Journal of Integrative Plant Biology 2009
AKINβ1 is Involved in the Regulation of Nitrogen
Metabolism and Sugar Signaling in Arabidopsis
∗
Xiao-Fang Li , Yu-Ju Li, Ying-Hui An, Li-Jun Xiong, Xing-Hua Shao, Yang Wang and Yue Sun
(School of Life Sciences, East China Normal University, Shanghai 200062, China)
Abstract
Sucrose non-fermenting-1-related protein kinase 1 (SnRK1) has been located at the heart of the control of metabolism and
development in plants. The active SnRK1 form is usually a heterotrimeric complex. Subcellular localization and specific
target of the SnRK1 kinase are regulated by specific beta subunits. In Arabidopsis, there are at least seven genes encoding
beta subunits, of which the regulatory functions are not yet clear. Here, we tried to study the function of one beta subunit,
AKINβ1. It showed that AKINβ1 expression was dramatically induced by ammonia nitrate but not potassium nitrate, and
the investigation of AKINβ1 transgenic Arabidopsis and T-DNA insertion lines showed that AKINβ1 negatively regulated
the activity of nitrate ruductase and was positively involved in sugar repression in early seedling development. Meanwhile
AKINβ1 expression was reduced upon sugar treatment (including mannitol) and did not affect the activity of sucrose phosphate synthase. The results indicate that AKINβ1 is involved in the regulation of nitrogen metabolism and sugar signaling.
Key words: AKINβ1; metabolism; nitrate reductase; sucrose phosphate synthase; sugar signaling.
Li XF, Li YJ, An YH, Xiong LJ, Shao XH, Wang Y, Sun Y (2009). AKINβ1 is involved in the regulation of nitrogen metabolism and sugar signaling in
Arabidopsis. J. Integr. Plant Biol. 10.1111/j.1744-7909.2009.00811.x
Available online at www.jipb.net
Sucrose non-fermenting-1-related protein kinase 1 (SnRK1)
is a plant protein kinase homologous to that of SNF1 (Sucrose
Non-fermenting-1) of yeast and AMPK (adenosine monophosphate (AMP) activated protein kinase) of animals (Halford
et al. 2003). The SNF1 family has been implicated in cellular
responses to nutritional and environmental stress. SNF1 is
activated in response to low cellular glucose levels and is
required for the derepression of a battery of genes that are
repressed by glucose (Ronne 1995; Gancedo 1998; Dickinson
et al. 1999; Dobrzyn et al. 2005a, b). It also directly modulates
the phosphorylation state of a number of metabolic enzymes,
including acetyl-CoA carboxylase (Woods et al. 1994), HMGCoA reductase (HMGR) and glycogen synthase (Hardie et al.
1994; Hardie and Pan 2002), and is required for the arrest of
growth and the cell cycle under conditions of glucose deprivation
(Thompson-Jaeger et al. 1991). The mammalian AMPK is
Received 13 Apr. 2008 Accepted 27 Nov. 2008
Supported by the Shanghai Natural Science Foundation (04ZR14039).
∗
Author for correspondence.
Tel: +86 021 6223 3582;
Fax: +86 021 6223 3574;
E-mail: <[email protected]>.
C 2009 Institute of Botany, the Chinese Academy of Sciences
doi: 10.1111/j.1744-7909.2009.00811.x
involved in diverse stress responses (Hardie et al. 1994; Corton
et al. 1995) and has been likened to a cellular fuel gauge
because of activation of AMPK by a high AMP : adenosine
triphosphate (ATP) ratio, which is symptomatic of low cellular
energy levels (Hardie and Carling 1997). SnRK1 is involved in
regulation of metabolism in plants (Purcell et al. 1998; Laurie
et al. 2003), and can phosphorylated and inactivated in vitro
HMGR (Ball et al. 1995; Barker et al. 1996), nitrate reductase (NR) and sucrose phosphate synthase (SPS) (Douglas
et al. 1997; Halford and Hardie 1998), which are three key
biosynthetic enzymes involved in the control of steroids and
isoprenoid compounds synthesis, nitrogen assimilation and sucrose synthesis. The SnRK1 kinases are also implicated in the
transcriptional control of genes involved in carbon metabolism
(Purcell et al. 1998). Furthermore, it has been suggested that
the metabolic alterations mediated by SnRK1 are a component
of antiviral defense (Hao et al. 2003).
In higher eukaryotes, the functional SNF1 form is a heterotrimeric complex, which includes the catalytic subunit SNF1
(AMPKα in animals), the regulatory subunit SNF4 (AMPKγ in
animals) (Schuller and Entian 1987; Celenza and Carlson 1989;
Celenza et al. 1989) and the specification subunit SIP (AMPKβ
in animals) (Yang et al. 1992; Yang et al. 1994; Dyck et al. 1996;
Woods et al. 1996). SNF4 activates the SNF1 kinase in vivo and
in vitro and is essential for maximal kinase activity (Celenza and
Carlson 1989; Woods et al. 1994). SIP subunit is composed of
2 Journal of Integrative Plant Biology
2009
a class of proteins: SIP1, SIP2, GAL83 and AMPKβ. In yeast, it
has been shown that members of the SIP1/SIP2/GAL83 family
play an essential role in the specificity of recognition between
the kinase complex and its target. Moreover the β-subunits also
play an essential role in the subcellular localization of the kinase
complex in yeast and mammals (Vincent et al. 2001; Warden
et al. 2001).
Homologs of SNF4 and the SIP family have now been
identified in plants (Bouly et al. 1999; Kleinow et al. 2000;
Bradford et al. 2003). Genes in maize (Zea mays; ZmAKINβγ-1)
and Arabidopsis (AtSNF4 or AKINβγ) that contained domains
homologous to both the β- and γ-subunits of the SnRK1
complex were also identified (Lumbreras et al. 2001). Thus,
plants contain homologs of all three components common to the
yeast and mammalian SNF1 complexes, and these components
interact in a manner consistent with a heterotrimeric structure
(or a dimeric structure in the case of the βγ-type proteins) based
on the yeast two-hybrid system and in vivo protein interaction
studies (Bouly et al. 1999; Lakatos et al. 1999; Kleinow et al.
2000; Crawford et al. 2001; Ferrando et al. 2001; Lumbreras
et al. 2001). However, the function of most homologs of SNF4
and the SIP family in plants require further elucidation (Polge
and Thomas 2007).
In Arabidopsis, AKINβ1, AKINβ2 and AKINβ3 genes have
been shown to be differentially expressed, suggesting that
SnRK1 proteins could be differentially regulated via interactions
with the targeting β subunits, which are regulated in response
to different signals (Bouly et al. 1999; Gissot et al. 2004).
In Arabidopsis there are at least seven genes encoding beta
subunits (Ferrando et al. 2001). However, the specific function of
different beta subunits is not yet clear. In the present study, using
AKINβ1 transgenic Arabidopsis and AKINβ1 T-DNA insertion
lines, we disclose the role of AKINβ1 in the regulation of activity
of NR and sugar repression in early seedling development. Our
study on the expression of AKINβ1 in response to different sugar
and nitrogen status and concentration also shows that AKINβ1
is involved in the specific regulation of nitrogen metabolism
and sugar signaling. Our results are consistent with the notion
that the plant SNF1-like kinases, in conjunction with various
beta proteins, contribute to the regulation of different growth
responses in response to different signals.
Results
AKINβ1 does not affect the development of Arabidopsis
under normal growth conditions
We got more than 10 transgenic lines overexpressing the
AKINβ1 gene (AKINβ1-OX). The akinβ1 mutant (Salk-008325)
was confirmed that T-DNA was inserted in the first intron
by polymerase chain reaction (PCR) amplification. Reverse
transcription (RT)-PCR verified that the expression of AKINβ1
Figure 1. The expression of AKINβ1 was semi-quantitatively determined by reverse transcription-polymerase chain reaction (RT-PCR).
OX-9-12 and OX2-7 are AKINβ1 overexpression lines. WT, wild type.
is upregulated in AKINβ1-OX plants and reduced significantly in
AKINβ1 T-DNA insertion lines (Figure 1). There were no obvious
differences in phenotype among mutants, AKINβ1-OX plants
and wild type when they were grown under normal conditions.
It indicates that AKINβ1does not affect normal development of
Arabidopsis.
AKINβ1 participates in the sugar signaling in Arabidopsis
Soluble sugar levels have been shown to affect many developmental processes. SnRK1s have been postulated to be induced
by high sucrose concentration or low glucose concentration,
which suggests that these proteins act as part of a regulatory
circuit to allow differential responses to sucrose and glucose
(Halford et al. 2003). We asked if AKINβ1, being one of the
SnRK1 subunits, would affect the response of Arabidopsis to
soluble sugar. Although the AKINβ1-OX plants and mutants
had no noticeable differences in phenotype compared with the
wild type under normal growth conditions, they did show quite
unique phenotypes when they were grown in the presence of
exogenous sugar, such as sucrose or glucose. As previously
reported (Gibson 2005), we also showed that high concentrations of glucose or sucrose inhibited cotyledon expansion, true
leaf formation and root growth of young Arabidopsis seedlings,
and induced anthocyan accumulation resulting in a brown-red
seedling formation. With higher sugar concentrations, a more
severe inhibition of cotyledon expansion, true leaf formation
and root growth of young Arabidopsis seedlings was seen.
However, there was no significant difference among the three
types of plants regarding the inhibition of root growth by both
sugars. The cotyledons of AKINβ1-OX plants were the most
severely retarded by 205 mM sucrose, with 47% of plants
without cotyledons expansion on the fifth day compared with
13% and 2% for wild type and mutant plants, respectively,
(Table 1). Furthermore, AKINβ1-OX plants had almost no noticeable true leaf, but wild type and mutant plants emerged true
leaves with 205 mM sucrose or 278 mM glucose on the eighth
day. No significant differences in the development of leaves
or cotyledons were observed among the wild type, mutant and
AKINβ1-OX plants when they were grown in the presence of
the non-metabolic sugar mannitol. These results suggest that
AKINβ1 modulates leaf and cotyledon shape only in response
to metabolic sugars.
AKINβ1 is Involved in the Regulation of Metabolism
Table 1. Percentage of seedlings with unexpanded cotyledons grown
for 5 d on high concentration sucrose mediuma
Sucrose concentration (mM)
146
205
Mutant
7 ± 1.9
7.5 ± 2.3
Wild type
7 ± 2.3
13 ± 1.7
23 ± 3.7∗
47 ± 5.7∗
AKIN β1-OX
a
Fifty seedlings of each sample were used for the statistical analyses.
The differences of seedlings with un-expanded cotyledons between
the wild type and the mutant/AKINβ1-OX plants were analyzed by
t-test. Significant differences (P < 0.05) are indicated with an asterisk (∗ ).
SPS activity (mg sucrose . h–1 . g–1 FW)
Since SnRK1s regulate the activity of SPS, which is one
of key enzymes in the carbon metabolism, we analyzed the
relationship between the activity of SPS and AKINβ1. There
was no significant difference in SPS activity between the wild
type and the mutant, as analyzed by a t-test (Figure 2).
3
experiment showed that the patterns of the AKINβ1 expression
assayed by AKINβ1::β-D-glucuronidase (GUS) reporter staining
and RT-PCR were the same (compare Figure 3D with 3A, showing AKINβ1 mainly expressed in the above ground tissues),
which was consistent with previous Northern-blotting results
from other groups (Bouly et al. 1999). These data suggest that
our promoter fusion of AKINβ1 was faithfully expressed. Further
results by GUS staining showed that exogenous 29 mM sucrose
began to attenuate the expression of AKINβ1, especially in true
leaves (compare Figure 3Bwith 3A). It indicated that the true leaf
was more sensitive to sucrose. When sucrose concentration
was raised to 58 mM, the expression of AKINβ1 was almost
inhibited (Figure 3C with 3A). The quantitative GUS assay
showed that other sugars such as fructose or glucose also
inhibited the expression of AKINβ1 at certain concentrations
and that the extent of inhibition depended on the type of
sugar (Figure 4). However, the repression of AKINβ1 was also
300
250
200
150
100
50
0
WT
t
tan
Mu
e
xpr
ere
Ov
ng
ssi
1
line
e
xpr
ere
Ov
ng
ssi
2
line
ng
ssi
line
3
e
xpr
ere
Ov
Figure 2. AKINβ1 had no significant effect on the sucrose phosphate
synthase (SPS)activity.
The SPS activity was analyzed in 28-d-old AKINβ1-OX plants, mutants
and wild type (WT). Data are presented as mean ± SE (n = 3). The
SPS activity differences between the wild type and the mutant/AKINβ1OX plants were analyzed by t-test.
Figure 3. The expression patterns of AKINβ1 gene in 8-d-old seedlings.
The expression of AKINβ1 gene is regulated by sugar
signaling pathway
The results above suggest that AKINβ1 is involved in certain
sugar signaling responses. Since SnRK1s have been shown to
be regulated by different sugar signals, we wanted to further
investigate if the expression of the AKINβ1 gene is regulated
by sugar signaling in a feedback controlled way. Our pilot
(A–C) The expression patterns of AKINβ1::β-D-glucuronidase (GUS)
reporter constructs in seedlings cultured on 1/2 Murashige and Skoog
(MS) medium supplemented with 0 mM (A), 29 mM (B), and 58 mM (C)
sucrose.
(D) The expression of AKINβ1 was semi-quantitatively determined by
reverse transcription-polymerase chain reaction.
Bar,0.5 mm.
4 Journal of Integrative Plant Biology
2009
14
10
NR activity
(mg NO2 . h-1 . mg-1 protein)
12
Relative activity of GUS
2 286.9**
2 500
Sucrose
Fructose
Glucose
Mannitol
2 000
1 500
8
1 000
6
4
835.0
500
85.9**
2
WT
0
0
30
60
90
120
150
4. The
β-D-glucuronidase
(GUS)
activity
Ov
in
t
tan
Mu
ng
ssi
e
xpr
ere
Sugar content (mM)
Figure
38.4**
0
1
line
e
xpr
ere
Ov
ng
ssi
2
line
ng
ssi
4.7**
line
3
e
xpr
ere
Ov
10-d-old
AKINβ1::GUS expressing seedlings cultured on 1/2 Murashige and
Skoog (MS) medium supplemented with different amounts of sugars.
The data were measured by a fluorometric GUS assay and are the
means of three independent results.
Figure 5. AKINβ1 negatively regulates the nitrate reductase (NR) activity.
The activities of NR in 20-d-old AKINβ1 ectopic expressing plants, mutants and wild type (WT) growing in the soil were analyzed, respectively.
Data are presented as mean ± SE (n = 3). The NR activity differences between the wild type and the mutant/AKINβ1-OX plants were
observed in response to osmotic control as shown by nonmetabolic sugars such as mannitol (Figure 4). This suggests that
the regulation of AKINβ1 gene expression by sugar signaling is
caused at least to some extent by osmotic change.
AKINβ1 participates in the regulation of nitrogen
metabolism
Plant nitrate reductase (NR), the key enzyme in nitrogen assimilation, has also been shown to be negatively regulated by
SnRK1. To determine the effect of AKINβ1 to the activity of NR,
we analyzed the activity in wild type, AKINβ1-OX plants and
mutants. As shown in Figure 5, the activity of NR in mutants
was the highest, about three times higher than that in the wild
type. The activity in the AKINβ1-OX plants was the lowest,
about 10–180 times lower than that in the wild type. The t-test
analysis indicated the significant differences of the NR between
the wild type and the mutant/AKINβ1-OX (P < 0.05). This result
corroborated with the negative regulation of NR by the SnRK1
complex and suggests that AKINβ1 is one of the beta subunits
in Arabidopsis that participates in the regulation of nitrogen
metabolism.
To determine if AKINβ1 is regulated by nitrogen status and
concentrations in a feedback cycle, we analyzed the GUS
activity fused with the AKINβ1promoter in the 8-d-old plants
cultured on plates supplemented with different concentrations
of nitrate and amine salt. As shown in Figure 6A, the expression
of AKINβ1gene was stronger in the medium with amine salt than
that with only nitrate salt. There was no significant difference in
analyzed by t-test. Significant differences (P < 0.05) are indicated with
an asterisk (∗ ).
GUS activity with different concentrations of potassium nitrate.
Less than 50 mM potassium nitrate enhanced the expression
of the AKINβ1gene faintly, while more than 50 mM reduced
the expression to some extent. As amine nitrate was added,
the AKINβ1 gene expression was enhanced with the salt level
raised. Further, higher amine chloride also raised the expression. However, more than 10 mM nitrogen with amine salt
severely retarded the development of plants. Compared with
the same concentration of nitrate salt, amine salts can increase
the AKINβ1 gene expression level not only above ground but
also in the root of the plants (compare Figure 6B with 6C).
Discussion
Sugar controls plant growth and development by acting as a
metabolic intermediate product and also as regulatory signals
that control the expression of diverse genes involved in many
processes in the plant life cycle (Koch 1996; Jiang and Carlson
1997; Smeekens and Rook 1997; Smeekens 1998; Roitsch
1999; Sheen et al. 1999). The SnRK1 complex is thought to
be a central component of the sugar signaling system (Halford
and Hardie 1998; Halford et al. 2003). In yeast (Saccharomyces
cerevisiae) and mammals, activating and anchoring subunits
associate with and regulate the activity, substrate specificity,
and cellular localization of the kinase subunit in response
AKINβ1 is Involved in the Regulation of Metabolism
Figure 6. AKINβ1 was regulated by nitrogen status and level.
(A) The activity of AKINβ1 promoter in 10-d-old AKINβ1::β-Dglucuronidase (GUS) expressing plants was measured by a fluorometric
GUS assay. The data are the mean of three independent results.
(B, C) The expression patterns of AKINβ1::GUS reporter constructs
in 10-d-old seedlings cultured on 1/2 Murashige and Skoog (MS) salt
supplemented with 75 mM potassium nitrate (B) or 75 mM amine nitrate
(C). Bar, 0.8 mm.
to changing nutrient sources or energy demands. Compared
with the information available for yeast and mammals, little
is known about the physiological role of SnRK1 in plants. In
Arabidopsis, the differential expression of AKINβ1, AKINγ and
AKINβ2 and the modulation of the transcript levels specifying
some AKIN complex subunits in response to a dark treatment
suggest a mechanism of a transcriptional regulation of the AKIN
complex in response to different signals (Bouly et al. 1999).
But the specific function of a different subunit in response
to different signals is still not clear. Our results demonstrate
that ectopic expression of AKINβ1 enhanced the retardation
of the development of cotyledon and true leaf by exogenous
metabolic sugars, which indicated that AKINβ1 modulates leaf
and cotyledon shape in response to metabolic sugars. However,
AKINβ1 mutant and wild type showed no clear differences in this
respect, suggesting that other AKINβ homologs may participate
in such regulation.
SnRK1 has been shown to regulate SPS and NR, two key
enzymes in the carbon and nitrogen metabolism (Douglas
5
et al. 1997; Halford and Hardie 1998). Here it showed that
overexpressing AKINβ1 inhibited the activity of NR, while mutant
AKINβ1 upregulated its activity. This suggests that AKINβ1,
being one of the beta subunits in Arabidopsis, specifically
participates in the regulation of NR by AKIN complex. However,
AKINβ1 did not influence the activity of SPS, suggesting that
AKINβ1 might not target SPS.
The transcription of AKINβ1 was modulated by sugar and
nitrogen signals, suggesting that regulation in the plants was
finely developed throughout evolution in order to meet the physiological requirements and response to different signals. The
best example is that AKINβ1 negatively regulated NR activity
and AKINβ1 was regulated by nitrogen status and level in a feedback cycle. Nitrate serves as the primary signal for regulating
nitrate assimilation, but light, cytokinin, CO 2 levels, and nitrogen
metabolites such as glutamine all play regulatory roles as well.
A sophisticated regulatory network involving both transcriptional
and post-transcriptional mechanisms plays an important role in
integrating nitrate assimilation. NR activity was rapidly reduced
threefold to 10-fold when plants were transferred to the dark
or to a low CO 2 environment. One mechanism of inactivation
of NR is mediated by phosphorylation (Crawford 1995). Here,
the result that the expression of AKINβ1gene was inhibited
when nitrate concentration was raised, met the requirement of
higher NR activity. By contrast, the AKINβ1 gene expression
was enhanced by the high amine concentration because high
NR activity was not needed under such conditions. Additionally,
exogenous amine salts also increase the expression of the
AKIN β1 gene in the root, which is in accordance with the
fact that roots are the main tissues for nitrate assimilation by
NR (Crawford 1995). This regulation of NR may be critical to
prevent the accumulation of toxic nitrite when levels of anime
salts become high enough to restrict nitrite reduction in the
plastid. It is well known that the activity of NR is regulated by light
and downregulated in darkness. Our results are a confirmation
of the work of Bouly et al. that showed that the expression of
AKINβ1gene is enhanced in darkness (Bouly et al. 1999), which
might provide a possible pathway regulating NR activity by light
signal. The molecular mechanisms operating in the nitrogen
metabolic regulation by SnRK1 might be mediated by specific
AKINβ1. For confirmation, the phosphorylation levels of NR in
response to different levels of AKINβ1 need to be elucidated in
the future.
Materials and Methods
Plant growth, mutant lines
All plants were in the Columbia (Col-0) ecotype. akinβ1 mutant
(Salk-008325) were obtained from SALK T-DNA insertion
collection. The T-DNA insertion lines were confirmed by
PCR amplification of plant genomic DNA using a left-border
6 Journal of Integrative Plant Biology
2009
primer (5 -TGGTTCACGTAGTGGGCCATCG-3 ) and a
specific AKINβ1 gene primer (5 -ATGGGAAATGCGAACGGC3 ). Homozygous mutant plants were confirmed by
PCR amplification using a set of specific AKINβ1
gene primers, 5 -ATGGGAAATGCGAACGGC-3 and 5 TCACCTCTGCAGGGATTTGTA-3 , by which one product can
be amplified from genomic DNA of wild-type or heterozygous
lines, whereas no product can be obtained from homozygous
mutant plants. Arabidopsis thaliana seeds were sown in soil or
on 1/2 of Murashige and Skoog medium salt supplemented with
different sugar contents at 20–24 ◦ C with continuous light. The
effect of nitrogen on the expression of AKINβ1 was analyzed
by sowing seeds on 1/2 of Murashige and Skoog medium
salt minus nitrogen salt supplemented with different nitrate
contents.
AKINβ1 overexpression construct
The open reading frame (ORF) of AKINβ1 gene (GenBank
NM_122124.3) was introduced into the EcoR I site of the binary
T-DNA vector pMon530 (Monsanto, Saint Louis, MO, USA),
driven by the 35S promoter.
AKINβ1::GUS construct
Genomic DNA sequences corresponding to 1 627 bp upstream
of the predicted ATG codon of the AKINβ1 ORF were cloned into
pBI101.1 binary vector between SalI and BamHI sites (Clontech,
Mountain View, CA, USA). Junction sequences of the resulting
construct AKINβ1::GUS were sequenced.
All plasmids were introduced into Agrobacterium tumefaciens strain GV3101 (Koncz and Schell 1986) by electroporation and transformed into Col wild-type plants by the
floral dip method (Clough and Bent 1998). The overexpression AKINβ1 transgenic lines were verified by PCR,
using a 35S-specific primer (5 -GCTCCTACAAATGCCATCA3 ) and a primer matching the AKINβ1 sequence (5 GTCGACGGTACCAAGCTT TTACCGTGTGAGCGGTTTGTA3 ). AKINβ1 overexpression was confirmed by RT-PCR.
assayed using 1 mM MUG at 37 ◦ C, and the reaction stopped
with 0.2 M Na 2 CO 3 after 60 min. Fluorescence was measured
on FLUOstar OPTIMA (BMG LABTECH, Offenburg, Germany).
Activity was presented as nmol 4-MU per min and μg protein
(nM MU · min−1 · μg−1 protein).
Enzyme assays
Leaves of 25-d-old of soil-grown plants were used for enzyme
assay and SPS and NR were assayed as outlined previously
(Huber et al. 1992; Willenbrink et al. 1998). SPS was assayed
as the Fru-6-P and UDP-Glc-dependent production of Suc
and Suc-P under “nonlimiting” conditions (10 mM Fru-6-P and
40 mM Glc-6-P). One unit of SPS produced 1 μg of Suc-P in
1 h at 30 ◦ C. Plants were watered by 50 mM NH 4 NO 3 for 10 h
and NR was assayed as described by Willenbrink et al. (1998)
except that 7.5 mM phenazine methosulfate was included in the
zinc acetate stopping solution. One unit of NR was the amount
that produced 1 μg of nitrite in 1 h at 30 ◦ C. All results are
expressed as mean ± SE of triplicate assays.
Acknowledgements
We thank Professor Shuiping Wang for critically reading the
manuscript.
References
Ball KL, Barker J, Halford NG, Hardie DG (1995). Immunological
evidence that HMG-CoA reductase kinase-A is the cauliflower homologue of the RKIN1 subfamily of plant protein kinases. FEBS Lett.
377, 189–192.
Barker JH, Slocombe SP, Ball KL, Hardie DG, Shewry PR,
Halford NG (1996). Evidence that barley 3-hydroxy-3-methylglutarylcoenzyme a reductase kinase is a member of the sucrose
nonfermenting-1-related protein kinase family. Plant Physiol. 112,
1141–1149.
Bouly JP, Gissot L, Lessard P, Kreis M, Thomas M (1999). Arabidopsis thaliana proteins related to the yeast SIP and SNF4 interact
Promoter analysis and quantification of GUS activity by
fluorescent MUG assay
Homozygous kanamycin-resistant T3 plants of AKINβ1: :GUS
were used for GUS activity detection as described by Weigel
and Galzebrook (Weigel and Glazebrook 2002) for whole mount
observations.
Fluorometric assay of GUS activity was carried out essentially as described by Gallagher (1992). Total protein of
10-d seedlings was extracted using 300 μL MUG (4-methyl
umbelliferone glucuronide; Sigma-Aldrich, St. Louis, MO, USA)
assay buffer. After centrifugation, the supernatant was assayed
for GUS activity and for protein quantification. Samples were
with AKINalpha1, an SNF1-like protein kinase. Plant J. 18, 541–
550.
Bradford KJ, Downie AB, Gee OH, Alvarado V, Yang H, Dahal P
(2003). Abscisic acid and gibberellin differentially regulate expression of genes of the SNF1-related kinase complex in tomato seeds.
Plant Physiol. 132, 1560–1576.
Celenza JL, Carlson M (1989). Mutational analysis of the Saccharomyces cerevisiae SNF1 protein kinase and evidence for functional
interaction with the SNF4 protein. Mol. Cell. Biol. 9, 5034–5044.
Celenza JL, Eng FJ, Carlson M (1989). Molecular analysis of the
SNF4 gene of Saccharomyces cerevisiae: evidence for physical
association of the SNF4 protein with the SNF1 protein kinase. Mol.
Cell. Biol. 9, 5045–5054.
AKINβ1 is Involved in the Regulation of Metabolism
7
Clough SJ, Bent AF (1998). Floral dip: a simplified method for
Hao L, Wang H, Sunter G, Bisaro DM (2003). Geminivirus AL2 and
Agrobacterium-mediated transformation of Arabidopsis thaliana.
L2 proteins interact with and inactivate SNF1 kinase. Plant Cell 15,
Plant J. 16, 735–743.
Corton JM, Gillespie JG, Hawley SA, Hardie DG (1995). 5aminoimidazole-4-carboxamide ribonucleoside. A specific method
for activating AMP-activated protein kinase in intact cells? Eur.
J. Biochem. 229, 558–565.
Crawford NM (1995). Nitrate: nutrient and signal for plant growth. Plant
Cell 7, 859–868.
Crawford RM, Halford NG, Hardie DG (2001). Cloning of DNA encoding
a catalytic subunit of SNF1-related protein kinase-1 (SnRK1-alpha1),
and immunological analysis of multiple forms of the kinase, in spinach
leaf. Plant Mol. Biol. 45, 731–741.
Dickinson J, Cole D, Halford N (1999). A cell cycle role for a plant
sucrose nonfermenting-1-related protein kinase (SnRK1) is indicated
by expression in yeast. Plant Growth Regul. 28, 169–174.
Dobrzyn A, Dobrzyn P, Lee SH, Miyazaki M, Cohen P, Asilmaz
E et al. (2005a). Stearoyl-CoA desaturase-1 deficiency reduces
1034–1048.
Hardie DG, Carling D (1997). The AMP-activated protein kinase: fuel
gauge of the mammalian cell? Eur. J. Biochem. 246, 259–273.
Hardie DG, Carling D, Halford N (1994). Roles of the Snf1/Rkin1/AMPactivated protein kinase family in the response to environmental and
nutritional stress. Semin. Cell Biol. 5, 409–416.
Hardie DG, Pan DA (2002). Regulation of fatty acid synthesis and
oxidation by the AMP-activated protein kinase. Biochem. Soc. Trans.
30, 1064–1070.
Huber JL, Huber SC, Campbell WH, Redinbaugh MG (1992). Reversible light/dark modulation of spinach leaf nitrate reductase activity involves protein phosphorylation. Arch. Biochem. Biophys. 296,
58–65.
Jiang R, Carlson M (1997). The Snf1 protein kinase and its activating
subunit, Snf4, interact with distinct domains of the Sip1/Sip2/Gal83
component in the kinase complex. Mol. Cell. Biol. 17, 2099–2106.
ceramide synthesis by downregulating serine palmitoyltransferase
Kleinow T, Bhalerao R, Breuer F, Umeda M, Salchert K, Koncz C
and increasing beta-oxidation in skeletal muscle. Am. J. Physiol.
(2000). Functional identification of an Arabidopsis snf4 ortholog by
Endocrinol. Metab. 288, E599–607.
screening for heterologous multicopy suppressors of snf4 deficiency
Dobrzyn A, Dobrzyn P, Miyazaki M, Ntambi JM (2005b). Polyunsaturated fatty acids do not activate AMP-activated protein kinase
in mouse tissues. Biochem. Biophys. Res. Commun. 332, 892–
896.
Douglas P, Pigaglio E, Ferrer A, Halfords NG, MacKintosh C (1997).
Three spinach leaf nitrate reductase-3-hydroxy-3-methylglutarylCoA reductase kinases that are required by reversible phosphorylation and/or Ca2+ ions. Biochem. J. 325(Pt 1), 101–109.
Dyck JR, Gao G, Widmer J, Stapleton D, Fernandez CS, Kemp BE
in yeast. Plant J. 23, 115–122.
Koch KE (1996). Carbohydrate-modulated gene expression in plants.
Annu. Rev. Plant Physiol. Plant Mol. Biol. 47, 509–540.
Koncz C, Schell J (1986). The promoter of TL-DNA gene 5 controls
the tissue-specific expression of chimaeric genes carried by a novel
Agrobacterium binary vector. Mol. Gen. Genet. 204, 383–396.
Lakatos L, Klein M, Hofgen R, Banfalvi Z (1999). Potato StubSNF1
interacts with StubGAL83: a plant protein kinase complex with yeast
and mammalian counterparts. Plant J. 17, 569–574.
et al. (1996). Regulation of 5 -AMP-activated protein kinase activity
Laurie S, McKibbin RS, Halford NG (2003). Antisense SNF1-related
by the noncatalytic beta and gamma subunits. J. Biol. Chem. 271,
(SnRK1) protein kinase gene represses transient activity of an alpha-
17798–17803.
amylase (alpha-Amy2) gene promoter in cultured wheat embryos.
Ferrando A, Koncz-Kalman Z, Farras R, Tiburcio A, Schell J, Koncz
J. Exp. Bot. 54, 739–747.
C (2001). Detection of in vivo protein interactions between Snf1-
Lumbreras V, Alba MM, Kleinow T, Koncz C, Pages M (2001). Domain
related kinase subunits with intron-tagged epitope-labelling in plants
fusion between SNF1-related kinase subunits during plant evolution.
cells. Nucleic Acids Res. 29, 3685–3693.
Gallagher SR (1992). GUS Protocols: Using the GUS Gene as a
Reporter of Gene Expression. Academic Press, San Diego.
Gancedo JM (1998). Yeast carbon catabolite repression. Microbiol. Mol.
Biol. Rev. 62, 334–361.
Gibson SI (2005). Control of plant development and gene expression
by sugar signaling. Curr. Opin. Plant Biol. 8, 93–102.
Gissot L, Polge C, Bouly JP, Lemaitre T, Kreis M, Thomas M (2004).
AKINbeta3, a plant specific SnRK1 protein, is lacking domains
EMBO Rep. 2, 55–60.
Polge CC, Thomas M (2007). SNF1/AMPK/SnRK1 kinases, global
regulators at the heart of energy control? Trends Plant Sci. 12 20–27.
Purcell PC, Smith AM, Halford NG (1998). Antisense expression of a
sucrose non-fermenting-1-related protein kinase sequence in tubers
and loss of sucrose-inducibility of sucrose synthase transcripts in
leaves. Plant J.14, 195–202.
Roitsch T (1999). Source-sink regulation by sugar and stress. Curr.
Opin. Plant Biol. 2, 198–206.
present in yeast and mammals non-catalytic beta-subunits. Plant
Ronne H (1995). Glucose repression in fungi. Trends Genet. 11, 12–17.
Mol. Biol. 56, 747–759.
Schuller HJ, Entian KD (1987). Isolation and expression analysis of
Halford NG, Hardie DG (1998). SNF1-related protein kinases: global
regulators of carbon metabolism in plants? Plant Mol. Biol. 37, 735–
748.
Halford NG, Hey S, Jhurreea D, Laurie S, McKibbin RS, Paul M et al.
(2003). Metabolic signalling and carbon partitioning: role of Snf1related (SnRK1) protein kinase. J. Exp. Bot. 54, 467–475.
two yeast regulatory genes involved in the derepression of glucoserepressible enzymes. Mol. Gen. Genet. 209, 366–373.
Sheen J, Zhou L, Jang JC (1999). Sugars as signaling molecules. Curr.
Opin. Plant Biol. 2, 410–418.
Smeekens S (1998). Sugar regulation of gene expression in plants.
Curr. Opin. Plant Biol. 1, 230–234.
8 Journal of Integrative Plant Biology
2009
Smeekens S, Rook F (1997). Sugar sensing and sugar-mediated signal
transduction in plants. Plant Physiol. 115, 7–13.
Thompson-Jaeger S, Francois J, Gaughran JP, Tatchell K (1991).
Deletion of SNF1 affects the nutrient response of yeast and resembles mutations which activate the adenylate cyclase pathway.
Genetics 129, 697–706.
Vincent O, Townley R, Kuchin S, Carlson M (2001). Subcellular
localization of the Snf1 kinase is regulated by specific beta subunits
and a novel glucose signaling mechanism. Genes Dev. 15, 1104–
1114.
Warden SM, Richardson CO, Donnell JJ, Stapleton D, Kemp BE,
Witters LA (2001). Post-translational modifications of the beta-1
subunit of AMP-activated protein kinase affect enzyme activity and
cellular localization. Biochem. J. 354, 275–283.
Willenbrink BJ, Bonnett GD, Willenbrink S, Wardlaw IF (1998).
Changes of enzyme activities associated with the mobilization of
carbohydrate reserves (fructans) from the stem of wheat during
kernel filling. New Phytol. 139, 471–478.
Woods A, Cheung PC, Smith FC, Davison MD, Scott J, Beri RK et al.
(1996). Characterization of AMP-activated protein kinase beta and
gamma subunits. Assembly of the heterotrimeric complex in vitro.
J. Biol. Chem. 271, 10282–10290.
Woods A, Munday MR, Scott J, Yang X, Carlson M, Carling D (1994).
Yeast SNF1 is functionally related to mammalian AMP-activated
protein kinase and regulates acetyl-CoA carboxylase in vivo. J. Biol.
Chem. 269, 19509–19515.
Yang X, Hubbard EJ, Carlson M (1992). A protein kinase substrate
identified by the two-hybrid system. Science 257, 680–682.
Weigel D, Glazebrook J (2002). How to study gene expression. In:
Yang X, Jiang R, Carlson M (1994). A family of proteins containing
Arabidopsis: A Laboratory Manual. Cold Spring Harbor Laboratory
a conserved domain that mediates interaction with the yeast SNF1
Press, Cold Spring Harbor, NY.
protein kinase complex. EMBO J. 13, 5878–5886.
(Handling editor: Xiaoquan Qi)