Independent Research Proposal
A Novel Molecular Beacon with Long-wavelength Fluorescent Dyes
for High Sensitivity DNA/Protein Analysis
Libo Cao
Department of Chemistry, Center for Intelligent Chemical Instrumentation, Ohio University,
Athens, OH 45701-2979
IDEA
DNA/RNA analysis is of great importance in molecular biology, genetics, and molecular
medicine. Molecular beacons (MBs) are single-stranded oligonucleotide probes with a hairpin
structure that can identify the mutations in the human genome caused by DNA hybridization.
A fluorophore and a quencher are linked to the two ends of the strand. The bases at both ends of
the beacon are complementary to each other, forming the stem, which keeps the fluorophore and
the quencher in proximity to each other. The fluorescence of the fluorophore, which are usually
dyes, is thus quenched by the quencher through energy transfer. This proposal attempts to design
a novel molecular beacon with long-wavelength fluorescent dyes for high sensitivity and
efficiency DNA/Protein analysis. With the long-wavelength fluorescent dyes, which will have
emission and excitation greater than 600 nm, the background noise will be attenuated. By using
two fluorophores, as acceptor and donor, defined in FRET theory in stead of a fluorophore and a
quencher, higher molecular beacon efficiency can be obtained. The cyanine dyes Cy3 and Cy5
are presented as the fluorophore donor and acceptor in MBs.
Another advantage of this method is that 630-650 nm laser diode can be used as the excitation
source if using near infrared donor and acceptor pair to label the ends of MB. The traditional
laser sources are He-Cd (325 nm and 441 nm) and Ar ion (488 nm and 512 nm), which excite
auto-fluorescence. However the diode laser will circumvent this shortcoming.1-3 Further more,
1
diode lasers have several other advantageous characteristics: they are small, have a low flicker
noise (<0.05%), and the available wavelengths are in the red (>630nm) to near-infrared region,
where the light scattering is generally low.
BACKGROUND
1. Molecular beacon
DNA and RNA analysis is of great importance in molecular biology, genetics, and molecular
medicine. Molecular beacons are a new class of DNA/RNA probes. The first molecular beacon,
which is a single-stranded oligonucleotide probe with a hairpin structure, was developed in
1996.4A fluorophore and a quencher are linked to the two ends of the strand. The five to seven
bases at both ends of the beacon are complementary to each other, forming the stem, which
brings the fluorophore and quencher close enough to allow quenching to occur by fluorescence
resonance energy transfer. Upon hybridization to a complementary DNA sequence, the hairpin
loop is broken and the fluorophore and quencher are separated, resulting in the restoration of
fluorescence.
Fig. 1. Principle of operation of molecular beacons.
Because molecular beacons can possess a wide variety of differently colored fluorophores,
multiple targets can be distinguished in the same solution, using several different molecular
beacons, each designed to detect a different target, and each labeled with a different fluorophore.
2
Single-nucleotide differences in a DNA sequence can thus be detected in homogeneous assays.5
The region surrounding the site of a sequence variation is amplified in a polymerase chain
reaction and the identity of the variant nucleotide is determined by observing which of four
differently colored molecular beacons binds to the amplification product.
Anthony developed the method for detection of single-base mismatches using molecular beacon
with high selectivity. The method is based on fluorescence resonance energy transfer (FRET)
between a fluorophore attached to an immobilized DNA strand (“probe”) and a quenchercontaining sequence that is complementary except for an artificial mismatch at the site of
interrogation.6, 7 Also, since the signal transduction mechanism is built within the MB molecules,
no DNA intercalation reagent or labeling of the target molecule is needed. Molecular beacons
have shown many other advantages over other DNA probes. These include the excellent
capability of studying biological process in real time and in vivo.
Fig. 2. Autofluorescence of Gray Snapper (L.griseus) oocyte 8
For current molecular beacons, the fluorophore usually chosen is fluorescein (FAM),9 which has
emission at 520nm and excitation at 480nm. However, for some amino acids, such as Oocyte,
Tryptophane, and Tyrosine, autofluorescence will occur at this region.8 The figure 2 above
shows the autofluorescence of a different Gray Snapper (L. griseus) oocyte excited at 490 nm
3
and 685nm. The accompanying surface plot shown to the right of the corresponding image
graphically illustrates the autofluorescent signal or background noise using 490 nm and the lack
of autofluorescence using 685nm, the LaJolla Blue excitation wavelength. Thus using these
molecular beacons to detect protein with these amino acids will reduce the signal-to-noise ratio
and the sensitivity.
2. Fluorescence resonance energy transfer (FRET)
FRET involves non-radiative transfer of electronic excitation from an excited donor, D* to a
ground state acceptor molecule A, and occur on time scales from femto seconds to milliseconds
ο
at distances ranging from 10 to approximately 100 A . Therefore, FRET suits for the detection of
dynamic distance changes, for example the distance change during the process of open and close
of the hairpin loop. The particular advantage of FRET is the dependence (and thus sensitivity) of
the energy transfer efficiency (E) on the sixth power of the distance (R) between the
chromophores.10 The energy transfer yield is given by Eq. (1).11
R06
E 6
R0  R 6
where
（1）
ο
critical distance (R0) is a dye-pair-dependent parameter in the range up to 70 A . R
is the distance between the donor and acceptor in a biological environment. The transferred
energy is depended on both the
critical distance, which is characterized by the FRET pairs
themselves and the distance between the donor and acceptor fluorophores.
An addition method that is utilized to calculate transfer efficiency, E, is from the fluorescence
intensities (quantum yields) using Eq. (2): 12
E  1  ( Fda / Fd )
（2）
4
Where Fda is the donor fluorescence intensity determined at a given wavelength in the presence
of the acceptor and Fd is the corresponding quantity determined in the absence of the acceptor.
This method was used to roughly calculate the transfer efficiency of the FRET fluorophore pairs.
3. Efficiency evaluation of the molecular beacon
In most of the applications, MBs use a fluorophore and a quencher attached to both ends
of the stem. The sensitivity and dynamic range of MBs as probes are determined mainly by two
parameters: the residual fluorescence intensity when the MBs are in the stem-closed form and the
fluorescence intensity when they are in the stem-open form. Efficiency of the MBs can be
evaluated as the ratio of the fluorescence intensity of the fluorophore at the stem-open form to
the stem-close form, which can be written as Ifl,open/Ifl,close, however, in reality, the residual
fluorescence varies greatly due to many factors, and usually cause incomplete quenching. Thus a
new strategy to design MBs with two fluorophores instead of one fluorophore and one quencher
was invented.13
Fig. 3. A schematic representation of the MB with two fluorophores.
In Figure 3, two different fluorophores (F1 and F2) are attached to the two ends of the stem. F1
and F2 are chosen such that FRET will occur within a certain distance. When the MB is in the
stem-closed form and excited at the absorption band of F1, due to the energy transfer, the
fluorescence of F1 is quenched by F2, and the fluorescence of F2 is increasing. When a hybrid is
formed between the MB and target, because of the increased distance between two ends of the
5
stem, FRET is reduced or eliminated and the fluorescence of F1 will rise while that of F2 will
diminish or disappear. By using the two fluorophores, the ratio of the intensities of the
fluorescence of F1 and F2 (IF1/IF2) can provide significant advantages over measurement of IF1
only. Because (IF1,open/IF2,open)/( IF1,close/IF2,close), which can be rewrite as
(IF1,openIF2,close)/( IF1,closeIF2,open), will always be larger than Ifl,open/Ifl,close according to the
mechanism, the fluorescence intensity of F1 will increase upon hybridization, while that for F2
will decrease. In this proposal, two fluorophores are chosen, as acceptor and donor, defined in
FRET theory.
EXPERIMENTS AND METHODS
1. Choose of acceptor and donor dyes
The structure of a molecular beacon is given in Figure 4 below.
A
A
G
A
T
A
T
C
C
T
A
G
A
A
G
5'
O
O
P
O
C
A
T
G
C
C
G
G
C
G
T
3'
O
O
HN
S
O
NH
N
N
HN
N
SO3
Fig. 4. The structure of a molecular beacon
6
The known helical structure of double-stranded DNA and RNA can be exploited to determine the
global structure of nucleic acids and nucleoprotein complexes. Well-defined sequences of DNA
and RNA oligomers are now routinely synthesized and
termini, as well as within the DNA sequence. The structure of the molecular beacon can be
referred to as Donor-(N)n-Acceptor, where n indicates the base pair separation between the dyes.
Many acceptor and donor pair can be chosen for this purpose to label to the end of DNA. End
labeling has three main advantages (when the shortest possible DNA is used): the dyes can be
spatially separated from the binding protein to avoid protein–dye interactions; the DNA end
sequence can be specifically designed to provide an identical chemical environment and, thus,
the fluorescence properties of the dyes in a series of molecules can be derived; and the exact
location of Cy3 on the DNA is known and evidence is accumulated on the position of fluorescein
12
Because of its improved absorption and fluorescence properties, Cy3 will largely replace
rhodamine as the acceptor in FRET studies. Additionally, in contrast to rhodamine, Cy3 can be
directly attached to the oligonucleotides during synthesis.14 In this proposal, the cyanine dyes of
Cy3 and Cy5, which showed in Figure 5, are used as donor and acceptor respectively because of
their long-wavelength character (Cy3 fluorophores were excited by argon laser at 514.5 nm and
Cy5 fluorophores were excited by a He-Ne laser, or Diode laser-induced fluorescence detector
(DIO-LIF) at 632.8nm) that can minimize the background noise and other excellent parameters
showed in applications on bimolecular analysis.
The FRET donor and acceptor are linked to the ends of DNA strand, Cy3 (donor) can be labeled
at the 5’ end in this oligonucleotide model.7 The position of Cy3 stacking on top of a C-G base
7
pair (bp) at the ends of helical DNA is also known.14 Dyes with group COOH- or SO3- can be
labeled with the biomolecular as showed in Figure 6:6
Fig. 5. The molecular structures of Cy3 and Cy5
O
O
Dye
DCC, DMF
N OH
COOH
Dye
COO
N
O
O
O
DCC, DMF
Dye SO3H
N OH
O
Dye S O
O
O
O
N
O
NH2 Bio
O
Dye S NH Bio
O
Fig. 6. Label dyes with the biomolecular
2. FRET results for Cy3 and Cy5 pair
FRET used to be the technique used to measure distances in protein structures and their
assemblies in solution. This technique recently is applied to make more efficient molecular
beacon.7, 15 Protein can be labeled with dyes at defined sites, for example, cysteine residues.
The FRET efficiency of different donor-acceptor labeled model DNA system in aqueous solution
from ensemble measurements and at the single molecule level are studied. A set of differently
8
labeled FRET constructs with D/A base pair separation was synthesized to investigate and
compare the distance dependence and the influence of the dye structure on the measured
spectroscopic characteristics.
The
ο
radii, R0 of the D/A pair of Cy3/Cy5 is 55.8 A . It is calculated from the spectral
overlap of the separate absorption and emission spectra of the donor and acceptor only doublestranded oligonucleotides, and the fluorescence quantum yields of the donor only constructs,
respectively. Cy3 and Cy5 were assumed as free rotors.
Figure 7 is the model of the D/A DNA constructs with varying distance: D-(N)5-A; D-(N)15-A;
D-(N)25-A; and D-(N)35-A. the 40mer complementary oligonucleotideswere custom synthesized.
Fig. 7. Model of the D/A DNA constructs with varying distance. 11
The donor dye Cy3 was coupled to the 5’ end of oligonucleotide, and acceptor Cy5 was also
coupled to C6 amino-modified thymidine bases at four different positions in the complementary
oligonucleotide, resulting in D/A distances of 5, 15, 25 and 35 base pairs, respectively.
From table 1 we can see that the donor dye Cy3 exhibit monoexponential fluorescence decay
times attached at the double-stranded DNA. From the relatively high fluorescence quantum
yields, the data imply that the donor dye is not quenched by DNA nucleotides. In other words,
the donor only constructs exhibit relatively homogeneous spectroscopic characteristics, which is
important for successful FRET experiments.
9
Lieberwirth also proved that the rhodamine derivative JA133 and most indocarbocyanine dyes
such as Cy5 are not quenched by DNA nucleotides.16 Due to this observation, we can use FRET
constructs where guanosine residues are so far apart from the donor dyes that any quenching
influence of the DNA base guanine should be minimized.
Table 1. Ensemble spectroscopic characteristics of the different FRET constructs in aqueous buffer containing 1 M
NaCl.11
-- relative fluorescence quantum yield; D – donor; A—acceptor;
FRET efficiency from the donor average fluorescence lifetime.
-- fluorescence lifetime;
--
Fig. 8. Fluorescence emission spectra of the different FRET constructs in aqueous buffer containing 1 M NaCl 25 oC,
10-6 M. Cy3/Cy5 excited at 520 nm. 11
Figure 8 shows the emission spectra of the FRET constructs with D/A distances of 15, 25, and 35
base pairs show the expected decrease in donor fluorescence and increase in acceptor
fluorescence. Furthermore, the emission curves intersect in one point, which demonstrates a
10
direct correlation between the decrease of donor fluorescence and increase of acceptor
fluorescence. As we may also see, the energy is not completely transferred to the acceptor at
even 35 bases distance level.
In single molecule measurements, the single pair FRET (spFRET) efficiencies, Esp were
calculated from the background corrected fluorescence intensities of the donor I Dcorr and
acceptor I Acorr , as showed in equation (3)
E sp 
I Acorr  C
( I Acorr  C  I Dcorr )
(3)
The cross-talk, C between the donor and acceptor channel was calculated from ensemble
emission spectra and the transmission of the filter set (8.1% for Cy3).
Fig. 9. FRET histograms extracted from single molecule data of 10 -11 M solutions of the differently labeled D/A
constructs and corresponding Gaussian fits.11
Figure 9 shows the spFRET efficiency histograms that were generated from the single molecule
fluorescence intensity data of Cy3-(N)x-Cy5 constructs, and of only donor labeled
oligonucleotides measured in aqueous buffer containing 1 M NaCl. Without acceptor, the donor
only labeled oligonucleotides show only one peak with zero FRET efficiency. Two peaks can be
11
seen for the 5-bp separation constructs, the donor at approximately zero efficiency and the
acceptor at very high (>0.95) efficiency. As the increasing of the bp length, the acceptor peak
clearly shifts to lower FRET efficiency, as expected for
energy transfer.
3. Molecular beacon design
FRET can occur between them within a certain distance. Several applications on protein and
DNA analysis haven been done that relate to these two dyes.11, 15, 17 However, no application up
to now has been carried out to apply this pair of dyes on molecular beacon. MB and target DNA
sequence with 5-25 bp with this pair of fluorophores are evaluated. The Cy3 fluorophores were
excited by argon laser at 514.5 nm and Cy5 fluorophores were excited by a He-Ne laser, or
Diode laser-induced fluorescence detector (DIO-LIF) at 632.8nm.
Since the two fluorophore MB will provide higher efficiency than one fluorophore MB, this
proposal applied this strategy by synthesizing a two fluorophore MB with Cy3 dye labeled on
one end of the stem as a donor and Cy5 as an acceptor on the other. The sequences of the MB
and target DNA used in this work is showed in table 2.
Table 2. MB and target DNA sequences.
_______________________________________________________________________
MB:
5’-Cy3-GCTCGTCCATGCCCAGGAAGGAGGCAACGACACGAGC-Cy5-3’
Target: 5’-GTCGTTGCCTCCTTCCTGGGCATGG-3’
________________________________________________________________________
MB and target DNAs used in this work can be synthesized by Trilink Bio Technologies, Inc.
(San Diego, CA). MB was synthesized using standard phosphoramidite coupling procedures. The
sample was deprotected with concentrated ammonium hydroxide at room temperature for 30
hours, and then purified on a polyacrylamide gel. The labeled oligonucleotide was isolated on
12
reversed-phase HPLC.13 In the absence of a target sequence MB adopts a hairpin structure
containing a stem of 6 base pairs (the underlined segment) and a loop of 25 bases. The stem
keeps the two fluorophores in proximity, which causes a quenching of the Cy5 and an emission
of Cy3 as a result of energy transfer. A conformational change that opens the stem leads to the
separation of the two fluorophores (35 bases distance), and therefore restores the fluorescence of
Cy5 while decreasing that of Cy3, and fluorescence spectra can be read from figure 7. All
fluorescence experiments were performed at room temperature. The fluorescence emission
spectra of the different FRET are obtained in aqueous buffer containing 1 M NaCl 25 oC, 10-6 M.
Cy3/Cy5 excited at 520 nm.
Figure 10 is the schematic diagram of the optical setup for detection. ‘For efficient excitation of
the donor dye Cy3, a frequency-doubled Nd:YAG laser emitting at 532 nm. The fluorescence
light was collected through the same objective and imaged onto a 100 m pinhole to reject outof-focus light. The collimated laser beam was directed into an inverted microscope and coupled
into the microscope objective with high numerical apertures (oil immersion, 100 x, NA 1.4) via a
dichroic beam splitter. Within the microscope objective, the beam was focused into the sample to
detect freely diffusing FRET constructs. The transmitted fluorescence light is then split by a
dichroic mirror and focused onto the active areas of two avalanche photodiodes. To further
isolate the donor and acceptor signal, additional band pass filters in front of the APDs can b e
used. The signals of both APDs were coupled to a counting board and a personal computer.
Sample solutions (10-11 M) were prepared from 10-6 M stock solutions by several dilution steps.
For diffusion measurements, the average excitation power at the sample was adjusted to be 325
W. ’
13
DESIGNED EXPERIMENTS
Choose of donors and acceptors
The FRET features of R6G, TMR, Cy3, Ja133 and Cy5 has been evaluated by Dietrich and his
colleges in reference 7, thus it is possible to use those pairs in MB to detect one-base mismatch.
Figure 1 shows the structure of these molecules:
Fig. 10 Molecular structures of the used dyes
The donor dyes are 5-carboxyrhodamine 6G (R6G) (absorb at 534nm, emission at 558nm), 5carboxytetramethylrhodamine (TMR) (557nm/584nm), and the indocarbocyanine dye Cy3
(551nm/565nm). Acceptors are Cy5 (650nm/664nm), which is obtained as functionalized Nhydroxysuccinimidyl esters, and rhodamine derivative, JA133 (620nm/634nm).
Synthesis of molecular beacons
Molecular beacons are single-stranded oligonucleotide probes that possess a stem-and-loop
structure. Four types of molecular beacons are synthesized, each containing 5-nucleotide-long
arms and 25-nucleotide-long probe sequence:
5’-Cy3-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’
14
5’-TMR-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’
5’-R6G-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’
5’-TMR-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-JA133-3’
The complementary DNA sequence, one-base-mismatch DNA sequence, two-base-mismatch
DNA sequence, and non-complementary DNA sequence are needed:
Complementary DNA: CGAGCGGTACGGGTCCTTCCTCCGTTGCTGGCTCG
One-base-mismatch DNA: CGAGCGGTACGGGTCCTACCTCCGTTGCTGGCTCG
Two-base-mismatch DNA: CGAGCGGTACGGGTCCTAGCTCCGTTGCTGGCTCG
Non-complementary DNA: CGAAACCTGCGAATGGTAGCTCCAATGTGGAATCG
The one-base mismatch occurs at the base underlined. The molecular beacons and DNA chains
will be custom designed and synthesized by the Midland Certified Reagent Co. (Midland, TX).
Other chemical reagents can be obtained from Sigma. Super purified water will be used for the
preparation of all solutions.
Instrumental Setup
A schematic representation of the experimental setup is shown in Figure 11. A
frequency-doubled Nd:YAG laser operating at 532 nm will be directed into a inverted Olympus
fluorescence microscope(IX70-S8F) onto the sample with high numerical apertures(oil
immersion, 100x, NA 1.4) by a dichroic beam splitter. The excitation source will be applied
during the data acquisition in a shuttered matter to minimize photobleaching. The transmitted
fluorescence light will be split by a dichroic mirror and focused onto two avalanche photodiodes
(APD) with additional band-pass filters in front of the APDs to further isolate the donor and
acceptor signal. The fluorescence light will be filtered by a band-pass filter between 549 and 595
15
nm (Omega, 570DF30) for donors, and between 650 and 710 nm (Omega, 680DF30) for the
acceptors. A counting board will work as the interface between the signals of both APDs and a
Sample
Microscope
objective
Beam splitter
Laser source
APD
Personal computer
Beam splitter
Band-pass
filters
Counting board
APD
Fig. 11 Schematic diagram of the optical setup.
personal computer. This personal computer will be used to control all parts of the instrument,
acquire data, and analyze results. The whole equipment will be monitored over time.
METHODOLOGY
Sample solutions (10-11M) should be obtained from 10-6 M stock solutions by several dilution
steps. For each MB, the FRET efficiency in closed state MB should be calculated first for future
comparison. Coupling reactions will be carried out in hybridization buffer (20mM Tris-HCl,
pH8.0, 0.5M MgCl2). Each MB will carry out hybridization reactions with the complementary
DNA sequence, the one-base-mismatch DNA sequence, two-base-mismatch DNA sequence and
16
the non-complementary DNA sequence respectively. A real-time dynamic process of the
hybridization will be followed. There should be an obvious difference in the FRET efficiency
when different DNA sequences hybridize with the MBs. Compared with the hybridization
reaction with the complementary DNA sequence, the hybridization reaction with one-basemismatched DNA sequence will result in a much higher FRET efficiency. Both the hybridization
reactions of MBs with the two-base-mismatched DNA sequence and the non-complementary
DNA sequence have as high FRET efficiency as the stem-closed state FRET efficiency, which
indicates the still closed state of the MBs because the hybridization reaction should not be
occurred. The labeled oligonucleotides can be purified by reversed phase (RP18-column) HPLC
using a gradient of 0-75% acetonitrile in 0.1M aqueous triethylammonium acetate. Absorption
and emission spectra will be obtained with a Perkin-Elmer LS 50 B spectrometer equipped with
a photomultiplier R928 before the coupling step and after the open of the hairpin. Fluorescence
intensity for each donor and acceptor at a certain stage should be respectively obtained. Thus the
efficiency of the MB can be calculated.
Estimation of the FRET parameters
The FRET efficiency E is a function of the distance R between the donor and
acceptor: E  R06 /( R06  R 6 ) , where R0 is the distance at which the FRET efficiency is 50%, it is a
function of the orientation factor k2 and overlap integral J.
R0  8.79 105 ( D k 2 n 4 J ) ,
where  D is a quantum yield of the donor and n is the refraction index of the medium. The R0 of
ο
ο
ο
the four investigated D/A pairs are: 63.5 A (R6G/Cy5); 64.5 A (TMR/Cy5); 55.8 A (Cy3/Cy5);
ο
and 59.0 A (TMR/JA133)
Evaluation of efficiency for MBs
17
For MBs, E = (IF1,openIF2,close)/( IF1,closeIF2,open), the efficiency of MBs can be evaluated by
detecting the intensity of different fluorophores before and after the hairpin is open. A table of
the different MB efficiencies should be created for evaluation. Theoretically, the dualfluorophore MBs should give higher (usually 2 times) efficiency than the traditional ones.
Detection of hybridization reaction
The hybridization of four types of oligonucleotides (complementary DNA, one-base-mismatch
DNA, two-base-mismatch DNA and non-complementary DNA) to the MBs will be investigated.
A real-time dynamic process of the hybridization will be followed. Four graphs for the four MBs
with time vs. FRET efficiency should be created to discriminate the hybridization reactions
among perfect match, one-base mismatch, two-base mismatch and the non-complementary. The
perfect match should give lowest FRET efficiency, one-base-mismatch hybridization reaction
should provide relatively higher FRET efficiency, and both the two-base-mismatch and the noncomplementary FRET efficiency should keep the same as the FRET efficiency of the original
closed state MBs before the hybridization reaction. The length of the hybridization sequence and
the location of the mismatched bases in the sequence will have strong effects upon the stability.
Effect of metal ion on the hybridization reaction
Effect of metal ions on the hybridization reaction of MBs with its target DNA sequence will be
studied in 5 different environments. Kinetics studies of the hybridization reaction will be carried
out. Different metal ions with a certain concentration will have different ionic strength, which
will influence the stem stability of the MBs. The more stable the stem structure in a MB, the
more stable FRET efficiency will occur, which means the lower FRET efficiency in the open
stem state, and the higher FRET efficiency in the closed stem state. The ionic strength I will be
calculated by I  1/ 2 Ci Zi2 , where Ci is the ionic concentration, and Zi is the ionic charge. The
18
concentration range from 10nm to 100nm of four types of solutions (KCl, NaCl, MgCl2, and
CaCl2) and one with no additional salts will be used in this part of experiment. Two sets of plots
will be created, one with time vs. relative fluorescence intensity of donor (should increase during
the procedure of the hybridization reaction), and the other with time vs. relative fluorescence
intensity of acceptor (should decrease during the procedure of the hybridization reaction). Each
plot will include 5 curves, each indicates for the same buffer solution with different ion solutions.
Thus, the optimum ion environment for the hybridization reaction should be obtained and the
kinetics feature of the hybridization reaction should be obtained.
Sensitive Detection of the MBs
The determination of the sensitivity of the MBs and the kinetics of the hybridization study will
be investigated by using different concentrations of target oligonucleotide. During the process of
the target DNA hybridizing with the MB, initial reaction rates will be used to characterize the
hybridization kinetics. A plot of initial rate vs. concentration of target DNA in a 0-100 nm range
should be created. When the target DNA concentration is low, we may need a long time to reach
steady-state for the hybridization reaction to be finished. The hybridization rate is expected to be
increased linearly with increasing target DNA concentration. Standard deviation for the baseline
before the hybridization started should be calculated. The concentration detection limit of the
MBs also should be calculated.
Chemical regeneration of the MBs
Reusability of MBs has always been a desired feature in practical applications. Usually the
regeneration of MB was achieved by either a thermal or a chemical method. Here we will apply a
chemical method to regenerate the MB. The MBs that we used can be regenerated by immersing
it in 90% formamide in a TE buffer (10mM Tris-HCl, pH8.3, 1mM EDTA) for 1 min at room
19
temperature. After regeneration, the MBs will return to their original state, which indicates that
the double-stranded DNA hybrid are dissociated into single strands and the MBs are closed again.
The donor fluorescence should be observed to decrease and acceptor fluorescence increase. Even
the regeneration of the MBs are possible, however, the regeneration should be less successful
after several restoration assay cycles. Statistical methods will be used to calculate the confidence
interval of the response values.
CONCLUSIONS
In conclusion, a new strategy of designing MBs which uses two fluorophores (Cy3 and
Cy5) instead of one fluorophore and one quencher as the donor and acceptor was proposed. Such
MBs display high sensitivity and a large dynamic range. The molecular beacon designed in this
proposal should be able to detect target DNA with 35 bases up to 1x10-7 M. The FRET
efficiencies of D/A pair (Cy3 and Cy5) covalently attached to a double-stranded 35 base pair
oligonucleotide in aqueous solution was studied. This type of MBs could be very useful for
studying protein-DNA/RNA interactions. Also it could be promising in the field of fluorescent
immunoassay,15 DNA sequencing,18 and other bio-molecular analyses.
Reference:
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
Boyer, A.; Lipowska, M.; Zen, J.; Patonay, J. J. Anal. Lett. 1992, 25, 415.
Mank, A. J. G.; Yeung, E. S. J. Chromatogr. 1995, 708, 309.
Imasaka, T.; Tsukamoto, A.; Ishibashi, N. Anal. Chem. 1989, 61, 2285.
Tyagi, S.; Kramer, F. Nat. Biotechnol. 1996, 14, 303.
Marras, S. A. E.; Kramer, F. R.; Tyagi, S. Genet. Anal-Biomol. E. 1999, 14, 151.
Davidson, R. S.; Hilchenbach, M. M. Photochem. Photobiol. 1990, 52, 431.
Frutos, A. G.; Pal, S.; Quesada, M.; Lahiri, D. J. Am. Chem. Soc. 2002, 124, 2396.
http://www.diatronscience.com/AutoFluor.html.
Stojanovic, M.; Prada, P.; Landry, D. Chembiochem. 2001, 2, 411.
20
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
Stryer, L. Annu. Rev. Biochem. 1978, 47, 819.
Dietrich, A.; Buschmann, V.; M ller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211.
Hillisch, A.; Lorenz, M.; Diekmann, S. Curr. Opin. Struc. Biol. 2001, 11, 201.
Zhang, P.; Beck, T.; Tan, W. Angew. Chem. Int. Ed. 2001, 40, 402.
Norman, D. G.; Grainger, R. J.; Uhrin, D.; Lilley, D. M. Biochem. 2000, 39, 6317.
Schobel, U.; Egelhaaf, H.; Fr hlich, D.; Brecht, A.; Oelkrug, D.; Gauglitz, G. J. Fluoresc.
2000, 10, 147.
Lieberwirth, U.; Drexhage, K. H.; Herten, D. P. Anal. Chem. 1998, 70, 4771.
Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247,
163.
Metzker, M.; Lu, J.; Gibbs, R. Science 1996, 271, 1420.
21