Vol. 10, 403– 405, April 2001
Cancer Epidemiology, Biomarkers & Prevention
Short Communication
Association between the Dopamine D2 Receptor A2/A2 Genotype and
Smoking Behavior in the Japanese1
Kimihide Yoshida,2 Nobuyuki Hamajima,2
Ken-ichi Kozaki, Hiroko Saito, Ken Maeno,
Takahiko Sugiura, Katashi Ookuma, and
Takashi Takahashi3
Departments of Pulmonary Medicine [K. Y., K. M., T. S.] and Pathology and
Clinical Laboratories [K. O.], Aichi Cancer Center Hospital; and Divisions of
Epidemiology [N. H.] and Molecular Oncology [K. K., H. S., T. T.], Aichi
Cancer Center Research Institute, Chikusa-ku, Nagoya 464-8681, Japan
Abstract
For the study presented here, we investigated possible
links between the dopamine D2 receptor (DRD2) TaqIA
genotype (DRD2*A) and smoking behavior in a total of
332 Japanese individuals. For the first time, functional
insertion/deletion polymorphism (ⴚ141C Ins/Del) in the
DRD2 promoter was also examined in relation to smoking
behavior. The distribution of the DRD2*A genotype was
significantly different among current, former, and neversmokers (P ⴝ 0.001; ␹2 test), and smoking appeared to
be associated with the DRD2 A2/A2 genotype, showing
marked contrast to previous reports for non-Hispanic
whites in the United States. Multivariate logistic
regression analysis incorporating age, sex, genotype, and
smoking status as variables revealed that DRD2 A2/A2
genotype was significantly associated with an increased
risk of predisposition to smoking behavior in the
Japanese (odds ratio, 3.680; 95% confidence interval,
1.499 –9.052). In contrast, such an increased risk was not
observed in terms of association with the ⴚ141C Ins/Del
polymorphism. These findings suggest an association of
the DRD2*A genotype with an increased risk of being
predisposed to smoking behavior in the Japanese and
suggest the possible existence of ethnic group-specific
differences, which warrant additional studies on the
underlying molecular mechanism.
Introduction
It is well known that the consumption of nicotine and of other
drugs subject to abuse induces pleasurable feelings in users.
Dopamine, a major neurotransmitter of the central nervous
system, is thought to be involved in the mesolimbic reward
Received 6/14/00; revised 1/3/01; accepted 2/11/01.
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported in part by a Grant-in-Aid for Scientific Research on Priority Areas
from the Ministry of Education, Science, Sports and Culture, Japan, and by a
Grant from the Smoking Research Foundation.
2
These two authors contributed equally to this study.
3
To whom requests for reprints should be addressed, at Division of Molecular
Oncology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-Ku,
Nagoya 464-8681, Japan. Phone: 81 (52) 764-2983; Fax: 81 (52) 764-2993; Email: [email protected].
pathway (1–3). Nicotinic receptors are present on the dopaminergic cell bodies, and stimulation of these receptors by
nicotine has been shown to result in an increased release of
dopamine in the nucleus accumbens of the mesolimbic system (4).
Accruing evidence suggests that certain polymorphisms of
the dopaminergic system genes may be linked to susceptibility
to various neuropsychiatric diseases including alcoholism,
polysubstance abuse, cocaine abuse, obesity, and pathological
gambling (5–9). Although environmental factors may be important determinants of smoking, the results of association,
family, and twin studies suggest that initiation and maintenance
of smoking also involve hereditary factors (10 –14). To date,
three studies on non-Hispanic Caucasian populations in the
United States have shown a relationship between either the
DRD2*A1 or the *B1 allele and genetic predisposition to smoking behavior (15–17), whereas such an association was not
confirmed in a United Kingdom population (18).
In our study, we investigated possible links between the
DRD2*A genotype and smoking behavior in a total of 332
Japanese individuals. In addition, a functional polymorphism
(⫺141C Ins/Del), which was identified in the DRD24 promoter
(19), was examined for the first time in relation to smoking
behavior.
Materials and Methods
Study Subjects. Blood samples were obtained from a total of
332 Japanese individuals (87% participation rate) who were
consecutively recruited when they visited the outpatient clinic
of Aichi Cancer Center for either cancer screening (n ⫽ 154) or
the antibiotic eradication of Helicobacter pylori infection (n ⫽
178). These study populations were chosen simply because of
their availability when we initiated the present study. There
were 177 females (24 current smokers, 6 former smokers, and
147 never-smokers) and 155 males (53 current smokers, 51
former smokers, and 51 never-smokers). Subjects were categorized as to smoking status as follows: (a) never-smokers were
individuals who smoked less than 100 cigarettes in their lifetime; (b) former smokers were those who had quit at least 1
year before the interview; (c) current smokers were subjects
who either were currently smoking or had stopped smoking
within the previous 1 year; and (d) ever-smokers consisted of a
combination of current and former smokers. The sex-stratified
distribution of smokers and never-smokers in this study cohort
was similar to that of the general Japanese population (20). The
study was approved by the Ethics Committee of Aichi Cancer
Center, and informed consent was obtained from all of the
subjects before a structured interview and peripheral blood
sampling.
4
The abbreviations used are: DRD2, dopamine D2 receptor; ⫺141C Ins/Del, an
insertion/deletion polymorphism at ⫺141C of DRD2.
Downloaded from cebp.aacrjournals.org on July 31, 2017. © 2001 American Association for Cancer Research.
403
404
Short Communication: Association of DRD2*A2 with Smoking in the Japanese
Table 1
Distribution of DRD2*A genotypes in relation to smoking status
DRD2*A genotype
Smoking status
A1/A1
All of the subjects (n ⫽ 332)
Current smokers
Former smokers
Never-smokers
Males (n ⫽ 155)
Current smokers
Former smokers
Never-smokers
Females (n ⫽ 177)
Current smokers
Former smokers
Never-smokers
A1/A2
Table 2
Multivariate analysis of the association between smoking status and
DRD2*A genotype
Pa
DRD2*A genotype
A2/A2
Smoking status
A1/A1
b
5 (6)
5 (9)
31 (16)
33 (43)
17 (30)
105 (53)
39 (51)
35 (61)
62 (31)
0.001
4 (8)
5 (10)
8 (16)
22 (42)
14 (27)
26 (51)
27 (51)
32 (63)
17 (33)
0.044
1 (4)
0 (0)
23 (16)
11 (46)
3 (50)
79 (54)
12 (50)
3 (50)
45 (31)
0.210
Ever-smokers
Current smokers
Former smokers
Ever-smoking males
Ever-smoking females
1
1
1
1
1
A1/A2
A2/A2
a
1.65 (0.67–4.04)
1.90 (0.63–5.70)a
1.16 (0.35–3.91)a
1.27 (0.43–3.77)b
3.58 (0.43–29.8)b
3.68 (1.50–9.05)a
3.72 (1.23–11.2)a
3.58 (1.09–11.8)a
3.19 (1.06–9.60)b
7.59 (0.91–63.4)b
a
Age- and sex-adjusted odds ratio; 95% confidence interval is shown in parentheses.
b
Age-adjusted odds ratio; 95% confidence interval is shown in parentheses.
␹2 test.
Numbers in parentheses represent percentage of each genotype among individuals with the indicated smoking status.
a
b
PCR-based Detection of Polymorphisms of the DRD2 Gene.
Genomic DNA was extracted from each coded blood sample,
and DRD2*A genotypes were determined by means of PCR
using sense (5⬘-CCGTCGACCCTTCCTGAGTGTCATCA-3⬘)
and antisense (5⬘CCGTCGACGGCTGGCCAAGTTGTCTA3⬘) oligonucleotide primers (15). The resulting PCR products
were digested with TaqI, followed by electrophoretic separation
on 3% agarose gels. Detection of ⫺141C Ins/Del polymorphism was carried out by electrophoretic separation of the
BstNI-digested PCR products on 3% agarose gels using sense
(5⬘-ACTGGCGAGCAGACGGTGAGGACCC-3⬘) and antisense (5⬘-TGCGCGCGTGAGGCTGCCGGTTCGG-3⬘) oligonucleotide primers (19).
Statistical Analyses. Odds ratios and 95% confidence intervals for the genotypes were calculated by using an unconditional logistic model in conjunction with the Statistical Analysis System statistical program package (Ver. 6.12; SAS
Institute, Inc., Cary, NC) after completion of the molecular
biological evaluation. The ␹2 test was used to examine the
association between DRD2 genotype and smoking status.
Results and Discussion
We first examined a total of 332 Japanese individuals to investigate whether the DRD2*A genotype may be associated with smoking behavior. We consequently found that the DRD2 A2/A2 genotype was seen more frequently in current smokers and former
smokers (51% and 61%, respectively) than in never-smokers
(31%) and that the difference in the distribution of DRD2*A
genotype among current, former, and never-smokers was indeed
statistically significant (P ⫽ 0.001 as determined by ␹2 test; Table
1). To our surprise and in marked contrast to previous reports from
the United States (15–17), smoking thus appeared to be associated
with the DRD2*A2 allele instead of DRD2*A1 allele. Stratification
according to sex showed similar relationships and was statistically
significant for males (P ⫽ 0.044; ␹2 test). Similar genotypephenotype relationships were observed regardless of the participant accrual methods (data not shown). A thorough review of the
original gels and the coding of genotypes within the database ruled
out the possibility of any errors in classification or coding, and
genotyping data were confirmed for 19 randomly selected samples
by an independent outside researcher (Dr. Kenji Hibi of Nagoya
University, Japan) for further validation. It should also be noted
that the overall allele frequency observed in this study was very
similar to that reported in a study on the association between
alcoholism and the DRD2*A genotype in the Japanese by an
independent Japanese group (21).
Multivariate logistic regression analysis was performed to
estimate the age- and sex-adjusted odds ratio for the genotype
to examine whether the DRD2*A genotype is independently
associated with an increased risk of being predisposed to smoking behavior (Table 2). It was consequently shown that individuals with the A2/A2 genotype had a significantly increased
risk of such predisposition when compared with those with the
A1/A1 genotype (odds ratio, 3.68; 95% confidence interval,
1.50 –9.05). Individuals with the A1/A2 genotype also had a
modestly increased, although not statistically significant, risk of
predisposition to smoking (odds ratio, 1.65), which suggests
that the gene dosage of the DRD2*A2 allele has an effect on the
level of risk. Multivariate analysis performed separately for
current and former smokers revealed a similarly increased
probability for individuals with the DRD2 A2/A2 genotype of
being either current smokers (odds ratio, 3.72; 95% confidence
interval, 1.23–11.2) or former smokers (odds ratio, 3.58; 95%
confidence interval, 1.09 –11.8). Stratification by sex revealed
the presence of a significant association between the DRD2
A2/A2 genotype and predisposition to smoking behavior in
males (odds ratio, 3.191; 95% confidence interval, 1.06 –9.60;
Table 2). Although it did not reach statistical significance, a
similar trend was also seen in females (odds ratio, 7.59; 95%
confidence interval, 0.91– 63.4).
Our preliminary analysis of TaqIB polymorphism in the
intron 1 of the DRD2 gene revealed a highly consistent association between DRD2*A2 and DRD2*B2 alleles in the Japanese population (i.e., only 2 in 154 individuals showed discrepancy), showing a more stringent linkage disequilibrium than
that reported for non-Hispanic whites in the United States (17).
Both of the DRD2*A and DRD2*B polymorphisms reside outside the coding region, and no direct evidence for their functional significance such as transcriptional regulatory activity
has been reported. Therefore, we extended the present study by
investigating possible links between smoking behavior and the
⫺141C Ins/Del polymorphism, i.e., a functional insertion/deletion polymorphism recently identified within the promoter
region of the DRD2 gene (19). However, in contrast to the
DRD2*A genotype, the distributions of ⫺141C Ins/Del genotypes were virtually similar regardless of smoking status (Table
3). We note that although skewing in the genotype distribution
was marginally significant for males, multivariate analysis
failed to support any independent link of the ⫺141C Ins/Del
genotype to smoking behavior (data not shown).
The study presented here shows for the first time that the
DRD2 A2/A2 genotype is significantly associated with an increased risk of predisposition to smoking behavior in the Japanese
Downloaded from cebp.aacrjournals.org on July 31, 2017. © 2001 American Association for Cancer Research.
Cancer Epidemiology, Biomarkers & Prevention
Table 3
Distribution of ⫺141C Ins/Del genotypes of the DRD2 gene in
relation to smoking status
Smoking status
All of the subjects (n ⫽ 327)
Current smokers
Former smokers
Never-smokers
Males (n ⫽ 154)
Current smokers
Former smokers
Never-smokers
Females (n ⫽ 173)
Current smokers
Former smokers
Never-smokers
⫺141C Ins/Del genotype
Pa
Ins/Ins
Ins/Del
Del/Del
54 (71)b
38 (67)
140 (72)
20 (26)
14 (25)
51 (26)
2 (3)
5 (9)
3 (2)
0.098
39 (75)
33 (65)
42 (82)
13 (25)
13 (25)
8 (16)
0 (0)
5 (10)
1 (2)
0.048
15 (63)
5 (83)
98 (69)
7 (29)
1 (17)
43 (30)
2 (8)
0 (0)
2 (1)
0.278
␹2 test.
Numbers in parentheses represent percentage of each genotype among individuals with the indicated smoking status.
a
b
population. It is interesting that the observed association is in
inverse relation to that reported for non-Hispanic Caucasians in the
United States (15–17), indicating the possible existence of ethnic
differences in the association of the DRD2 A2/A2 genotype with an
increased risk of being predisposed to smoking behavior. Thus,
additional studies are needed to clarify the molecular mechanism,
which can account for the observed ethnic group-specific difference. One possibility is that DRD2*A alleles may be involved in
a different linkage disequilibrium, depending on the ethnic population, with a multiallele polymorphism of DRD2, which has a
stronger influence on the function of DRD2 than ⫺141C Ins/Del.
An alternative explanation would be that DRD2*A alleles may be
differentially linked to a multiallele functional polymorphism of a
neighboring gene, as yet to be identified, in an ethnic groupspecific manner. It will be interesting to investigate whether a
similar association exists in other Asian populations such as Koreans and Chinese, because ethnic variation has been reported in
the strength of both intragenic and intergenic linkage disequilibriums (22, 23). The lack of apparent association of the DRD2*A
genotype with either cigarettes/day or pack-years smoked was
noted in contrast to its significant link to the acquisition of smoking behavior (data not shown). These findings suggest that there
may not be a simple relationship between DRD2*A genotype and
the degree of nicotine dependence in the Japanese population.
Nevertheless, although replication of the present findings by other
groups using independent samples is necessary, the present study
suggests the potential usefulness of DRD2*A genotyping for the
assessment of individual risk profiles for smoking among Japanese. Thus, future studies are warranted, especially those which
focus on the gene-gene interaction between DRD2 and other
mesolimbic dopamine systems such as the dopamine D4 receptor
gene (24) as well as on social, behavioral, and personal factors that
may influence the acquisition of smoking behavior.
Acknowledgments
We thank Dr. K. Hibi for his help in validating our genotyping data. We also
thank Dr. H. Osada for helpful discussions and critical reading of the manuscript
and S. Ooya and T. Saito for their technical assistance.
References
1. Wise, R. A., and Rompre, P. P. Brain dopamine and reward. Annu. Rev.
Psychol., 40: 191–225, 1989.
2. Koob, G. F. Drugs of abuse: anatomy, pharmacology and function of reward
pathways. Trends Pharmacol. Sci., 13: 177–184, 1992.
3. Di Chiara, G. Drug addiction as dopamine-dependent associative learning
disorder. Eur. J. Pharmacol., 375: 13–30, 1999.
4. Pontieri, F. E., Tanda, G., Orzi, F., and Di Chiara, G. Effects of nicotine on the
nucleus accumbens and similarity to those of addictive drugs. Nature (Lond.),
382: 255–257, 1996.
5. Blum, K., Noble, E. P., Sheridan, P. J., Montgomery, A., Ritchie, T., Jagadeeswaran, P., Nogami, H., Briggs, A. H., and Cohn, J. B. Allelic association
of human dopamine D2 receptor gene in alcoholism. J. Am. Med. Assoc., 263:
2055–2060, 1990.
6. Smith, S. S., O’Hara, B. F., Persico, A. M., Gorelick, D. A., Newlin, D. B.,
Vlahov, D., Solomon, L., Pickens, R., and Uhl, G. R. Genetic vulnerability to drug
abuse. The D2 dopamine receptor TaqI B1 restriction fragment length polymorphism appears more frequently in polysubstance abusers. Arch. Gen. Psychiatry,
49: 723–727, 1992.
7. Noble, E. P., Blum, K., Khalsa, M. E., Ritchie, T., Montgomery, A., Wood,
R. C., Fitch, R. J., Ozkaragoz, T., Sheridan, P. J., Anglin, M. D., Paredes, A.,
Treiman, L., and Sparkes, R. S. Allelic association of the D2 dopamine receptor
gene with cocaine dependence. Drug Alcohol Depend., 33: 271–285, 1993.
8. Noble, E. P., Noble, R. E., Ritchie, T., Syndulko, K., Bohlman, M. C., Noble,
L. A., Zhang, Y., Sparkes, R. S., and Grandy, D. K. D2 dopamine receptor gene
and obesity. Int. J. Eating Disord., 15: 205–217, 1994.
9. Comings, D. E., Rosenthal, R. J., Lesieur, H. R., Rugle, L. J., Muhleman, D.,
Chiu, C., Dietz, G., and Gade, R. A study of the dopamine D2 receptor gene in
pathological gambling. Pharmacogenetics, 6: 223–234, 1996.
10. Hughes, J. R. Genetics of smoking: a brief review. Behav. Ther., 17: 335–345,
1986.
11. Heller, R. F., O’Connell, D. L., Roberts, D. C., Allen, J. R., Knapp, J. C.,
Steele, P. L., and Silove, D. Lifestyle factors in monozygotic and dizygotic twins.
Genet. Epidemiol., 5: 311–321, 1988.
12. Carmelli, D., Swan, G. E., Robinette, D., and Fabsitz, R. Genetic influence
on smoking-a study of male twins. N. Engl. J. Med., 327: 829 – 833, 1992.
13. Heath, A. C., Madden, P. A., Slutske, W. S., and Martin, N. G. Personality
and the inheritance of smoking behavior: a genetic perspective. Behav. Genet.,
25: 103–117, 1995.
14. Cheng, L. S., Swan, G. E., and Carmelli, D. A genetic analysis of smoking
behavior in family members of older adult males. Addiction, 95: 427– 435, 2000.
15. Noble, E. P., St. Jeor, S. T., Ritchie, T., Syndulko, K., St. Jeor, S. C., Fitch,
R. J., Brunner, R. L., and Sparkes, R. S. D2 dopamine receptor gene and cigarette
smoking: a reward gene? Med. Hypotheses, 42: 257–260, 1994.
16. Comings, D. E., Ferry, L., Bradshaw-Robinson, S., Burchette, R., Chiu, C.,
and Muhleman, D. The dopamine D2 receptor (DRD2) gene: a genetic risk factor
in smoking. Pharmacogenetics, 6: 73–79, 1996.
17. Spitz, M. R., Shi, H., Yang, F., Hudmon, K. S., Jiang, H., Chamberlain,
R. M., Amos, C. I., Wan, Y., Cinciripini, P., Hong, W. K., and Wu, X. Casecontrol study of the D2 dopamine receptor gene and smoking status in lung cancer
patients. J. Natl. Cancer Inst. (Bethesda), 90: 358 –363, 1998.
18. Singleton, A. B., Thomson, J. H., Morris, C. M., Court, J. A., Lloyd, S., and
Cholerton, S. Lack of association between the dopamine D2 receptor gene allele
DRD2*A1 and cigarette smoking in a United Kingdom population. Pharmacogenetics, 8: 125–128, 1998.
19. Arinami, T., Gao, M., Hamaguchi, H., and Toru, M. A functional polymorphism in the promoter region of the dopamine D2 receptor gene is associated with
schizophrenia. Hum. Mol. Genet., 6: 577–582, 1997.
20. The Editorial Board of the Cancer Statistics in Japan. The trends in consumption of tobacco, alcohol and food. In: Cancer Statistics in Japan, 1999, pp.
62– 63. Tokyo: Foundation for Promotion of Cancer Research, 1999.
21. Kono, Y., Yoneda, H., Sakai, T., Nonomura, Y., Inayama, Y., Koh, J., Sakai,
J., Inada, Y., Imamichi, H., and Asaba, H. Association between early-onset
alcoholism and the dopamine D2 receptor gene. Am. J. Med. Genet., 74: 179 –
182, 1997.
22. Ingles, S. A., Haile, R. W., Henderson, B. E., Kolonel, L. N., Nakaichi, G., Shi,
C. Y., Yu, M. C., Ross, R. K., and Coetzee, G. A. Strength of linkage disequilibrium
between two vitamin D receptor markers in five ethnic groups: implications for
association studies. Cancer Epidemiol. Biomark. Prev., 6: 93–98, 1997.
23. Xu, Y., Berglund, L., Ramakrishnan, R., Mayeux, R., Ngai, C., Holleran, S.,
Tycko, B., Leff, T., and Shachter, N. S. A common HpaI RFLP of apolipoprotein
C-I increases gene transcription and exhibits an ethnically distinct pattern of
linkage disequilibrium with the alleles of apolipoprotein E. J. Lipid Res., 40:
50 –58, 1999.
24. Shields, P. G., Lerman, C., Audrain, J., Bowman, E. D., Main, D., Boyd,
N. R., and Caporaso, N. E. Dopamine D4 receptors and the risk of cigarette
smoking in African-Americans and Caucasians. Cancer Epidemiol. Biomark.
Prev., 7: 453– 458, 1998.
Downloaded from cebp.aacrjournals.org on July 31, 2017. © 2001 American Association for Cancer Research.
405
Association between the Dopamine D2 Receptor A2/A2
Genotype and Smoking Behavior in the Japanese
Kimihide Yoshida, Nobuyuki Hamajima, Ken-ichi Kozaki, et al.
Cancer Epidemiol Biomarkers Prev 2001;10:403-405.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cebp.aacrjournals.org/content/10/4/403
This article cites 23 articles, 4 of which you can access for free at:
http://cebp.aacrjournals.org/content/10/4/403.full#ref-list-1
This article has been cited by 2 HighWire-hosted articles. Access the articles at:
http://cebp.aacrjournals.org/content/10/4/403.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cebp.aacrjournals.org on July 31, 2017. © 2001 American Association for Cancer Research.