM MOPS pH 7.0, 15 % isopropanol) and the plasmid DNA
eluted with 800 µl buffer QF (1.25 MNaCl, 50 mM TrisCl pH 8.5, 15 % iso-propanol), prewarmed to 65° C. The eluted DNA was precipitated with iso-propanol and washed with
ethanol before dissolved in 10 mM Tris/HCl, pH 8. The DNA concentration was determined
with a NanoDrop® Spectrophotometer ND-1000 (Thermo Scientific, Wilmington, DE, USA).
11
3.5
Digestion of plasmid DNA
To analyze the plasmid DNA by gel electrophoresis the DNA was digested with PstI (10u/µl)
(Fermentas®, St. Leon-Rot, Germany) and Bst1107I (10u/µl) (Fermentas®) in Buffer O
(Fermentas®). The mixture was incubated at 37° C for 3 hours. Digested DNA and
undigested controls were mixed with 6 × DNA Loading Dye (Fermentas®) and loaded on to a
1 % agarose gel containing 0.5 Tris-Borate-EDTA (TBE) buffer (Fermentas®, Vilnius,
Lithuania) and SYBR® Safe DNA gel stain (Life Technologies Ltd, Paisley, UK). The gel
was run at 80 V for 1-1.5 h and a GeneRuler™ 1kb Plus DNA ladder (0.5 µg/µl)
(Fermentas®) was used.
3.6
Purification of total DNA
The bacterial total DNA was extracted with the DNeasy® Blood & Tissue Kit (QIAGEN®
AB, Sollentuna, Sweden) according to the manufacturer’s protocol. Briefly, one loop of
freshly grown bacteria was resuspended in 1 ml saline, centrifuged (7 min at 1,400 × g, room
temperature) and resuspended in 180 µl tissue lysis-buffer ATL (QIAGEN®). 20 µl of
proteinase K (>600 mAU/ml) (QIAGEN®, Hilden, Germany) were added to the mixture
before incubation for 2.5 h in a 56 ° C water bath at 180 rpm. Thereafter lysis-buffer AL and
ethanol were added before loading the mixture on to a silica-based spin column which was
centrifuged for 1 minute at 6,000 × g. The column was washed with buffer AW1 and AW2
before elution of the DNA with buffer AE.
3.7
Detection of the gfp-construct by PCR
The purified total DNA was used in a PCR assay to ensure that surviving colonies from the
selection plates indeed carried the gfp-construct, which is incorporated in the genome of all
recipient bacteria. The PCR reaction was performed in a total volume of 25 µl, using the
AmpliTaq® polymerase (Applied Biosystems, Foster City, CA, USA), AmpliTaq® Buffer
12
(Applied Biosystems), 25 mM MgCl (Applied Biosystems), 10 mM dNTPs (Applied
Biosystems) and the following gfp-construct specific primers; GFPaphA3-373
5’ctgtcgacacaatctgccct 3’ and GFPaphA3’952 5’ccacatcggccagatcgtta 3’ (Eurofins MWG
Synthesis GmbH, Ebersberg, Germany). The recipient bacteria were used as positive controls
and a gfp-negative E. coli strain as a negative control. The DNA was heated to 94° C for 3
minutes before amplification during 35 cycles with denaturing at 94° C for 30 seconds,
annealing at 55° C for 30 seconds, elongation at 72° C for 40 seconds, and with a final
extension at 72° C for 7 minutes. The reaction was carried out in an Applied Biosystems®
GeneAmp® PCR System 9700 (Life Technologies Ltd, Paisley, UK). 10 µl of the PCR
product was mixed with 6 × DNA Loading Dye (Fermentas®) and analyzed on a 1.5 %
agarose gel containing SYBR® Safe DNA gel stain (Life Technologies) using a GeneRuler™
1kb Plus DNA ladder (0.5 µg/µl) (Fermentas®). The gel was run at 80 V for 45 minutes.
3.8
Matrix-assisted laser desorption/ionization – time of flight mass spectometry (MALDITOF MS)
To further confirm suspected transconjugants, MALDI-TOF MS technology was used to type
the isolates based on peptide mass fingerprinting. Fresh colonies were sent to Bakteriologiska
laboratoriet, Sahlgrenska universitetssjukhuset (Gothenburg, Sweden), where analyses were
performed.
3.9
Antibiotic susceptibility testing
The minimal inhibitory concentration (MICs) of ciprofloxacin, ampicillin, ceftazidime,
sulfamethoxazole, co-trimoxazole (trimethoprim/sulphamethoxazole), tetracycline,
gentamicin and azithromycin were determined for the recipient bacteria and for suspected
transconjugants with Etest® strips (BioMérieux SA, Marcy l’Etoile, France). The recipient
bacteria were cultured in Mueller-Hinton broth (Oxoid) containing kanamycin (50 µg/ml) and
13
suspected transconjugants were cultured in Mueller-Hinton broth containing kanamycin (50
µg/ml) and ciprofloxacin (0.2 µg/ml) or sulphamethoxazole (100 µg/l), all bacteria were
incubated at 28° C and 100 rpm over night. Following day the cultures were diluted to an
OD600 of 0.12-0.14 and spread with a cotton swab on a Mueller-Hinton agar plate according
to the instructions provided by the Etest® manufacturer. The E-strips were applied with
forceps and plates containing P. putida, A. baylyi and A. tumefaciens were incubated at 28° C
whilst plates containing E. coli were incubated at 35.5° C. All isolates were incubated for 20 h
before the MICs were read.
4
4.1
Results
Analysis of phenotypic ciprofloxacin- and sulfamethoxazole-resistance in sediment
samples
Previous studies of the environment in the Patancheru surroundings have shown high
concentrations of several antibiotics as well as high levels of antibiotic resistance genes, not
least those conferring resistance towards sulfonamides and quinolones [11, 20]. To elucidate
the phenotypic resistance we performed culturing of bacteria from two Indian lake sediment
samples (Kazipally Lake and Azanikunta tank, located in the Patancheru area) and two
Swedish reference lake sediment samples (Axlemosse and Härlandatjärn, located in the
Gothenburg area). Serial dilutions of the samples were plated on agar plates containing
ciprofloxacin (a quinolone) or sulfamethoxazole (a sulfonamide) as well as plates without
antibiotics. The result of the plating showed a considerably higher frequency of ciprofloxacinand sulfamethoxazole-resistant bacteria in the two Indian lakes compared to the two Swedish
lakes (Fig. 3).
14
Bacterial growth in the presence of antibiotics
Frequency (resistant vs total CFU)
1
0,9
0,8
0,7
0,6
0,5
0,4
0,3
0,2
0,1
0
Härlandatjärn
Axlemosse
Ciprofloxacin 2 ug/ml
Kazipally lake
Asanikunta tank
Sulfamethoxazole 100 ug/ml
Fig. 3. Percentage ciprofloxacin- and sulfamethoxazole-resistant bacteria in sediment samples from
two Indian lakes (Kazipally lake and Azanikunta tank), which are subjected to antibiotic-pollution,
and two Swedish reference lakes (Härlandatjärn and Axlemosse).
4.2
Capture of plasmids containing sulfamethoxazole or ciprofloxacin resistance genes
Since the two Indian lakes contain a high proportion of sulfamethoxazole- and ciprofloxacinresistant bacteria we conducted exogenous plasmid capture experiments in order to search for
resistance plasmids in these sediment samples. In the first plasmid capture experiment we
used E. coli as recipient for ciprofloxacin- and sulfamethoxazole-resistance from
environmental bacteria. After mating on filters, only the E. coli-Azanikunta mixture gave rise
to colonies on selection plates containing ciprofloxacin (Table 1), but the colonies did not
look like typical E. coli colonies and they did not survive a transfer to new ciprofloxacincontaining plates. The colonies on the sulfamethoxazole-containing selection plates with the
E. coli-Azanikunta were likewise transferred to a new sulphamethoxazole-containing plate.
However, after transfer it was obvious that these isolates did not emit a fluorescent signal, as
15
true E. coli transconjugants should. In contrary, resulting colonies from the E. coli-Kazipally
mixture on sulfamethoxazole-containing selection plates did survive transfer and emitted a
fluorescent signal as the E. coli recipient (Table 1). The potential transconjugants were
acquired at a frequency of 3.5×10-6 (number of transconjugants per total number of recipient
cells).
Selection of transconjugants
Determination of
total number of
recipients
RKc&
Ciprofloxacin
0,2 µg/ml
CFU/ml
B
B
B
RKc&
Sulfamethoxazole
100 µg/ml
CFU/ml
B
9×103
B
Escherichia coli
B
DL
9×1010
E. coli & Kazipally
B
3.5×105
1×1011
8×105
6.5×105
B
B
DL
1.1×1011
Kazipally
Azanikunta
Härlandatjärn
E. coli & Azanikunta
E Coli & Härlandatjärn
RKc
CFU/ml
Table 1. Numbers of colonies on the different plates from the first plasmid capture experiment.
R = rifampicin 50 µg/ml, K = kanamycin 50 µg/ml, c = cycloheximide 100 µg/ml
= blank - no growth on the plate, DL = dead lawn of bacteria - no growth on the plate
B
Since no ciprofloxacin-resistant E. coli transconjugants were acquired in the first plasmid
capture experiment, three new recipients were used (P. putida, A. tumefaciens and A. baylyi)
in a second experiment to extend the search for transferable plasmids containing ciprofloxacin
resistance genes. Although the P. putida strain that was used as recipient, according to earlier
MIC determinations, should be sensitive to ciprofloxacin at a concentration well below 0.2
µg/ml (concentration used in the selection plates) it formed several colonies on the
ciprofloxacin-containing control plate (Table 2). The plates with the P. putida-Kazipally
16
mixture and the P. putida alone contained equally many colonies, indicating that there were
mainly P. putida mutants and not P. putida transconjugants living on the selection plate.
Similar results were obtained for the plates with the P. putida-Härlandatjärn mixture. The P.
putida-Azanikunta mixture on the other hand contained significantly fewer surviving recipient
bacteria after incubation on plates without ciprofloxacin, compared to the other P. putidacontaining samples, but still gave rise to a comparable number of colonies on the
ciprofloxacin-supplemented selection plates. Since the Azanikunta sample bacteria alone were
sensitive to ciprofloxacin, the colonies on the P. putida-Azanikunta mixture plate could
represent transconjugants. In addition, the tentative P. putida transconjugants emitted a green
fluorescent signal as expected.
Overall, the outcome when A. baylyi was used as recipient was very similar to that seen for
P. putida. Hence possible A. baylyi transconjugants were picked from the selection plates with
the A. baylyi-Azanikunta mixture.
The only colony observed on the selection plates when using A. tumefaciens as recipient was
from the A. tumefaciens-Azanikunta mixture. This colony was further investigated as a
transconjugant, since the control of A. tumefaciens alone was sensitive to ciprofloxacin.
Unfortunately the fluorescent signal from the A. baylyi and the A. tumefaciens is relatively
weak and it was therefore difficult to separate recipient bacteria from environmental bacteria
based on the signal. In summary, all of the new recipient bacteria, P. putida, A. tumefaciens
and A. baylyi gave rise to possible transconjugants when mixed with the sediment sample
from Azanikunta tank, at frequencies of 5×10-2, >2×10-4, and 1.3×10-1, respectively.
17
Selection of
transconjugants
Determination of total
number of recipients
RKc
Kazipally
Azanikunta
Härlandatjärn
Pseudomonas putida
RKc&
Ciprofloxacin
0.2 µg/ml
CFU/ml
1×104
B
B
1×106
3.3×1010
P. putida & Kazipally
1×106
7.5×1010
P. putida & Azanikunta
5×105
1×107
2.7×106
5×1010
Agrobacterium tumefaciens
B
1.1×1011
A. tumefaciens & Kazipally
B
1.5×1010
1×103
B
B
7×1010
Acinetobacter baylyi
5×105
5×1010
A. baylyi & Kazipally
3×105
5×1010
A. baylyi & Azanikunta
6.5×105
5×106
A. baylyi & Härlandatjärn
1.5×105
1.5×1010
P. putida & Härlandatjärn
A. tumefaciens & Azanikunta
A. tumefaciens & Härlandatjärn
CFU/ml
Table 2. Numbers of colonies on the different plates from the second plasmid capture experiment.
R = 50 µg/ml rifampicin, K = 50 µg/ml kanamycin, c = 100 µg/ml cycloheximide
B = blank - no growth on the plate
4.3
Plasmid isolation
To elucidate whether the isolated possible transconjugants had acquired a plasmid, DNA was
extracted from pelleted cells of each transconjugant using an anion-exchange column-based
plasmid isolation procedure. The plasmid DNA was digested with restriction enzymes before
analysis with gel electrophoresis.
18
The DNA extracted from the E. coli-Kazipally isolates revealed typical restriction fragment
patterns of plasmids (Fig. 4). Isolates 12 and 13 showed identical patterns, the patterns of
isolates 15, 16, 17 and 18 were all unique, and isolates 14, 19, 20, 21 and 22 did all show
restriction patterns as if holding the same type of plasmid. In summary, a total of six different
restriction fragment patterns were found, indicating the presence of six different plasmids.
Fig. 4. DNA extracted with a plasmid DNA isolation procedure from 11 possible sulfamethoxazoleresistant E. coli transconjugants (named 12-22) and the E. coli recipient (EC) digested with restriction
enzymes before loaded onto the gel. Underlined wells contain undigested DNA. The well marked with
“L” consists a GeneRuler™ 1kb Plus DNA ladder.
DNA isolated with the plasmid extraction method did not show any obvious restriction
fragment patterns of plasmids when suspected transconjugants from the P. putida-Azanikunta
mixtures and the A. baylyi-Azanikunta mixtures were used as starting material (Fig. 5a and
5c). In contrary, DNA from the suspected A. tumefaciens transconjugant did show a
restriction pattern of a plasmid (Fig. 5b).
19
a
b
c
Fig 5. DNA extracted with a plasmid DNA isolation procedure from possible ciprofloxacin-resistant
transconjugants, digested with restriction enzymes before loaded onto the gel. Underlined wells
contain undigested DNA. a; wells 30-32, 49 and 50, 73 and 74 represent seven potential P. putida
transconjugants, wells named PP contain a P. putida recipient. b; wells named 38 contain a potential
A. tumefaciens transconjugant and wells named AT contain the A. tumefaciens recipient. c; wells 34,
35, 37, 59, 61, 68 and 71 represent seven potential A. baylyi transconjugants, wells named AB contain
a A. baylyi recipient. Wells named L in a and b consists a GeneRuler™ 1kb Plus DNA ladder.
4.4
Detection of gfp-construct by PCR
Some of the potential transconjugants could not undisputedly be separated from
environmental bacteria based on the green fluorescent signal. Therefore a PCR assay with gfp
construct-specific primers was applied, using purified total DNA from the potential
transconjugants. Analysis with gel electrophoresis revealed that all of the investigated
transconjugants from the E. coli-Kazipally and the P. putida-Azanikunta mixtures gave rise to
20
the same 600 kb band as the recipient controls, indicating the presence of the gfp construct.
Likewise, the investigated transconjugants from the A. baylyi-Azanikunta mixture showed a
700 bp band as in the A. baylyi recipient control, also indicating the presence of a gfp
construct (Fig. 6a, 6b, 6c and 6d). However, the single suspected transconjugant from the A.
tumefaciens-Azanikunta mixture did not give rise to the 600 bp band seen in the recipient
control; consequently the isolate does not contain the gfp-construct which indicates that it is a
false positive transconjugant (Fig. 6b).
Fig. 6. PCR detecting gfp-constructs in potential transconjugants.
a; EC: gfp-positive E. coli recipient; 12, 15-18 and 20: potential
sulfamethoxazole-resistant E. coli transconjugants; NC: gfpnegative E. coli control. b; AT: gfp-positive A. tumefaciens; 38:
potential ciprofloxacin-resistant A. tumefaciens transconjugant. c;
PP: gfp-positive P. putida; 30, 49, 50 and 74: potential
ciprofloxacin-resistant P. putida transconjugants. d; 34 and 37:
Potential ciprofloxacin-resistant A. baylyi transconjugants; AB:
gfp-positive A. baylyi. Wells named L consist a GeneRuler™ 1kb
Plus DNA ladder (Fermentas®).
d
21
4.5
Antibiotic susceptibility testing
As plasmids are known to often carry resistance to more than one antibiotic [17, 21, 22] the
minimal inhibitory concentrations (MICs) of various antibiotics for the supposed
transconjugants were investigated by Etests®.
The ciprofloxacin, ampicillin, ceftazidime, sulfamethoxazole, co-trimoxazole, tetracycline,
gentamicin and azithromycin MICs were determined for the potential E. coli transconjugants.
As expected, the sulphamethoxazole MIC was significantly elevated for the transconjugants,
with at least an 11-fold change in resistance, compared to the E. coli recipient. A moderate
increase in co-trimoxazole was also observed for three of the transconjugants. However, the
MICs of the other investigated antibiotics were very similar for the transconjugants and the
recipient control (Table 3).
Cip
(0.002-32
µg/mL)
Amp
(0.016256
µg/mL)
4
Cef
(0.016256
µg/mL)
0.19
Sul
(0.0641024
µg/mL)
64-96
Co-t
(0.00232
µg/mL)
0.064
Tet
(0.016256
µg/mL)
1.5
Gen
(0.0641024
µg/mL)
0.064
Azi
(0.016256
µg/mL)
1
0.016
E.
coli
0.016
4
0.19
>1024
0.094
1.5
0.064
1
12
0.016
4
0.19
>1024
0.047
1
0.064
1
14
0.016
4
0.19
>1024
0.125
1
0.094
0.50
15
0.016
3
0.19
>1024
0.064
0.75
0.064
1
16
0.012
4
0.19
>1024
0.125
1.5
0.094
1
17
0.016
4
0.19
>1024
0.25
1.5
0.064
0.75
18
0.012
3
0.19
>1024
0.064
1
0.064
0.50
20
Table 3. MIC determinations by Etests® of potential E. coli transconjugants (named 12, 14-18 and
20) and the E. coli recipient. Cip = ciprofloxacin, Amp = ampicillin, Cef = ceftazidime, Sul =
sulfamethoxazole, Co-t = co-trimoxazole, Gen = gentamicin, Azi = azithromycin.
The believed ciprofloxacin-resistant A. tumefaciens transconjugant was indeed more resistant
to ciprofloxacin compared to the A.tumefaciens recipient, but the resistance, more than a
1000-fold increase in MIC compared to the recipient, was too high to be considered plasmid-
22
borne (Table 4) [14]. This isolate also showed increased MICs for ampicillin and tetracycline
compared to the recipient control.
Cip
Amp
Tet
(0.002-32 µg/mL)
(0.016-256 µg/mL)
(0.016-256 µg/mL)
0.016
0.75
0.064
A. tumefaciens
>32
256
0.25
38
Table 4. MIC determinations by Etests® of a potential A. tumefaciens transconjugant (38) and the A.
tumefaciens recipient. Cip = ciprofloxacin, Amp = ampicillin, Tet = tetracycline
For the potential P. putida transconjugants, the ciprofloxacin, ampicillin, ceftazidime, cotrimoxazole, tetracycline, gentamicin and azithromycin MICs were investigated. The
suspected transconjugants were indeed more resistant to ciprofloxacin compared to the P.
putida recipient. The elevations in ciprofloxacin MIC are of such magnitude that they are
possibly due to acquisition of plasmids [13]. Furthermore several of the potential P. putida
transconjugants also showed a higher resistance to ceftazidime, tetracycline, gentamicin and
azithromycin compared to the P. putida recipient (Table 5). However, we could not observe
more than a ten-fold increase in MIC for any of the antibiotics.
Cip
(0.002-32
µg/mL)
Amp
Cef
Co-t
Tet
Gen
Azi
(0.016(0.016(0.002- (0.016- (0.064- (0.016256
256
32
256
1024
256
µg/mL)
µg/mL) µg/mL) µg/mL) µg/mL) µg/mL)
0.032
>256
1
>32
5
0.25
32
P. putida
1.5
>256
6
>32
24
4
30
>256
1.5
>256
8
>32
16
3
31
>256
2
>256
1.5
>32
12
0.38
128
49
1.5
>256
2
>32
3
0.064
64
50
0.75
>256
1.5
>32
6
0.5
128
51
1.5
>256
4
>32
16
1
73
>256
1
>256
4
>32
48
1
74
>256
Table 5. MIC determinations by Etests® of potential P. putida (30-31, 49-51 and 73-74)
ciprofloxacin-resistant transconjugants and the P. putida recipient. Cip = ciprofloxacin, Amp =
ampicillin, Cef = ceftazidime, Co-t = co-trimoxazole, Tet = tetracycline, Gen = gentamicin, Azi =
azithromycin.
23
Finally, seven of the suspected A. baylyi transconjugants were investigated. MIC
determinations were made for the same classes of antibiotics as for the suspected P. putida
and E. coli transconjugants. The assumed A. baylyi transconjugants showed increased
ciprofloxacin resistance in the range of possibly being plasmid-borne. In addition they had an
elevated resistance to all of the investigated antibiotics, except for gentamicin, compared to
the recipient strain.
Cip
(0.002-32
µg/mL)
Cef
(0.016-256
µg/mL)
Tet
(0.016-256
µg/mL)
Azi
(0.016-256
µg/mL)
Co-t
(0.002-32
µg/mL)
Gen
(0.0641024
µg/mL)
0.125
2
0.75
0.38
0.19
0.125
34
1
8
6
1.5
0.50
0.25
35
1
6
6
1
0.38
0.25
37
1.5
6
6
1
0.25
0.125
59
1
6
6
2
0.38
0.094
61
1.5
6
8
0.75
0.50
0.125
68
1
6
8
1.5
0.38
0.125
71
1
6
8
1.5
0.38
0.125
A. baylyi
Table 6. MIC determinations by Etests® of potential A. baylyi ciprofloxacin-resistant transconjugants
and the A. baylyi recipient. Cip = ciprofloxacin, Cef = ceftazidime, Tet = tetracycline, Azi =
azithromycin Co-t = co-trimoxazole, Gen = gentamicin.
4.6
MALDI-TOF MS
In order to validate that the suspected transconjugants were of the expected species we
analyzed ten of the P. putida transconjugants and the single A. tumefaciens transconjugant
with MALDI-TOF MS, which identifies bacterial isolates based on peptide mass
fingerprinting.
These analyses, which could identify the recipients as P. putida and A. tumefaciens,
confirmed that the P. putida transconjugants were of the expected species. However, the
suspected A. tumefaciens transconjugant was identified as Ochrobactrum anthropi, which is
24
in accordance with results above, indicating a false positive during the selection of
transconjugants.
5 Discussion
In this study we found that; sediment samples collected from two lakes in an antibioticpolluted area in India contained a higher percentage of antibiotic resistant bacteria than the
two Swedish control lakes, which were most likely not subjected to any significant
anthropogenic antibiotic-pollution. The environmental bacteria in the Indian sediment
samples were furthermore capable of transferring plasmids conferring sulfamethoxazoleresistance to E. coli, and possibly MGEs containing ciprofloxacin-resistance, as well as
resistance to several other classes of antibiotics, to P. putida and A. baylyi.
The magnitude of resistance-genes found in an earlier study of sediment samples from the
Patancheru area [11] clearly indicate a selection pressure promoting these genes, most likely
caused by the emissions of antibiotics from local drug manufacturers. The increase in
phenotypic ciprofloxacin- and sulfamethoxazole-resistance of the bacteria in the Indian
sediment samples (Kazipally lake and Azanikunta tank), compared to the Swedish
(Härlandatjärn and Axlemosse), further indicates that antibiotic resistant bacteria are selected
in these environments. This corresponds to the fact that antibiotic resistance develops in
bacteria exposed to antibiotics. On the other hand it is not surprising that also the bacterial
flora of the Swedish lakes present some ciprofloxacin- and sulfamethoxazole resistance since
it is known that intrinsic resistance to almost any class of antibiotics can be found in
environmental bacteria [4, 23-25]. Furthermore sulfamethoxazole is a sulfonamide, one of the
first antimicrobial drugs and used for over 70 years, why it is most likely widely spread in the
environment, promoting the selection of sulfonamie-resistant bacteria [26].
25
In the first plasmid capture experiment, using Escherichia coli as recipient, the only mixture
that produced transconjugants was the E. coli-Kazipally mixture. These transconjugants
endured transfer to new sulfamethoxazole-containing plates, they emitted the green
fluorescent signal as the E. coli recipient does when exposed to UV-light, and they were
producing the right product in the PCR assay with gfp construct-specific primers. Finally, and
most importantly, after plasmid isolation they show typical and clear restriction fragment
patterns of plasmids when treated with restriction enzymes and analyzed with gel
electrophoresis. These findings clearly indicate that transconjugants have been acquired,
although no other resistance than sulfamethoxazole-resistance has yet been found to be borne
by the plasmids. Some of the isolates did show a discreet increase in co-trimoxazole
resistance, most likely due to the increased resistance to sulfamethoxazole, but only a total
sequencing of the plasmids can reveal their entire content. Sequencing would as well
elucidate whether or not the plasmids are carrying any genes corresponding to the resistance
genes found in metagenomies from similar samples in a prior study [11].
Concerning the E. coli-Azanikunta mixture in the first plasmid capture experiment, it gave
rise to colonies that did not survive being transferred to new ciprofloxacin-containing plates.
Firstly the colonies did not look like typical E. coli colonies, and secondly the recipient E. coli
evidently did not survive on the recipient-count plate together with the Azanikunta sample.
Hence, most probably the surviving colonies on the selection plates were environmental
bacteria from the Azanikunta sample, which managed to survive on selection plates when
cultured together with the E. coli recipient but not when cultured alone on the same plates.
The reason why the environmental bacteria are not present on the recipient-count plate
(containing neither ciprofloxacin nor sulfamethoxazole) is most likely that the samples were
more diluted when cultured on those plates compared to when cultured on selection plates.
The fact that the same mixture produced non-fluorescent bacteria, surviving transfer to a new
26
sulfamethoxazole-supplemented plate, again showed the presence of bacteria in the
Azanikunta sample that were able to survive on selection plates.
In the second plasmid capture experiment new recipients were used to generate ciprofloxacinresistant transconjugants since the E. coli in the first experiment did not. It can be speculated
that the E. coli were not compatible with the possible donors to achieve conjugation, or that
the mating method used was not appropriate.
The first problem encountered in the second experiment was that the P. putida recipient was
not sensitive enough and formed colonies on the ciprofloxacin-supplemented selection plate,
showing that the P. putida easily mutates and gains antibiotic-resistance under selection
pressure as the closely related P. aeruginosa [27], making it hard to distinguish a mutated P.
putida from a transconjugant. However, the P. putida-Azanikunta mixture showed
considerably fewer recipient bacteria after incubation on recipient count plates, compared to
the other P. putida-containing samples and mixtures, and still gave rise to a comparable
number of colonies on the ciprofloxacin-supplemented selection plates. In other words, there
were a much higher proportion of viable ciprofloxacin-resistant bacteria in the P. putidaAzanikunta mixture compared to other P. putida samples, which leads us to believe that the
colonies on these selection plates were transconjugants. In addition, the above mentioned
problem with survival of environmental bacteria from the Azanikunta sample on selection
plates could in this case be excluded since the P. putida-Azanikunta colonies emitted the
green fluorescent signal as the recipient P. putida. The gfp-construct specific PCR assay and
the MALDI-TOF MS further confirmed the suspected transconjugants as being P. putida.
After attempting plasmid isolation and digestion of the product with restriction enzymes no
obvious restriction fragment patterns of plasmids were found. Since there were no patterns
found, the surviving P. putida-Azanikunta colonies would have been considered mutated,
ciprofloxacin-resistant, recipients if it was not for the antibiotic susceptibility testing; the MIC
27
determinations of suspected transconjugants displayed both sufficiently low resistance to
ciprofloxacin to possibly be considered plasmid-borne as well as a considerably higher
tolerance to ceftazidime, tetracycline, gentamicin and azithromycin in many of the isolates
compared to the P. putida recipient (Table 5). The ciprofloxacin-resistance, together with the
increase in resistance to several of the investigated antibiotics, argues for an acquisition of a
mobile genetic element (MGE) carrying several different antibiotic resistance genes, rather
than chromosomal mutations. Although the increase in ciprofloxacin-resistance from 0,032 to
0,75-2 µg/mL is slightly higher than found in most other studies investigating plasmidmediated quinolone resistance, in this study we used ciprofloxacin as the selective antibiotic
when performing the plasmid capture, which can select for higher resistance in recipients
[16].
In general, the outcomes when A. baylyi and P. putida were used as recipients were very
similar. The A. baylyi-Azanikunta mixture also generated a high proportion of viable
ciprofloxacin-resistant bacteria compared to the other A. baylyi samples and consequently
they were considered as transconjugants. In support, the gfp construct-specific PCR assay
confirmed the suspected transconjugants as being directly related to the recipient bacteria,
since they produced the right product. However, like for the P. putida transconjugants, we
were not able to isolate any obvious plasmid DNA from the suspected A. baylyi
transconjugants, but the antibiotic susceptibility pattern again suggested acquisition of MGE
carrying several resistance genes. In summary, acquisition of resistance to several different
classes of antibiotics, when under the selection pressure of just one, makes it likely that the
cause would be acquisition of a MGE. However, at this point it cannot be ruled out that the
tentative P. putida and A. baylyi transconjugants represent mutated recipient cells. Mutations
in non-selective efflux pumps might explain the observed fold-changes in antibiotic resistance
for the assumed transconjugants. Further, the reason why the P. putida- and A. baylyi 28
Azanikunta mixtures gave rise to such an high proportion of ciprofloxacin resistance among
the surviving bacteria could be due to quinolone antibiotics in the Azanikunta sample (not
washed away during the preparation of donor cells), which would kill off the great majority of
the recipient cells in the mixture.
Using A. tumefaciens as recipient only yielded a single colony on the A. tumefaciensAzanikunta selection plate and none in the other mixtures. As with the A. baylyi, the gfpsignal generated by A. tumefaciens is weak making it very hard to discriminate between a
recipient and environmental bacteria and therefore this single colony was further investigated
as a suspected transconjugant. Plasmid isolation and digestion with restriction enzymes
yielded the clearest restriction fragment patterns for plasmids of all the investigated isolates in
the second plasmid capture experiment. However, the PCR with gfp-construct specific
primers did not yield the expected product and the ciprofloxacin MIC was too high to be due
to plasmid borne resistance only. Finally the MALDI-TOF MS assay identified the isolate as
being Ochrobactrum antropi, a species that according to previous studies are found to carry
resistance to various antibiotics and having a MIC value of tetracycline in the same range as
the isolate found in this study [28].
5.1
Methodological considerations
Although our results suggests that P. putida and A. baylyi transconjugants have been
generated, no obvious plasmid DNA was isolated from these isolates. There are many
possible explanations for this:
First, a different approach than the anion-exchange column used in this experiment might be
needed. Other available ways are to use a silica-based spin column [25], a procedure that has
been successfully used for plasmid isolation from P. putida and Pseudomonas species by
other groups [26]. Another method of plasmid isolation is phenol-chloroform extraction.
29
Secondly, it is possible that there have been acquisition of non-plasmid MGE, such as
integrative and conjugative elements (ICEs). ICEs are self-transmissible MGEs that can reside
in the chromosomes of both gram-positive and –negative hosts. They encode the machinery
for its own conjugation, much like conjugative plasmids. The ICEs are excised from the host
chromosome during certain conditions, after which they circularize and replicated before
transferring themselves to new hosts by the conjugation machinery [29]. Like plasmids, they
can carry several genes for antibiotic resistance. To distinguish an ICE from a plasmid a PCR
with primers for conserved regions of ICE-specific genes, if any, can be performed. An
alternative, but more time consuming way of distinguishing ICEs from plasmids is to perform
a total sequencing of the recipient’s and the transconjugant’s genome to be able to find
acquired genetic elements by comparison.
If neither the potential P. putida nor the A. baylyi transconjugants are carrying any plasmids
containing ciprofloxacin-resistance but rather show an increased resistance due to
chromosomal mutations causing changes in for example antibiotic target enzymes and/or
unspecific efflux-pump activities, it can be argued that the approach used in this thesis is not
suitable for capturing of plasmid-mediated quinolone-resistance. However, conjugation of
qnr-containing plasmids, at least from one E. coli to another, have however proven to be
possible by other groups [30], where rifampicin-resistant E. coli were used as recipients. In
our experiment it is inbuilt that we do not know who the donors are; if we did we possibly
could have adapted the plasmid capture experiment accordingly. However, antibiotic
resistance plasmids have been captured by other groups using unknown donors originating
from piggery manure, sewage and faeces, with the same plasmid capture method used in this
study [19, 31]. Transposon-aided capture (TRACA) of plasmids is another method available
for capturing of plasmids from a complex sample like the sediment samples of our study is. In
prior studies this approach have allowed gaining of plasmids from metagenomic DNA
30
extracts and following maintenance and selection in an E. coli host [32, 33]. This method does
however include electrotransformation to transfer the found plasmids to the recipient bacteria,
which do not represent a natural way of plasmid transfer requested to address the aim of this
study.
5.2
Future studies
Sequencing of a selection of isolated plasmids should be performed to get an exact picture of
their structure and which antibiotic resistance genes they are carrying. In addition new
approaches for plasmid isolation from the potential P. putida and the A. baylyi
transconjugants have to be evaluated in order to possible isolate plasmid DNA from these
cells. This could be conducted with a silica spin column or by phenol-chloroform extraction.
Alternatively, whole-genome sequencing can be conducted of the suspected transconjugants
and the recipients in order to look for acquired MGEs. Furthermore, the MIC determinations
should be repeated for verification of the results. In the bigger picture, data that is still missing
is of antibiotic-resistance as a clinical problem in Patancheru and nearby areas. To our
knowledge no such studies have been done nor are performed at this moment. It would be
informative to investigate what the resistance-situation looks like in these areas compared to
the one in Europe or other parts of India. Moreover, findings of the same plasmids and genes
in the investigated sediment samples and resistant strains found in the clinic would further
link the clinical situation with the critical environmental situation in these areas. In line with
this our group is right now conducting a study where the presence of antibiotic resistance
genes in the gut micro flora is compared between individuals from antibiotic-polluted and
non-polluted Indian villages.
31
6 Conclusions and implications
The percentage of phenotypic ciprofloxacin- and sulfamethoxazole-resistance in
environmental bacteria were shown to be considerably higher in the sediment from the two
Indian lakes, located in a heavily antibiotic-polluted environment, than in the two Swedish
control lakes. Furthermore plasmids carrying sulfamethoxazole-resistance were found to be
transferable to E. coli from environmental bacteria from one of the Indian sediment samples.
Most likely, MGEs carrying ciprofloxacin, ceftazidime, tetracycline, gentamicin and
azithromycin resistance have been transferred to P. putida from environmental bacteria in
another Indian sediment sample. The same sample did as well provide the A. baylyi recipient
with resistance to ciprofloxacin, ceftazidime, tetracycline, co-trimoxazole and azithromycin,
but as for the potential P. putida transconjugants no plasmids have yet been isolated. Still the
findings poses a risk to people exposed to antibiotic-polluted environments since commensal
bacteria, or pathogens, might gain antibiotic-resistance via horizontal gene transfer from the
antibiotic resistant environmental bacteria. Resistant bacteria can furthermore be transferred
from human to human with a risk of worldwide spread. It is of utmost importance to stop such
antibiotic-pollution to the environment by legislation, in order to limit further antibioticresistance to evolve in pathogens or commensal bacteria. Furthermore, studies should be done
to elucidate whether plasmids found in this study are carried by clinically important
pathogenic strains found in the surrounding area.
32
Populärvetenskaplig sammanfattning
I Patancheru i Indien är naturen svårt förorenad på grund av flera industriers verksamhet i
området. Bland annat släpper läkemedelstillverkare ut stora mängder antibiotika och tidigare
studier har visat att det i sedimentprover från de förorenade miljöerna finns mängder av
bakteriella gener för antibiotikaresistens, speciellt mot de två antibiotikasorterna kinoloner
och sulfonamider [10, 11]. Vi har utfört en studie för att se om den typen av gener man funnit
även används av de miljöbakterier som finns i området, detta undersöktes genom att
kontrollera om bakterierna överlevde trots att de odlades i medier som innehöll just kinoloner
och sulfonamider. Vi undersökte också om resistensen i så fall var överförbar till andra
bakterier, inklusive bakterier som liknar sådana som kan ge upphov till sjukdomar hos
människor (patogener).
När man jämförde sedimentprover från två sjöar i området kring Patancheru med
sedimentprover från två svenska sjöar stod det klart att en betydligt högre andel av bakterierna
från de indiska proverna var resistenta mot det undersökta kinolonantibiotikumet och
sulfonamidantibiotikumet. Generna för resistensen i de indiska miljöbakterierna var dessutom
överförbara till andra bakterier, till exempel tog en typ av E. coli (andra typer av E. coli kan
till exempel orsaka urinvägsinfektion) upp resistens mot ett sulfonamidantibiotikum (detta
används i kombination med ett annat antibiotikum mot urinvägsinfektioner) genom att ta emot
ett DNA-fragment från indiska miljöbakterier. När bakterierna P. putida och A. baylyi
(släktingar till bakteriearter vilka främst drabbar redan sjuka människor inneliggande på
sjukhus) blandades med bakterier från de indiska miljöerna utvecklade de resistens mot
kinolonantibiotikumet och dessutom mot flera andra typer av antibiotika, troligtvis också
genom att ha tagit upp DNA från de indiska miljöbakterierna.
Fynden är viktiga av två anledningar; dels för att de visar att utsläpp av antibiotika i miljön
påverkar bakteriefloran i naturen. Dessutom visar de att miljöbakterier på grund av detta kan
33
bidra till spridningen av resistensgener. Antibiotikaresistensgener sprids inte bara mellan
bakterier som alla är en del av den mänskliga bakteriefloran utan även mellan dessa bakterier
och bakterier ute i naturen. För övrigt ger fynden incitament till en ökad miljömedvetenhet
vid läkemedelstillverkning och upphandling av läkemedel. Eftersom fynden talar för att
antibiotikaresistens uppkommer i miljöbakterier på grund av utsläpp av antibiotika och
dessutom kan spridas till humana bakterier kan ett stopp av utsläppen alltså kunna vara ett
bidrag till att vi även i fortsättningen kan använda antibiotika i kampen mot bakteriella
infektioner.
Att många patogener under de senaste årtiondena inte längre tillintetgörs av antibiotika är ett
stort problem inom vården. Det kan ge förödande konsekvenser då till exempel en vanlig
bakterieorsakad lunginflammation kan bli dödlig om antibiotikan som används inte har någon
effekt mot bakterierna [34]. Hos bakterier som tidigare varit känsliga för ett visst antibiotika
kan resistens utvecklas via två vägar: Antingen genom att en bakterie har muterat – att dess
utseende eller funktion slumpvis har ändrats – så att antibiotikans mål i bakterien inte längre
nås; detta leder till att just denna bakterie överlever och förökar sig under en
antibiotikabehandling. Ett annat sätt för bakterier att bli resistenta mot antibiotika är genom
att ta emot resistensgener från andra bakterier. Detta kan ske exempelvis genom att bakterien
tar upp DNA från en död bakterie innehållande resistensgener eller genom att plasmider,
cirkulära, genbärande DNA-fragment som finns i bakterien utöver bakteriens kromosom,
skickas mellan bakterier och ger dem antibiotikaresistens [14].
Som sagt utvecklas resistens i bakterier då de utsätts för antibiotika, detta kan även
åstadkommas ute i vår miljö, där det finns miljarder olika bakterier, då antibiotika av olika
anledningar släpps ut. Man har länge varit rädd för att det sker stora utsläpp av antibiotika till
miljön från exempelvis sjukhus, men på senare år har det visat sig att även
34
läkemedelsindustrin kan släppa ut stora mängder aktiva läkemedelssubstanser inklusive
antibiotika [9].
Huvudexperimentet i den här studien syftade till att studera om det hos miljöbakterierna fanns
plasmider innehållande antibiotikaresistensgener som var överförbara till andra bakterier.
Detta utfördes genom att en känd bakterie, exempelvis en E. coli som bär på resistens mot
antibiotikasorterna kanamycin och rifampicin, blandades med sedimentslam (innehållande
miljöbakterier) – målet var att få dessa E. coli att ta upp ytterligare resistens från bakterierna i
sedimentet. De E. coli som tog upp ny resistens sållades fram genom att odla blandningen på
så kallade agarplattor (plattor av gelé som bakterier trivs att växa på) innehållande kanamycin,
rifampicin och ytterligare ett antibiotikum, till exempel sulfametoxazol – endast de E. coli
som tagit upp sulfametoxazolresistens från miljöbakterierna kunde överleva på agarplattorna.
I ytterligare experiment undersöktes även om de överlevande E. coli hade tagit upp plasmider,
samt om eventuella plasmider bar på resistens för fler antibiotika.
För vissa av mottagarbakterierna kunde vi i denna studie inte avgöra om de bar på plasmider
eller ej, därför är ytterligare studier nödvändiga för att med andra metoder försöka rena fram
eventuella plasmider.
35
Acknowledgements
Special thanks for the help and support from my supervisor Carl-Fredrik Flach and cosupervisor Joakim Larsson. Also thanks to co-workers Carolin Rutgersson, Anna Johnning
and Lina-Maria Gunnarsson for patience and help with various questions concerning
laboratory work, the usage and mysteries of End Point, Microsoft Excel and Power Point, and
how to compile a scientific report. Further, thanks to “Fredrik” at Klinisk bakteriologi
(Laboratoriemedicin, The Sahlgrenska University Hospital) for help with collecting
information about manufacturers of culturing media used. Also, many thanks to Li Jin Yang
who, without any personal gain, was willing to function as last minute stand-in opponent.
Last, but not least, thanks to my mother Gunilla Nilsson and to my boyfriend Daniel
Lundkvist for help with making the popular scientific summary understandable, and for their
overall support.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Jernberg, C., et al., Long-term impacts of antibiotic exposure on the human intestinal
microbiota. Microbiology, 2010. 156(Pt 11): p. 3216-23.
Tortora, G.J., B.R. Funke, and C.L. Case, Microbial Genetics, in Microbiology, an
introduction. 2010, Pearson Benjamin Cummings: San Francisco. p. 234-240.
Goossens, H., et al., Outpatient antibiotic use in Europe and association with resistance: a
cross-national database study. Lancet, 2005. 365(9459): p. 579-87.
Aminov, R.I. and R.I. Mackie, Evolution and ecology of antibiotic resistance genes. FEMS
Microbiol Lett, 2007. 271(2): p. 147-61.
Baquero, F., J.L. Martinez, and R. Canton, Antibiotics and antibiotic resistance in water
environments. Curr Opin Biotechnol, 2008. 19(3): p. 260-5.
Zuccato, E., et al., Source, occurrence and fate of antibiotics in the Italian aquatic
environment. J Hazard Mater, 2010. 179(1-3): p. 1042-8.
Watkinson, A.J., et al., The occurrence of antibiotics in an urban watershed: from
wastewater to drinking water. Sci Total Environ, 2009. 407(8): p. 2711-23.
Larsson, D.G.J., [Emissions from the pharmaceutical industry affects the environment.
Antibiotic emissions also jeopardizes our own health]. Läkartidningen, 2012. 109(14-15): p.
750-3.
Phillips, P.J., et al., Pharmaceutical formulation facilities as sources of opioids and other
pharmaceuticals to wastewater treatment plant effluents. Environ Sci Technol, 2010.
44(13): p. 4910-6.
Larsson, D.G.J., C. de Pedro, and N. Paxeus, Effluent from drug manufactures contains
extremely high levels of pharmaceuticals. J Hazard Mater, 2007. 148(3): p. 751-5.
Kristiansson, E., et al., Pyrosequencing of antibiotic-contaminated river sediments reveals
high levels of resistance and gene transfer elements. PLoS One, 2011. 6(2): p. e17038.
36
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Enne, V.I., et al., Persistence of sulphonamide resistance in Escherichia coli in the UK
despite national prescribing restriction. Lancet, 2001. 357(9265): p. 1325-8.
Strahilevitz, J., et al., Plasmid-mediated quinolone resistance: a multifaceted threat. Clin
Microbiol Rev, 2009. 22(4): p. 664-89.
Hopkins, K.L., R.H. Davies, and E.J. Threlfall, Mechanisms of quinolone resistance in
Escherichia coli and Salmonella: recent developments. Int J Antimicrob Agents, 2005. 25(5):
p. 358-73.
Rodriguez-Martinez, J.M., et al., Detection of the plasmid-mediated quinolone resistance
determinant qnr among clinical isolates of Klebsiella pneumoniae producing AmpC-type
beta-lactamase. J Antimicrob Chemother, 2003. 52(4): p. 703-6.
Martinez-Martinez, L., et al., Interaction of plasmid and host quinolone resistance. J
Antimicrob Chemother, 2003. 51(4): p. 1037-9.
Martinez-Martinez, L., A. Pascual, and G.A. Jacoby, Quinolone resistance from a
transferable plasmid. Lancet, 1998. 351(9105): p. 797-9.
van der Bij, A.K. and J.D. Pitout, The role of international travel in the worldwide spread of
multiresistant Enterobacteriaceae. J Antimicrob Chemother, 2012.
Heuer, H., et al., Gentamicin resistance genes in environmental bacteria: prevalence and
transfer. FEMS Microbiol Ecol, 2002. 42(2): p. 289-302.
Fick, J., et al., Contamination of surface, ground, and drinking water from pharmaceutical
production. Environ Toxicol Chem, 2009. 28(12): p. 2522-7.
Villa, L., et al., Multiple-antibiotic resistance mediated by structurally related IncL/M
plasmids carrying an extended-spectrum beta-lactamase gene and a class 1 integron.
Antimicrob Agents Chemother, 2000. 44(10): p. 2911-4.
Szczepanowski, R., et al., Antibiotic multiresistance plasmid pRSB101 isolated from a
wastewater treatment plant is related to plasmids residing in phytopathogenic bacteria
and carries eight different resistance determinants including a multidrug transport system.
Microbiology, 2004. 150(Pt 11): p. 3613-30.
Martinez, J.L., Antibiotics and antibiotic resistance genes in natural environments. Science,
2008. 321(5887): p. 365-7.
Silver, L.L., Challenges of antibacterial discovery. Clin Microbiol Rev, 2011. 24(1): p. 71-109.
Bhullar, K., et al., Antibiotic resistance is prevalent in an isolated cave microbiome. PLoS
One, 2012. 7(4): p. e34953.
Gao, P., et al., Occurrence of sulfonamide and tetracycline-resistant bacteria and resistance
genes in aquaculture environment. Water Res, 2012. 46(7): p. 2355-64.
Vojtova, V., et al., Antibiotic utilization and Pseudomonas aeruginosa resistance in
intensive care units. New Microbiol, 2011. 34(3): p. 291-8.
Higgins, C.S., et al., Resistance to antibiotics and biocides among non-fermenting Gramnegative bacteria. Clin Microbiol Infect, 2001. 7(6): p. 308-15.
Wozniak, R.A. and M.K. Waldor, Integrative and conjugative elements: mosaic mobile
genetic elements enabling dynamic lateral gene flow. Nat Rev Microbiol, 2010. 8(8): p. 55263.
Schink, A.K., K. Kadlec, and S. Schwarz, Detection of qnr genes among Escherichia coli
isolates of animal origin and complete sequence of the conjugative qnrB19-carrying
plasmid pQNR2078. J Antimicrob Chemother, 2012. 67(5): p. 1099-102.
Smalla, K., et al., Exogenous isolation of antibiotic resistance plasmids from piggery
manure slurries reveals a high prevalence and diversity of IncQ-like plasmids. Appl Environ
Microbiol, 2000. 66(11): p. 4854-62.
Jones, B.V. and J.R. Marchesi, Transposon-aided capture (TRACA) of plasmids resident in
the human gut mobile metagenome. Nat Methods, 2007. 4(1): p. 55-61.
Warburton, P.J., et al., Isolation of bacterial extrachromosomal DNA from human dental
plaque associated with periodontal disease, using transposon-aided capture (TRACA).
FEMS Microbiol Ecol, 2011. 78(2): p. 349-54.
37
34.
Neidell, M.J., et al., Costs of Healthcare- and Community-Associated Infections With
Antimicrobial-Resistant Versus Antimicrobial-Susceptible Organisms. Clin Infect Dis, 2012.
38