Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Analysis of Genetic Diversity in
Maize(Zeamays L.)Varieties Using Simple
Sequence Repeat(SSR)Markers
Nidhal AbdulHusseinAl-Badeiry
College of Education for Girls
Kufa University
[email protected]
Ali Hmood Al-Saadi
College of Science
Babylon University
[email protected]
Thamer Khadhair Merza
College of Science
Kufa University
Abstract
A total of 41 alleles were detected among the tested varieties using 10 Simple Sequence Repeat
(SSR) loci distributed on 9 chromosomes of maize.The molecular size of bands obtained from
amplification of SSR products ranged from 91 to 288 bp. Alleles ranged from one in umc1653 to ten in
bnlg1189 loci. The values of heterozygosity for each locus varied from 0.46 for umc1641 and umc1069
loci to 0.88 for bnlg1189 locus with a mean of 0.55. The polymorphic information content (PIC) values
for the SSR loci ranged from 0.17 to 0.85, with an average of 0.44. The highest PIC values were
observed in primers bnlg1017 (0.85) and umc1038 (0.79) and the lowest PIC values was observed in
primer umc1946 (0.17).The study revealed that, the lowest genetic distance was (0.2410) between
varieties IPA 5011 (lane 6) and Sarah (lane 8), while, the highest genetic distance was (0.7853)
between varieties DKC 6120 (lane 15) and Manlcet (lane 19). The genetic similarity values ranging
from (0.2147 to 0.7590) depending upon the genetic distance values that ranging from (0.2410 to
0.7853), which indicate the larger diversity with percentage of (24 to 78%) among the tested varieties.
Analysis of the obtained results from genetic distances and Neighbor-joining dendrogram (unrooted
tree) revealed that, the 20 tested maize varieties can be grouped into two major groups: one small
cluster A containing 4 varieties and a large cluster B containing 16 varieties. The results obtained in
this study may assist maize cultivation and in maize breeding programes.
Key words: Genetic diversity; Zea mays; SSR markers; genetic distance.
‫الخالصة‬
‫)ك‬SSR ‫كم م كشفمعشامماكشفعذشتنممتكبشاكشفتت م اكشفمت ممذذكشف ممن ك‬10‫ممت م ك‬
‫ك‬
‫كم م كشالفممن اكص م كشالع م‬41‫تمملكشف ع م ك م ك‬
‫كعشفم تعمذعك ممعكت م تكمم كاذعمع ممعم اكشفممبذعكشفعمملذشم كعت مذشعلكشفم مملكشف منم كف مم لكشف ت ممتكم م ك‬Simple Sequence Repeat
‫ككعتم مذشعلك م م كشالف ممن اكلم م كشفمعشا مماكشفعذشتن ممتكمم م ك ف م م كعشمم م كلم م ك‬
‫ك عجكا م م‬288‫كإف ممعك‬91‫كمم م ك‬SSR‫كشفمعشا مماكشفعذشتن ممتكف م ممك‬
‫تضم م‬
‫كف م كمعامماكت مذشعلك‬heterozygosity‫ كعع م ك كاممنلكشفت م ذكشف شناممعت ك‬bnlg1189‫كإفممعك ع مذعك فممن اكل م كشفمعامماكشفممعذشت ك‬umc1653
‫ ككت شذعممماكاممنلكممتممعلكشفم عم م اكمت م عكشالعمما ك‬0.55‫)كع م م كا م ذ ك‬bnlg1189 ‫كل م ك‬0.88‫)كإفممعك‬umc1641 ‫كل م ك‬0.46
‫مم‬
‫ كعفمعم ك ك معكانممتك‬0.44‫كع م م كام ذ ك‬،0.85‫كإفمعك‬0.17 ‫كف كمعااكع شذتم كمم‬polymorphic information content‫)ك‬PIC
‫) ك‬0.17 ‫ك‬umc1946‫ك‬
‫ك ذاملك‬IPA 5011
‫)كلم م كمم م كا مماك ام م كانم ممتكلم م كشف م م‬0.79 ‫ك‬umc1038‫)كع‬0.85 ‫ك‬bnlg1017‫كا مماكف م م ن ك‬PIC‫ف م ممك‬
‫(كعشفمب كمعم كصم كشفعم ل‬0.2410) ‫ك مبشكشفماعمذكشف منم كإفمعك ك ام ك م كع شذتم ك مع‬
‫تعع اكشف شذ متكمم كلم‬
‫ ك ذاملك‬Manlcet‫)كع‬15‫ك ذاملك‬DKC 6120 ‫(كصم كشفعم ل ك‬0.7853)‫كص مم كع م اك صمذك م كع شذتم ك معك‬،)8‫ك م ذعك ذاملك‬
‫)كعشفعم‬6
‫كعشفتم كتعم ذكشفممعكشفت ممع ك‬،0.7590‫كإفممعك‬0.2147‫) كع ممعك م مكاممنلكشف م كشفممعذشت كتمملكإ م كاممنلكشفتعم اكشفممعذشت كشفتم كتذشعممماكمم ك‬19
‫كشفم ذع ممت كاعم كتم م كشف تم نحكشفتم كتمملكشفمعممع ك يم كمم كشف م كشفممعذشت كعع م ذعك‬
‫كم مع ممتك‬
‫كا م كشف شذ ممتكتع مماكإفممعكم مممع ت كذنن م ت‬
‫)كصم كشالعم‬%78‫كإفممعك‬24 ‫شف ص ممذكشفممب ك ممصتاك‬
‫كإفممعك كام كشالعم‬Neighbor-joining dendrogram‫شف اممتكشفعذشتنممتك‬
‫كتمتمع ك معك متتك عمذكعم ل كشف تم نحكشفتم كتملكشفمعمع ك‬B‫كعم مع متكاص مذعكتم عك‬،
‫كتمتمع ك معك ذة متك عم‬A‫عشم عكعم ذعكتم عك‬
‫كل ك شذ تكشفبذعكشفعلذشمكعةذشمحكتذة تي كك ك‬
‫ك‬
‫ي كل ك ب كشف شذ تكنما ك كت‬
‫كشف كشفعذشت‬، ‫كعش م اكشفتت اكشفمت ذذكشف ن‬،‫كشفبذعكشفعلذشم‬، ‫كشفعذشت‬
‫الكلمات الدالة كشفت ع ك‬
Introduction
Maize (Zea mays) is one of the world’s most important crop plants after
wheat and rice, which provides staple food to large number of human population in
- 1768 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
the world. It is belonging to the family of grasses (Poaceae) (Farhad et al., 2009). It
has greater nutritional value as it contains about 72% starch, 10% proteins,
8.5%fiber, 4.8% oil, 3% sugar and 1.7% ash. It is not only an important human
nutrient, but also a basic element of animal feed and raw material for manufacture of
many industrial products (Farhad et al., 2009 and Ministry of Environmental and
Forests, 2010). Information concerning the genetic diversity of maize hybrids is very
important for germplasm enhancement, hybrid breeding and preventing
environmental damage that may occur due to the genetic uniformity of hybrids
grown on large areas. Unless there is sufficient genetic diversity in the germ plasm, it
is practically not possible to increase the yield and other desirable characters of a
crop, because the selection of improved genotypes depends on the availability of
genetic variability within the breeding material (Bauer et al., 2007). Among DNA
marker methods, most commonly used is polymerase chain reaction (PCR). There
are two kinds of PCR-based assays, for example, random amplified polymorphic
DNA (RAPD) and simple sequence repeats (SSRs), powerful DNA fingerprinting
techniques (Cholastova et al., 2011). Microsatellites or (SSRs) composed of a DNA
sequence motif of 2–6 bases in length that is repeated tandemly usually five or more
times are markers that have become widely used in genetic studies in maize (Qi-Lun
et al., 2008). Besides its high level of polymorphism, this technique is useful
molecular markers because they are abundant, uniformly distributed, codominant,
rapidly produced by PCR, relatively simple to interpret and easily accessed by other
laboratories via published primer sequences. Besides, for measuring diversity, it is
very useful tool for assigning lines to heterotic groups and for genetic fingerprinting
(Park et al., 2008).Measuring genetic diversity in populations of sweet corn, e.g., is
important for understanding of the genetic structure and subsequently improving the
breeding process (Rupp et al., 2009). Nearly 1000 SSR markers are available in
maize under public domain facilitating their utilization for diverse purposes in
genetics and plant breeding, (Kumari et al., 2005) and also used as an important tool
for purity identification of maize hybrid (Wu et al., 2010).The aim of this study was
detection of polymorphism at DNA level among varieties of maize genetic deployed
in Iraq by investigation and application of DNA marker such as, SSR and to find of
DNA fingerprint distinctive for varieties and that serves as an identity that is used to
diagnose these varieties; and assessment and evaluation of genetic distance and
phylogenetic diversity of varieties so as to guide breeder an appropriate choice for
parents to conduct breeding.
Materials and Methods
Samples Collection:
Collected grain maize varieties from different regions in the country and
certified sources, such as: Buhooth 106, IPA 2052, IPA 5015, IPA 5012, IPA 5018,
IPA 5011, IPA 5026, Sarah, Al-Maha, SNH 8605, SNH 5610, Kr 640, 3078, Pio
3751, DKC 6120, DKC 5783, 89 May 70, Biotech Bag, Manlcet and DKC 6418. Its
grains were sown on 21/7/2011 for autumn cultivation and samples of maize leaves
(2 weeks old) were collected for DNA isolation.
DNA Isolation:
The genomic DNA Mini Kit (Geneaid Biotech. Ltd; Taiwan Company)
provides a quick and easy method for purifying total DNA (including genomic
DNA,mitochondrial and chloroplast DNA) from plant tissue. DNA was isolated from
leaves according to the method protocol.
- 1769 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
DNA Quantification and Quality Determination:
To determine the concentration, 20μl of DNA from each sample was added to
1980 μl of TE buffer and mixed thoroughly then optical density (OD) was measured
using a spectrophotometer at wavelengths of 260 nm and 280nm. The DNA
concentration in the solutions was calculated according to the following formula:
DNA conc. (μg /μl) = [OD260 *100 (dilution factor) * 50 μg/ml] /1000.
Theoretically, OD260 of one corresponds to approximately (50μg/ml) for double
strand DNA. The ratio between the reading at 260nm /280nm provides estimate of
the purity of nucleic acid (Sambrook and Russell, 2001).
PCR Amplification of SSR-Primers:
According to the Experimental Protocol of AccuPower® TLA PCR PreMix,
the PCR reaction mixture was prepared as follows: 1. 5µl template DNA and 4 µl of
primer (10 pmole/µl, 2µl forward and 2µl reverse), were added to each AccuPower®
TLA PCR PreMix tube. 2. Sterilized deionized distilled water was added to
AccuPower® TLA PCR PreMix tubes to the final volume of 20 µl. 3. The tubes
were mixed with vortex to dissolve the lyophilized blue pellet, and briefly spine
down (all these steps were done in ice). a sequence was amplified individually using
SSR primer (listed in table 1).Amplification were performed in thermocycler
programmed according to annealing temperatures as follows: 1. one cycle of 1 min at
94C°, for 40 cycle of each 15 sec at 94C°, 15 sec at 55C° and 30 sec at 72C°, with a
final extension for one cycle of 1 min at 72C° (umc2013, umc1038 and bnlg1017). 2.
one cycle of 5 min at 94C°, for 35 cycle of each 40 sec at 94C°, 35 sec at 60C° and
45 sec at 72C°, with a final extension for one cycle of 5 min at 72C° (umc1630,
umc1946, umc1641 and bnlg1189). 3. one cycle of 4 min at 94C°, for 35 cycle of
each 1 min at 94C°, 1 min at 58C° and 2 min at 72C°, with a final extension for one
cycle of 7 min at 72C° (umc1653, umc1069 and bnlg1810).
Table 1: Names and sequences of SSR primers used in this study.
Primer
Sequences (5’ → 3’)
Forward: CAGACCTTCGAGGGCAAGAACT
umc1630 Reverse: AGTTTTGGCTTCTTCTCCCAAGTC
Forward: ATTGGAAGGATCTGCGTGAC
bnlg1017 Reverse: CAGCTGGTGGACTGCATCTA
Forward: GAAACGACCAGCACAGCACAT
umc1946 Reverse: GCACCACACCATCAGATCCAG
Forward: CTCCCTTCGTCTCCCGACTC
umc1641 Reverse: CAGATCGGCTCAGCCACAAC
Forward: CGTTACCCATTCCTGCTACG
bnlg1189 Reverse: CTTGCTCGTTTCCATTCCAT
Forward: GGGACGAGAGTCTGTTGTTGTTG
umc2013 Reverse: GTTGATGCATGTGACTCTGGAAAC
Forward: GAGACATGGCAGACTCACTGACA
umc1653 Reverse: GCCGCCCACGTACATCTATC
Forward: AGAGAATCCCCAAGCAAACAAAC
umc1069 Reverse: CTTCATCGGAGCCATGGTGT
Forward: ATGCTCCTCCTCTCCTCCAT
bnlg1810 Reverse: GCGATGATGAGCTGCAAGTA
Forward: CGTCACACTCCTCTGCCACTT
umc1038 Reverse: GAGGATTCAGAACTCGACTCGG
- 1770 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Then amplified DNA were separated by electrophoresis in 2-3 % agarose gels
(1.5-2 hr, 100V) to be sure that the PCR process succeeded (Weigand et al., 1993).
PCR products were visualized by U.V transilluminator and then were imaged by gel
documentation system (Hashemi et al., 2009), the size of SSR-PCR products
estimated by comparing with the marker 100 bp DNA ladder 100-2,000 bp.
Data Analysis of SSR Products:
The resulting microsatellite data were analysed using Power Marker V.3
software (http://www.powermarker.net) to calculate the number of alleles,
heterozygosity and polymorphic information content (PIC). Genetic distance was
computed using Nei’s (1972) standard genetic distance (Ds). The distance method of
Nei (1972) was used with program Power Marker V.3 for the construction of
phylogenetic tree. Neighbore─joining method was used to obtain the tree. The tree
was then viewed using the TREEVIEW version 1.6 (http://taxonomy. zoology. gla.
ac. uk/ rod/rod.html) programs.
Results and Discussion
The isolated DNA (concentration ranges from 100 ng/μl to 295 ng/μl) with
purity of 1.8─1.9 determined by spectrophotometric ratio A260/A280.
The results obtained in these experiments revealed that 10 primers have
amplified the specific regions and produced specific bands (SSR primers were
umc1630, umc1946, umc1641, umc2013, umc1038, bnlg1017, bnlg1189, umc1653,
umc1069 and bnlg1810). For scoring and data analysis, the amplified loci were run
on agarose gel with high concentration.
When SSR─PCR products were separated by agarose gel electrophoresis
(Figures 1, 2, 3 and 4) either one band (homozygous) or two bands (heterozygous)
were noticed for each primer depending on the types of microsatellite loci
(homozygous or heterozygous). Microsatellites as they are co─dominant marker thus
heterozygote produces two bands revealing the amplification of the two loci and
could be readily identified (Wu et al., 2010). Microsatellite co─dominancy increases
the efficiency and accuracy of population genetic measures based on these markers
compared with other markers (Wang et al., 2009). The molecular weight of these
bands obtained from amplification of SSR products of twenty investigated maize
variety ranged from 91 to 288 bp.
In similar studies, Senior et al., (1998) reported that the molecular weight of
bands obtained from SSR products of maize ranged from 62 to 284 bp. Also, in a
study by Li et al., (2002) on Chinese maize inbred lines, the molecular weight was
ranged from 49 to 286 bp. Park et al., (2008) found that the molecular weight of
bands obtained from amplification of microsatellite loci in 76 korean waxy corn
ranged from 75 to 175 bp.
Figure 1: The amplification results of the SSR primer umc1630, lane M: DNA ladder and lanes
1-20: maize varieties.
- 1771 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Figure 2: The amplification results of the SSR primer umc2013, lane M: DNA ladder and lanes
1-20: maize varieties.
Figure 3: The amplification results of the SSR primer umc1069, lane M: DNA ladder and lanes
1-20: maize varieties.
Figure 4: The amplification results of the SSR primer bnlg1810, lane M: DNA ladder and lanes
1-20: maize varieties.
The total number of alleles detected was 41 for ten SSR loci in twenty maize
varieties (Table 2). The alleles ranged from one in umc1653 to ten in bnlg1189 loci.
The average number of alleles per locus among the varieties was 4.1 and the mean
number of alleles reported by many authors in previous studies was similar as those
found in this study. Warburton et al., (2002) found an average of 3.8 alleles in 9
Asian inbred lines and 3.04 by Yen et al., (2002) in 13 Indian inbred lines. Similarly
mean alleles detected by George et al., (2004) had higher (5 alleles) in 68 Asian
maize inbred lines, 4.9 alleles in 64 tropical Asian lines.
Variation reported in the number of alleles of maize varieties may be related to
variation in the loci studied as well as the number of genotypes and the locations or
due to wild range of origin varieties used in the study (Gurung et al., 2010).
The values of heterozygosity for each locus varied from 0.46 for umc1641 and
umc1069 loci to 0.88 for bnlg1189 locus with a mean of 0.55 (Table 2).
These results are similar to the results obtained in previous studies made in maize,
for example: Kostova et al., (2006) found a mean heterozygosity of 0.51, and
Morales et al., (2010) a value of 0.54 and which was higher than the findings by Yao
et al., (2008), where they observed an average value of 0.39.
- 1772 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Heterozygosity gives an idea of the information available from the SSR loci and
their potential to detect differences between lines based on their genetic relation. The
differences among varieties may be attributed mainly to differences in the genetic
base. We also considered the fact those microsatellites with show a higher number of
allelic variants. The numbers of alleles as well as the diversity values confirm the
wide genetic base of the maize varieties (Eyherabide et al., 2006 and Morales et al.,
2010).
The PIC values for the SSR loci ranged from 0.17 to 0.85, with an average of
0.44 (Table 2). The highest PIC values was observed in primers umc1038 (0.79) and
bnlg1017 (0.85) and the lowest PIC values was observed in primer umc1946 (0.17).
PIC demonstrates the informativeness of the SSR loci and their potential to
detect differences among the varieties based on their genetic relationships. Legesse et
al., (2007) also reported an average PIC value of 0.58, but their highest PIC value
was 0.71 and also number of SSR loci having highest PIC values was very low. The
high level of polymorphism is due to diverse varieties and more variation of SSR loci
used in the present study.
SSRs comprised of dinucleotide repeats had the highest average PIC value of
0.85. These results were consistent with the results of Etten et al., (2008) who found
an average PIC value for all SSR loci of 0.62 and an average PIC value for
dinucleotide repeats of 0.70.
In contrast, trinucleotide repeats are more abundant in protein coding regions
(Toth et al., 2000) with relatively small repeat numbers and total length (Odeny et
al., 2007).
Table 2: Summary of genetic diversity at ten SSR loci in maize. Primer
name, bin location, repeat type, fragment size range (pb), no. of amplified
bands, number of alleles, heterozygosity and polymorphic information
content (PIC).
The genetic relationship between the varieties was determined using the
genetic distances. This difference between the two varieties can provide a good
estimate of how divergent they are genetically (Avise, 1994). The genetic
- 1773 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
relationships between the genotypes were estimated with Nei, (1972) standard
genetic distance (GD). Other authors also made use of (GD) estimates (Yu et al.,
2012). The matrix for genetic distance estimates is shown in Table 3.
The lowest genetic distance was (0.2410) between varieties IPA 5011 (lane 6)
and Sarah (lane 8) which means that the presence of similarity between these two
varieties is high degree using SSR markers; may be because they were from local
varieties and cultivated in the country, as well as morphological features and traits.
The highest genetic distance was (0.7853) between varieties DKC 6120 (lane
15) and Manlcet (lane 19) which means that the presence of similarity between them
are very low and they were collected from different geographical origins (Baghdad
cities and Kurdistan region respectively) but introduced to the country of the same
place (USA) (Table 3).
The genetic similarity values ranging from (0.2147 to 0.7590) depending up
on the genetic distance values ranging from (0.2410 to 0.7853), which indicate the
substantial diversity (24% to 78%) among the varieties used for this study. The range
of the genetic similarity obtained in this study were within the ranges reported by
Sedaf, (2010) in a set of temperate in inbred lines of maize (0.17 to 0.92). In tropical
and subtropical maize, Banisetti, (2012) reported a range of genetic similarities of
(0.16 to 0.88). Genetic distance (or similarity) can reveal the genetic diversity of
individuals (Sedaf, 2010).
Table 3: The genetic distance values between maize varieties studied in SSR analysis.
Yu et al., (2012) examined the genetic diversity of 80 inbred waxy maize
lines using 22 SSR molecular markers that could be used to achieve heterosis in
waxy maize and found the values genetic distance from (0.233 to 0.505). An SSR
marker used for diversity studies has recorded genetic distance range of 16-53%
among 14 genotypes of maize using four SSR markers (Sedaf et al., 2010). These
results agreement with results of the present study.
- 1774 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
High degree of genetic polymorphism was observed among the maize
genotypes is very important for improvement of maize crop with overall genetic
distance average ranged from 0 - 81% (Shah et al., 2009).
El-Maghraby et al., (2005) noted that the reason for the differences in the
genetic distance between varieties due to the effect of the environments.
Molecular markers are very useful in studying the relationship of closely
related lines as they allow calculation of genetic distance based on allele frequencies.
The SSR markers are usually scored in terms of presence or absence of a band which
can be described as a binary variable. There are several methods to calculate
distance/similarity coefficient of paired varieties (Johnson and Wichern, 2007).
Dendrogram construction relies on a clustering method and a distance coefficient
(Nei et al., 1983). Saitou and Nei (1987) recommended Neighbor–Joining method
(NJ) to construct dendrograms based upon the closest neighboring pair that
minimizes the total branch length of operational taxonomic units (OUTs).
The UPGMA clustering method was used assuming a constant rate of
evolution. In contrast, NJ method is based on the assumption of the minimum
evolution (Nei, 1991). However, Nei et al., (1983) suggested that the accuracy of a
phylogenetic tree depends on tree construction method and distance coefficients, and
more than one method should be employed for phylogenic tree construction (Kim,
1993).
Phylogenetic tree was constructed to determine the genetic differentiation.
The phylogenetic relationship between twenty varieties of maize was determined
from genetic distance estimate. The neighbor-joining method was used to obtain the
unrooted tree (Figure 5).
Analysis of results obtained from genetic distances (Table 3) and Neighborjoining dendrogram (Figure 5) revealed that, grouped all the 20 maize varieties into
two major groups: one small cluster A and a large cluster B.
The major group A comprised 4 varieties, while the cluster B comprised 16.
Cluster ‘A’ included Kr 640 (12), Manlcet (19), IPA 2052 (2) and DKC 6418 (20)
varieties while all the remaining varieties were grouped under the cluster B.
The cluster B was further subdivided into two sub clusters; the first sub
cluster containing from 6 varieties: IPA 5015 (3), IPA 5018 (5), DKC 5783 (16),
Biotech Bag (18), IPA 5012 (4) and 89 May 70 (17).
The second sub cluster containing from 10 varieties as following: Buhooth
106 (1), SNH 5610 (11), Al-Maha (9), Pio 3751 (14), DKC 6120 (15), IPA 5026 (7),
SNH 8605 (10), 3078 (13), IPA 5011 (6) and Sarah (8).
In the phylogenetic analysis, most of the maize varieties were not clustered
together in respect to their geographical origin, and thus, might have a similar
genetic background. Those clustered within the same group or subgroups are mostly
from the same origin and those, which are distantly grouped, were from different
geographical locations. These results suggest that the maize varieties in different
origins may have some common genetic bases. Thus, it would be possible for gene
flow between different geographic distributions. Struss and Plieske (1998) obtained
similar results: they observed no correlation between geographical origin of cultivars
and classification.
The variability of maize varieties cannot be explained only by the geographic
origin but by all factors together such as the year of release (the age of variety) and
pedigree (Leisova et al., 2007).
- 1775 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Figure 5: Unrooted Neighbor-joining tree representing the genetic
relationships between maize varieties using SSR markers.
The reason for this might be that similar genetic variation occurred
independently in different geographic regions or that artificial transfer of an
accession from one region to another resulted in a false determination of the
geographic origin. Uddin and Boerner, (2008) found that the most closely related
two varieties originated from different collection sites. Cluster analyses based on
microsatellite data of barley varieties showed that diversity in the studied sets was
not randomly distributed. Country of origin, age of variety and botanical characters
influenced the distribution of barley varieties into clusters to a large extent (Tomka et
al., 2013). These results agreement with results of the present study.The main goal of
plant breeding is to develop new and more versatile genotypes by introducing and
manipulating genetic variation. Estimations of genetic diversity and the relationship
between varieties are valuable resources for maize breeding. This is the first study to
use SSR markers to investigate the genetic relationship of the maize varieties grown
in Iraq. The results of the present study confirmed that these molecular markers are
capable of detecting polymorphism among maize varieties, estimating relatedness,
and identifying varieties with genotype-specific SSR markers. Finally, this study is
thought to contribute vital information for breeding programs and the development
of varieties resources.
Conclusions
SSR can reliably be used for the estimation of genetic diversity in crops of
commercial importance like maize. On the basis of dendrogram analysis, it has been
concluded that genotypes DKC 6120 (lane 15) and Manlcet (lane 19) were most
distantly related to each other.
- 1776 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
References
Avise, J. C. (1994). Molecular markers, natural history and evolution. pp: 230-235.
1st ed. Chapman and Hall, New York.
Banisetti, K. (2012). Identification of candidate gene based SSR markers for lysine
and tryptophan metabolic pathways in maize (Zea mays). Plant Breeding,
131(1): 20-27.
Bauer, I.; Drinic-Mladenovic, S. and Drinic, G. (2007). Assessing temporal
changes in genetic diversity of maize hybrids using RAPD markers. Cer. Res.
Comm., 35: 1563 -1571.
Cholastova, T.; Soldanova, M. and Pokorny, R. (2011). Random amplified
polymorphic DNA (RAPD) and simple sequence repeat (SSR) marker efficacy
for maize hybrid identification. African J. Biotech., 10(24): 4794-4801.
El-Maghraby, M. A.; Moussa, M. E.; Hana, N. S. and Agrama, H. A. (2005).
Combining ability under drought stress relative to SSR diversity in common
wheat. Euphytica, 14: 301-308.
Etten, J. S. W.; Lopez, M. R. F.; Monterroso, L. G. M. and Samayoa, K. M. P.
(2008).Genetic diversity of maize (Zea mays L. ssp. mays) in communities of
the western highlands of Guatemala: geographical patterns and processes.
Genet. Resour. Crop Evol., 55: 303-317.
Eyherabide, G.; Nestares, G. and Hourquescos, M. (2006). Development of a
heterotic pattern in orange flint maize. pp: 352–379. In: K. Lamkey and M. Lee
(eds.). Plant Breeding: The Arnel R. Hallauer International Symposium:
Blackwell Publishing.
Farhad, W.; Saleem, M. F.; Cheema, M. A. and Hammad, H. M. (2009). Effect of
poultry manure levels on the productivity of spring maize (Zea mays L.). The
Journal of Animal and Plant Sciences, 19(3): 122-125.
George, M. L.; Regalado, E.; Warburton, M.; Vasal, S. and Hoisington, D.
(2004). Genetic diversity of maize inbred lines in relation to downy mildew.
Euphytica, 135: 145-155.
Gurung, D. B.; George, M. L. and Cruz, Q. D. (2010). Analysis of genetic diversity
within Nepalese maize populations Using SSR markers. Nepal J. Sci. Technol.,
11: 1-8.
Hashemi, S.; Mirmohammadi-Maibody, S.; Nematzadeh, G. and Arzani, A.
(2009). Identification of rice hybrids using microsatellite and RAPD markers.
African J. Biotech., 8(10): 2094-2101.
Johnson, R. A. and Wichern, D. W. (2007). Applied Multivariate Statistical
Analysis. Pearson Education Inc. NJ. p. 773.
Kim, J. (1993). Improving the accuracy of phylogenetic estimation by combining
different methods. Systematic Biology, 42 (3): 331-340.
Kostova, A.; Todorovska, E.; Christov, N.; Sevov, V. and Atanassov, A. (2006).
Molecular characterization of Bulgarian maize germplasm collection via SSR
markers. Biotechnology and Biotechnology Equipment, 20: 29-36.
Kumari, J.; Gadag, R. N. and Prasanna, B. M. (2005). Molecular profiling of
maize (Zea mays L.) inbred lines using SSR markers. Indian J. Genet., 65(4):
249-252.
Legesse, B. W.; Myburg, A. A.; Pixley, K. V. and Botha, A. M. (2007). Genetic
diversity of African maize inbred lines revealed by SSR markers. Hereditas,
144: 10-17.
Leisova, L; Kucera, L. and Dotlacil, L. (2007). Genetic resources of barley and oat
characterized by microsatellites. Czech J. Genet. Plant Breed., 43(3): 97-104.
- 1777 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Li, Y.; Du, J.; Wang, T.; Shi, Y.; Song, Y. and Jia, J. (2002). Genetic diversity and
relationships among Chinese maize inbred lines revealed by SSR markers.
Maydica, 47: 93-101.
Ministry of Environmental and Forests (MEF). (2010). Series of Crop. Specific
Biology Documents. Biology of Maize. Ministry of Environmental and Forests.
Government of India. Available online at http://dbtbiosafety.nic.in/ guidelines/
maize.pdf.
Morales, M.; Decker, V. and Ornella, L. (2010). Analysis of genetic diversity in
Argentinian heterotic maize populations using molecular markers. Cien. Inv.
Agric., 37(1): 151-160.
Nei, M. (1972). Genetic distance between populations. American Naturalist, 106:
283-292.
Nei, M. (1991). Relative efficiencies of different tree-making methods for molecular
data. pp: 90-128. M. M. Miyamoto, and J. Cracraft (ed.) Phylogenetic analysis
of DNA sequences. Oxford University Press, Inc.
Nei, M.; Tajima, F. and Tateno, Y. (1983). Accuracy of estimated phylogenetic
trees from molecular data. J. Mol. Evol., 19: 153-170.
Odeny, D.; Jayashree, B.; Ferguson, M.; Hoisington, D.; Crouch, J. and
Gebhardt, C. (2007). Development, characterization and utilization of
microsatellite markers in pigeonpea. Plant Breeding, 126: 130-136.
Park, J. S.; Park, J. Y.; Park, K. J. and Lee, J. K. (2008). Genetic diversity among
waxy corn accessions in Korea revealed by microsatellite markers. Korean J.
Breed. Sci., 40(3): 250-257.
Qi-Lun, Y.; Ping, F.; Ke-Cheng, K. and Guang-Tang, P. (2008). Genetic diversity
based on SSR markers in maize (Zea mays L.) landraces from Wuling mountain
region in China. J. Genetics, 87(3): 287-293.
Rupp, J. V.; Mangolin, C. A.; Scapim, C. A. and Machado, M. F. P. S. (2009).
Genetic structure and diversity among sweet corn (su1-Germplasm) progenies
using SSR markers. Maydica, 54: 125-132.
Saitou, N. and Nei, M. (1987). The Neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol. Biol. Evol., 4(4): 406-425.
Sambrook, J. and Russell, D. W. (2001). In vitro application of DNA by the
polymerase chain Reaction, in molecular cloning: Chapter 8: 691-733. A
laboratory manual. 3rd ed., Cold Spring Harbor Laboratory Press, New York.
Sedaf, B. (2010). Genetic analysis of some commonly grown genotypes of maize in
Pakistan using maize specific simple sequence repeat (SSR) markers. Current
Res. J. Bio. Sci., 2(4): 259-261.
Senior, M. L.; Murphy, J. P.; Goodman, M. M. and Stuber, C. W. (1998). Utility
of SSRs for determining genetic similarities and relationships in maize using an
agarose gel system. Crop Sci., 38: 1088–1098.
Shah, Z.; Ali, I. M. S.; Iqbal, A.; Mumtaz, S.; Nwaz, R. and Swati, Z. A. (2009).
Genetic diversity of Pakistani maize genotypes using chromosome specific
simple sequence repeat (SSR) primer sets. African J. Biotech., 8(3):375-379.
Struss, D. and Plieske, J. (1998). The use of microsatellite markers for detection of
genetic diversity in barley populations. Theoretical and Applied Genetics, 97:
308–315.
Tomka, M.; Chnapek, M.; Balazova, Z. and Galova, Z. (2013). Differentiation of
barley genotypes based on DNA polymorphism. J. Microbiol. Biotech., 2
(Special issue on BQRMF): 1677-1684.
- 1778 -
Journal of Babylon University/Pure and Applied Sciences/ No.(6)/ Vol.(22): 2014
Toth, G.; Gaspari, Z. and Jurka, J. (2000). Microsatellites in different eukaryotic
genomes: survey and analysis. Genome Res., 10: 967-981.
Uddin, M. and Boerner, A. (2008). Genetic diversity in hexaploid and tetraploid
wheat genotypes using Microsatellite markers. Plant Tissue Cult. Biotech.,
18(1): 65-73.
Wang, X.; Rinehart, T. A.; Wadl, P. A.; Spiers, J. M.; Hadziabdic, D.;
Windham, M. T. and Trigiano, R. N. (2009). A new electrophoresis technique
to separate microsatellite alleles. African J. Biotech., 8(11): 2432-2436.
Warburton, M.; Xianchun, X.; Crossa, J.; Franco, J.; Melchinger, A.; Frisch,
M.; Bohn, M. and Hoisington, D. (2002). Genetic characterization of
CIMMYT maize Inbred lines and open pollinated populations using large scale
fingerprinting methods. Crop Science, 42: 1832-1840.
Weigand, F.; Baum, M. and Udupa, S. (1993). DNA Molecular Marker
Techniques, Technical Manual. No.20. International Center for Agricultural
Research in the Dry Areas (ICARDA). Aleppo, Syria.
Wu, M.; Jia, X.; Tian, L. and Lv, B. (2010). Rapid and reliable purity identification
of F1 hybrids of maize (Zea may L.) using SSR markers. Molecular Plant
Breeding, 4(3): 381-384.
Yao, L; Fang, K. and Guang, P. (2008). Genetic diversity based on SSR markers in
maize (Zea mays L.) landraces from Wuling mountain region in China. J.
Genet., 87:1-13.
Yen, T. O. and Prasanna, B. M. (2002). Analysis of genetic polymorphism among
downy mildew resistant and susceptible maize inbred lines using SSR markers.
Maize Genetic Cooperation, 75:41-42.
Yu, R. H.; Wang, Y. L.; Sun, Y. S. and Liu, B. L. (2012). Analysis of genetic
distance by SSR in waxy maize. Genet. Mol. Res., 11(1):254-260.
- 1779 -